alignments/CBrugiaQ_2326.align.Z


1.  Brugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
2. Brugia malayi L4 JHU93SL-BmL4
3. Brugia malayi adult female cDNA (SAW96MLW-BmAF)
4. Brugia malayi adult male cDNA (SAW94NL-BmAM)
5. Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
6. Brugia malayi infective L3 JHU93SL-BmL3
7. Brugia malayi infective L4 JHU93SL-BmL4
8. Brugia malayi infective larva cDNA (SAW94WL-BmL3)
9. Brugia malayi microfilaria cDNA (SAW94LS-BmMF)
10. Brugia malayi second stage larvae JHU96SL-BmL2
11. JHU93SL-BmL4 (JHU)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 2326 ******************** . : . : . : . : . : . : 364463_6+ GGGNG-TCTA-GACCCGAGTTTGAGAT-A-CAA---T-----GA---T------G---AT 36 364468_6+ GAGCGGT-TATGACCA-AGTTTGAGATT-TCAA---T-----TA---T------G---AT 37 276421_6+ CTGTTGGATTA---T------G---AT 15 276417_6+ GTGGATTA---T------G---AT 12 217669_6+ TNCATNNA---T------G---AT 12 727226_8+ GAGATTTCAATTA---T------G---AT 17 273953_6+ GA---T------GA-GCT 8 217720_6+ GTTTATAAACCCT-CCTATAA--AT 22 217684_6+ TCCCCTTCC-ATTATGAT 17 281222_6+ TGAT 4 ____________________________________________________________ consensus GAGCGGTCTATGACCAGAGTTTGAGATTATCAA--GTTNAATTA---T------G---AT 46 . : . : . : . : . : . : 364463_6+ ATT-ATC-AAT-A-T-T-T-ACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAG 89 364468_6+ ATT-ATC-AAT-A-T-T-T-ACTACTTAATATATCATATTAATTGGACAAGGAGTTCATG 90 276421_6+ ATT-ATC-AGT-A-T-T-T-ACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAG 68 276417_6+ ATT-ATC-AAT-A-T-T-T-ACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAG 65 217669_6+ ATT-ATC-AAT-A-T-T-T-ACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAG 65 727226_8+ ATT-ATC-AAT-A-T-T-T-ACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAG 70 273953_6+ -TTAATC-AAT-A-T-T-T-AGTCCTTTATATATCATATTAATTGNACAAGGAGTTCAAG 61 217720_6+ GTCCCCCCAAA-A-A-A-T-ATTTTTTNATATATCATATNAGCCNCCCAAAGAGNTCAAG 77 217684_6+ CT-C-TC-AAT-A-T---TAACTACTTTATATGTCATATCAATTGCACAAGGAGTTCAAG 69 281222_6+ ATT-ATC-AAT-A-T-T-T-ACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAG 57 276426_6+ TAAAATAATCAGT-TCCCACTACTTTATTTATCATGTTAATTGCACAAGGAGTTCAAG 57 281249_6+ TCATC-AAT-A-T-TCT-ACTACTTTATATATCACATTAATCGCACAAGGAGTTCAAG 53 217723_6+ CACTCTAT-ACTACTTTATNTATCATATTANTTGCACAAGGAGTTCAAG 48 354108_8+ ATTT-ACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAG 44 ____________________________________________________________ consensus ATT-ATC-AAT-A-T-T-T-ACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAG 99 . : . : . : . : . : . : 364463_6+ CATGGTGGTATCAACCAGTTGGTTATGGTTTTGG-TTATCATCATGCTTCTTGGTATCAT 148 364468_6+ CATGGTGGTACCAACCAGTTGGTTATGGTTTTGG-TTATCATCATGATTCTTGGTATCAT 149 276421_6+ CATGGTGGTATCAACCAGTTGGTTATGGTTTGGGGTTATCATCATGCTTCTTGGTATCAT 128 276417_6+ CATGGTGGTATCAACCAGTTGGTTATGGTTTGGG-TTATCATCATGCTTCTTGGTATCAT 124 217669_6+ CATGGTGGTATCAACCAGCTGGTTATGGTTTGGGGTTATCATCATGCTTCTTGGTATCAT 125 727226_8+ CATGGTGGTATCAACCAGTTGGTTATGGTTTTGG-TTATCATCATGCTTCTTGGTATCAT 129 273953_6+ CATGGTGGCATCAACCAGTTGGTTATGGTTTGGG-TTATCATCATGCTTCTTGGTATCAT 120 217720_6+ NATGGTGGTATCAACCAGTTGGTTATGGTTTGGG-CTATCATCATGCTTCTTGGTATCAT 136 217684_6+ CATGGTGGTATCAACCAGCTGGTTATGGTTTGGG-TTATCATCATGCTTCTCGGTATCAT 128 281222_6+ CATGGTGGTATCAACCAGTTGGTTATGGTTTGGG-TTATCATCATGCTTCTTGGTATCAT 116 276426_6+ CATGGTGGTATCAACCAGTTGGTTATGGTTTAGG-TTATCATCATGCTTCTTGGTATCAT 116 281249_6+ CATGGCGGTATCAACCAGTTGGTTATGGTTCGGG-TTATCATCATGATTCTTGGTATCAC 112 217723_6+ CATGGTGGNATCAACCAGTTGGTTATGGTTTGGG-TTATCATCATGCTTCTTGGTATCAT 107 354108_8+ CATGGTGGTATCAACCAGTTGGTTATGGTTTGGGGTTATCATCATGCTTCTTGGTATCAT 104 ____________________________________________________________ consensus CATGGTGGTATCAACCAGTTGGTTATGGTTTGGG-TTATCATCATGCTTCTTGGTATCAT 158 . : . : . : . : . : . : 364463_6+ CCTTATCCTGCTTTTGG-TCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 206 364468_6+ CCTTATCCTGCTTTTGG-TCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 207 276421_6+ CCTTATCCTGCTTTGGGGTCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 187 276417_6+ CCTTATCCTGCTTTGGGGTCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 183 217669_6+ CCTTATCCTGCTTTGGG-TCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 183 727226_8+ CCTTATCCTGCTTTTGG-TCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 187 273953_6+ CCTTATCCTGCTTTGGG-TCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 178 217720_6+ CCTTATCCTGCTTTTGG-TCCAATGCC-ATATTATCAGCCTCATCCCTATCATCCTTATC 194 217684_6+ CCTTATCCTGCTT-GGGGCCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 186 281222_6+ CCTTATCCTGCTT-GGGGTCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 174 276426_6+ CCTTATCCTGCTTTGGG-TCCAATGCCCATATTATCAGGCTCATCCTTATCATCCTTATC 175 281249_6+ CCTAATCCTGCTTTGGG-TCCAATGCC-ATATTATTAGTCTCATCCTTATCATCCCCATC 170 217723_6+ CCTTATCCTGCTTTGGG-TCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 165 354108_8+ CCTTATCCTGCTTTGTGGTCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 163 ____________________________________________________________ consensus CCTTATCCTGCTTTGGG-TCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATC 216 . : . : . : . : . : . : 364463_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 264 364468_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 265 276421_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 245 276417_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 241 217669_6+ ACTATGCTGATATTCATCACATGTATTCTGTAACATAAAGGTGCACAAATTGGTGC-TGC 242 727226_8+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 245 273953_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 236 217720_6+ ACTATGCTGATTTTCATCACATGTATTCTG-CACATAACGGTGCACAAATCGGTGCCTGC 253 217684_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 244 281222_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 232 276426_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 233 281249_6+ ACTATGCTGATATCCATCACATGTCTTCTG-AACATAAAGGTGCACAATTTGGAGT-TGC 228 217723_6+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 223 354108_8+ ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 221 ____________________________________________________________ consensus ACTATGCTGATATTCATCACATGTATTCTG-CACATAAAGGTGCACAAATTGGTGC-TGC 274 . : . : . : . : . : . : 364463_6+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GT-GAAATC-ATT- 320 364468_6+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GT-GAAATC-ATT- 321 276421_6+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GT-GAAATC-ATT- 301 276417_6+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GT-GAAATC-ATT- 297 217669_6+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAGGTGAAATTC-GC-GAAATC-ATN- 298 727226_8+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCCGT-GAAATC-ATT- 302 273953_6+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GT-GAAATC-ATT- 292 217720_6+ ACTTGGCTCATTGGCTGTAACTCTTGGTAGGAAGAAGTGAAATTC-GT-GAAATC-ACTC 310 217684_6+ ACTTGGCTCATTGGTTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GC-GAACTC-ATT- 300 281222_6+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GT-GAAATC-ATT- 288 276426_6+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GCCGAAATCAAT-- 290 281249_6+ ACTTGGCTCATTGGTTGNAAATCTTGGTCGGAAGAAGTGAAATTC-GT-GACATCCATCC 286 217723_6+ ACTTGGTTCATTGGCTGCAACTCTTGGTAGGAAGAAGTGAAAT-CCGC-GAAATC-ATT- 279 354108_8+ ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GN-GAAATC-ATT- 277 ____________________________________________________________ consensus ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GT-GAAATC-ATT- 330 . : . : . : . : . : . : 364463_6+ TATT-TTTTTC-TCATT---TTATGCTT-ATTTTAAT-TCT--GT-GT 370 364468_6+ TATT-TTTTTC-TCATT---TTATGCTT-ATTTTAAT-TCT--GT 372 276421_6+ TATT-TTTTTC-TCATT---TTATGCTT-ATTTCAAT-TCT--GT-GT 351 276417_6+ TATT-TTTTTC-TCATT---TTATGCTT-ATTTTAAT-TCT--GT-GT 347 217669_6+ TATT-TTTT 357 727226_8+ TATT-TTTTTC-TCATT---TTATGCTT-ATTTTAAT-TCT--GTTGTT-AAA 352 273953_6+ TATT-TTTTTC-TCATT---TTATGCTT-ATTTTAAT-TCT--GT-GT 342 217720_6+ -ATTCTTCCACCTCATC-C-TC-TGCTT-ATTTTNATCTCTGCGTC 365 217684_6+ TAT-CTTCCTC-TCATTTCC 358 281222_6+ TATT-TTTTTC-TCATT---TTATGCTT-ATTTTAAT-TCTGTGT 341 276426_6+ TATT-TTCTTC-TCATT---TTATGCTT-ATCTTACT-TCTGTGTC 343 281249_6+ TATT-TCTCCCCTTATA-CATT-TGCTTTATTCCACTCTCTTTGTGGCTCAAATAACCCC 343 217723_6+ TATT-TTCTTCCTCATT---TTATGCTT-ATTTAAAT-TCTGTGT 333 354108_8+ TATT-TTTTTC-TCATA---TTATGCTT-ATTTTAAT-TCT-TGT-GT 328 ____________________________________________________________ consensus TATT-TTTTTC-TCATT---TTATGCTT-ATTTTAAT-TCT--GT-GTTCAAATAACCCC 380 . : . : . : . : . : . : 281249_6+ CCCAT 348 ____________________________________________________________ consensus CCCAT 385

Date: 14:53:23 on Sun 17 Dec 117.