alignments/CBrugiaQ_2523.align.Z


1.  Brugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
2. Brugia malayi L4 JHU93SL-BmL4
3. Brugia malayi adult female cDNA (SAW96MLW-BmAF)
4. Brugia malayi adult male cDNA (SAW94NL-BmAM)
5. Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
6. Brugia malayi infective L3 JHU93SL-BmL3
7. Brugia malayi infective L4 JHU93SL-BmL4
8. Brugia malayi infective larva cDNA (SAW94WL-BmL3)
9. Brugia malayi microfilaria cDNA (SAW94LS-BmMF)
10. Brugia malayi second stage larvae JHU96SL-BmL2
11. JHU93SL-BmL4 (JHU)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 2523 ******************** . : . : . : . : . : . : 1381394_3+ GCGTTACACAGATGGTTGAGCAGCAGCTGGAGAAGCTATAAACAAAGCTTCATCCCCTTC 60 1366662_5+ CAGCAGCTGGAGAAGCTATAAACAAAGCTTCATCCCCTCC 40 530491_4+ TTC 3 ____________________________________________________________ consensus GCGTTACACAGATGGTTGAGCAGCAGCTGGAGAAGCTATAAACAAAGCTTCATCCCCTTC 60 . : . : . : . : . : . : 1381394_3+ ACAACTTCGAATTTCAGTTTCAACATCG-GCAGGCAATAATGGCGGAA-GATATTGATGA 118 1366662_5+ ACAACTTCGAATTTTAGTTTCAACATCG-GCAGGCAATAATGGCGGAA-GACATTGATGA 98 530491_4+ ACAACTTCGAATTTCAGTTTCAACATCG-GCAGGCAATAATGGCGGAA-GATATTGATGA 61 217585_8+ TCAGTTTCAACATCG-GCAGGCAATAATGGCGGAA-GATATTGATGA 45 444558_8+ TTTCN-CNTCG-GCAGGCAATAATGGCGGAA-GATATTGATGA 40 1277449_9+ TCAACATCG-GCAGGCAATAATGGCGGAA-GATATTGATGA 39 1277448_9+ TCAACATCG-GCAGGCAATAATGGCGGAA-GATATTGATGA 39 864039_8+ TCAACATCATGCAGGCAATAATGGCGGAA-GATATTGATGA 40 445082_8+ CNAN-TCG-GCNGGCNATAGTGGCGGAA-GATATNGATGA 37 756624_3+ GCAGGCAATAATGGCGGAA-GATATTGATGA 30 1261848_1+ GCANTAATGGCGGAA-GATATTGATGA 26 898626_3+ CAATAATGGCGGAA-GATATTGATGA 25 1098925_3+ CAATAATGGCGGAA-GATATTGATGA 25 864044_8+ TAATGGCGGAA-GATATTGATGA 22 438504_8+ TAATGGCGGAA-GATATTGATGA 22 1077728_8+ GGAAAGATATTGATGA 16 445203_8+ GGAA-GATATTGATGA 15 444725_8+ AA-GATATTGATGA 13 1261843_1+ AA-GATATTGATGA 13 896297_8+ A-GATATTGATGA 12 1235506_9+ A-GATATTGATGA 12 444609_8+ A-GATATTGATGA 12 291641_8+ A-GATATTGATGA 12 924596_8+ ATATTGATGA 10 1077736_8+ ATATTGATGA 10 481172_8+ TATTGATGA 9 300509_8+ TATTGATGA 9 ____________________________________________________________ consensus ACAACTTCGAATTTCAGTTTCAACATCG-GCAGGCAATAATGGCGGAA-GATATTGATGA 118 . : . : . : . : . : . : 1381394_3+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 177 1366662_5+ GATTCTGGCTGAAATTGATGG-CTCACAAA 157 530491_4+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 120 217585_8+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 104 444558_8+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTCCGACATGT 99 1277449_9+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 98 1277448_9+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 98 864039_8+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 99 445082_8+ GATTCTGGCTGAAATTGANCA-CTCNCAAATGGAGGAATATCAACCN-CCTNCGACATGT 95 756624_3+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 89 1261848_1+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 85 898626_3+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 84 1098925_3+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 84 864044_8+ GATTCTGGCTGAAATTGATGG-CTCACANNTTGAGGAATATCAAAAGTTCTTCGACATGT 81 438504_8+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTCCTCCGACATGT 81 1077728_8+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 75 445203_8+ GATTCTGGCTGAAATTGATGG-NTCACAAATTGAGGAATATCAAAAGTCCTCCGACATGT 74 444725_8+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTNCGACATGT 72 1261843_1+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 72 896297_8+ GATTCTGGCTGAAATTGATGGGCTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 72 1235506_9+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 71 444609_8+ GATTCTGGCTGAAATTGATGG-CTCNCAAATTGAGGAATATCAAAAGTTCTNCGACATGT 71 291641_8+ GATTCTGGCTGAAATTGATGG-CTCTCAAATTGAGGAATATCAAAAGTNCTCCGACATGT 71 924596_8+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 69 1077736_8+ NATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 69 481172_8+ GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTNCGACATGT 68 300509_8+ GATNCTGGCTGAAATTGATGG-CTCNCAAATTGAGGAATATCAAAAGTTCTTCGACATGT 68 ____________________________________________________________ consensus GATTCTGGCTGAAATTGATGG-CTCACAAATTGAGGAATATCAAAAGTTCTTCGACATGT 177 . : . : . : . : . : . : 1381394_3+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 236 530491_4+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 179 217585_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 163 444558_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 158 1277449_9+ TTGATCGTGGTAANCAG-GGCTACATCATGGCGNCACAAATTGGCCAGATTATGCATGCG 157 1277448_9+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 157 864039_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 158 445082_8+ CGGNTCGTGGNAAGCAG-CGNTACATCATNGN 154 756624_3+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 148 1261848_1+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 144 898626_3+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 143 1098925_3+ TTGATCGTGGTAAACAG-GACTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 143 864044_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACNAATTGGCCAGATTATGCATGCG 140 438504_8+ GTGATCGTGGNAAACAG-GGCTACATCATNGCAACACAAGTGGGCCAGATTATGCATGCG 140 1077728_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 134 445203_8+ NTGNTCGTGGTAAGCAG-NGNTACATCATNGNAACACAAGTNGGCCAGATTATGCATGCG 133 444725_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGNAACACAAGTTGGCCAGATTATGCATGCG 131 1261843_1+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 131 896297_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 131 1235506_9+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 130 444609_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 130 291641_8+ GTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAGTTGGCCAGATTATGCATGCG 130 924596_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 128 1077736_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 128 481172_8+ TTGATCGTGGTAAACAG-GGCTACATCATGGNAACACAAATTGGCCAGATTATGCATGCG 127 300509_8+ GTGATCGTGGTAAACAGTGGCTACATCATGGCAACACAANTNGGCCAGATTATGCATGCG 128 444765_8+ CTACATCATGGNAACACAANTNGGCCAGATTATGCATGCG 40 ____________________________________________________________ consensus TTGATCGTGGTAAACAG-GGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCG 236 . : . : . : . : . : . : 1381394_3+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATNTGACGCTG 294 530491_4+ ATGGAACAAGACTTTGATGAAAAGCAACTNC-GAAAGTTGATTC-GTAAATTTGACGCTG 237 217585_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 221 444558_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 216 1277449_9+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 215 1277448_9+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 215 864039_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 216 756624_3+ ATGGAACAAGACTTTGATGAANAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 206 1261848_1+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 202 898626_3+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 201 1098925_3+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 201 864044_8+ ATGGAACNAGACTTTGATGAANAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 198 438504_8+ ATGGAACAAGACTTCGATGAAAAGCACCTTC-GAAAGTTGNTTC-GTNAATTTGACGCTG 198 1077728_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 192 445203_8+ ATGGAACAAGGNTTNGATGAAAAGNACC 193 444725_8+ ATGGAACAAGACTTNGATGAAAAGCANCTTC-GAAAGTTGNTTC 190 1261843_1+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 189 896297_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 189 1235506_9+ ATGGAACAAGACTTTGATGAAAAGCAACTTCCGAAAGTTGATTCCGTAAATTTGACGCTG 190 444609_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 188 291641_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GANAGTTGATTC-GTNAATTTGACGCTG 188 924596_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 186 1077736_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 186 481172_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 185 300509_8+ ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGNTTC-GTAAGTTGGACGCTG 186 444765_8+ ATGGAACAAGACTTTGATGAAAAGCACCTTC-GAAAGTTGNTTC-GTNAATTNGACGCTG 98 ____________________________________________________________ consensus ATGGAACAAGACTTTGATGAAAAGCAACTTC-GAAAGTTGATTC-GTAAATTTGACGCTG 294 . : . : . : . : . : . : 1381394_3+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 353 530491_4+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 296 217585_8+ ATGGATCCGGAAAACTGGAGTTTGATGAATTC 281 444558_8+ ATGGATCCGGAAAACTGGAGTNTGATGAATTCTGTGCCCTC-GTCTACACCGGTGNCAAT 275 1277449_9+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 274 1277448_9+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 274 864039_8+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 275 756624_3+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 265 1261848_1+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 261 898626_3+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 260 1098925_3+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 260 864044_8+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 257 438504_8+ ATGGCTCCGGAAAACTGGGGTGTGATGANTTCTNCNCCCTC-NCCTACACCGGGGNCAAT 257 1077728_8+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 251 1261843_1+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 248 896297_8+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 248 1235506_9+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTCCGTCTACACCGTTGCCAAT 250 444609_8+ ATGGATCCGGAAAACTGGAGTTNGATGAATTCTGTGCCCTC-GNCTACACCGTTGCCAAT 247 291641_8+ ATGNNTCCGGAAAACTGGAGTTTGATGANTTCTGNNCCCTC-GTCTACACCGCNGTCAAT 247 924596_8+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 245 1077736_8+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 245 481172_8+ ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 244 300509_8+ ATGGATCCGGAAAACTGGNGTNGGATGANTTCTGNGCCCTC-GTCTACACCGGTGCCAAT 245 444765_8+ ATGGCTCCGGAAAACTGGAGTTTGATGANTTC 158 ____________________________________________________________ consensus ATGGATCCGGAAAACTGGAGTTTGATGAATTCTGTGCCCTC-GTCTACACCGTTGCCAAT 353 . : . : . : . : . : . : 1381394_3+ ACAGTC-GAT 412 530491_4+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCT 354 444558_8+ ACAGTC-GATAAGGAGACATCGCAACTGGAACTAAG-AGAAGCTCTCC-GACTTTTTG-A 331 1277449_9+ ACAGTC-GATAAGGAGACATTGCNAAAGGAACTAAG-ANAANCTTTCC-GACTTTTTG-A 330 1277448_9+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 330 864039_8+ ACAGTC-GATAAGGAGACNTTGCAAAAGGAACTAAG-AGAA-CTTTCC-GACTTTTTG-A 330 756624_3+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAA-AAAAGCTTTCC-GACTTTTTG-A 321 1261848_1+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAGGAGAAGCTTTCC-GACTTTTTG-A 318 898626_3+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 316 1098925_3+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-ATAAGCTTTCC-GACTTTTTG-A 316 864044_8+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 313 438504_8+ ACAGTC-GATAAGGAGACATAGCAAAACGAACTACG-AGAAGCTCNCC-NACTGGANG-A 313 1077728_8+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 307 1261843_1+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 304 896297_8+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAA-CTTTCC-GACTTTTTG-A 303 1235506_9+ ACAGTCCGATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCCCGACTTTTTG-A 308 444609_8+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 303 291641_8+ ACAGTC-GATAAGGAGACATTGCANCAGGAACTAAG-AGA 305 924596_8+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 301 1077736_8+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 301 481172_8+ ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTGG- 300 300509_8+ ACAGTC-GATAAGGAGACATNGCAAAAGGNACTAAG-AGAAGCTCTCC-TACTGGNNGGA 302 ____________________________________________________________ consensus ACAGTC-GATAAGGAGACATTGCAAAAGGAACTAAG-AGAAGCTTTCC-GACTTTTTG-A 409 . : . : . : . : . : . : 444558_8+ CAAA-GAGGGT-AATGGTTATATATCTC-GGC-AACCC-TGAAAGCA-CTTC-T-GAANG 383 1277449_9+ CAAA-GANGGT-NATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GANAG 383 1277448_9+ CAAA-GAGGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GAAAG 383 864039_8+ CAAA-GAAGGT-TATGGTTATATATCTC-NGCCA-NCC-TGAAA-CA-CTTC-T-GAAAG 381 756624_3+ CAAA-GAAGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GAAAG 374 1261848_1+ CAAAGGAGGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-TGGAAAG 373 898626_3+ CAAA-GAGGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GAAAG 369 1098925_3+ CAAA-GAAGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GAAAG 369 864044_8+ CAAA-GAAGGT-TATGGTTATATATCTC-NGCCA-CCCCTGAAAGCC-CTTCCT-GAAAG 367 438504_8+ CAN-GGAGGGT-AATNGTTTTTTCTCTC-GCCCCACCC-TGAAAGCA-CTTC-T-GAAAG 366 1077728_8+ CAAA-GAAGGTTAATGGTTATATATCTC-GGCCAACCCCTGAAA-CA-CTTCCT-GAAAG 362 1261843_1+ CAAA-GAGGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GAAAG 357 896297_8+ CAAA-GAAGGT-TATGGTTATATATCTC-GGCCA-CCC-TGAAA-C--CTTC-T-GAAAG 353 1235506_9+ CAAA-GAAGGTTAATGGTTATATATCTCCGGCCAACCC-TGAAAGCA-CTTCCT-GAAAG 364 444609_8+ CAAAAGAGGGT-AATGGTTATATTTCTC-GGCCAACCC-TGAAAGCA-CTTC-TTGAAAG 358 924596_8+ CAAA-GAGGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GAAAG 354 1077736_8+ CAAA-GAGGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GAAAG 354 481172_8+ CAAA-GAGGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-TTGAAAG 354 300509_8+ CAAAAGAGGGT-AATNTTTTTTTTTCTC-GGCCA-CCC-GGAAAGCAACTTC-T-GAAAG 356 ____________________________________________________________ consensus CAAA-GAGGGT-AATGGTTATATATCTC-GGCCAACCC-TGAAAGCA-CTTC-T-GAAAG 462 . : . : . : . : . : . : 444558_8+ AAA-TTGGT-GANGATCT-GAGCGACGACCAG-CTGGA 439 1277449_9+ AAA-TTGCT-GATGATCT-GAGCGACGAACAG-CTGGAA-GCCGCTG-T-TGACGANATA 436 1277448_9+ AAA-TTGCT-GATGATCT-GAGCGACGAACAG-CTGGAA-GCCGCTG-T-NGACGAAATA 436 864039_8+ AA--TTGCT-GATGATCT-GAGCGAC-AACA--CTGGAA-CCC-CTN-T-TAAC-AAATT 429 756624_3+ ATA-TTGCT-GATGATCT-GAGCGACGAACAG-CTGGAA-GCCGCTG-T-AGACGAAATA 427 1261848_1+ AAA-TTGCT-GATGATCT-GAGCGACNAACAG-CTGGAA-NCCGCTG-T-ANACGAAATA 426 898626_3+ AAA-TTGCT-GATGATCT-GA 426 1098925_3+ AAA-TTGCT-GATGATCT 427 864044_8+ AAA-TTGCT-GATGATCT-GANCGACNAACA--CTNGAACCCC-CTG-TTTAACAAAATA 420 438504_8+ AAAATTGNT-GATGATCTTGNGCGACGAGCAG-NTGG 424 1077728_8+ AAA-TTGCT-GATGATCT-GAGCGACNAACAG-CTGGAA--CCGCTGGT-NAAC-AAATA 414 1261843_1+ AAA-TTGCT-GATGATCT-GAGCGACGAACAG-CTGGAA-GCCGCTG-T-AGACGAAATA 410 896297_8+ AA--TTGCT-GATGATCT-GACC-AC-AACA--CTGGAN--CC-CTG-T--NAC-A-ATA 397 1235506_9+ AAA-TTGCT-GATGATCT-GAGCGACGAACAG-CTGGAA-CCC-CTGTTTNAACAAAATT 418 444609_8+ AAAATTGCTTGATGATCTTGAGCGACGAACAGGTTGGAANGCCNCTG-T-NGACGAAATN 416 924596_8+ AAA-TTGCT-GATGATCT-GAGCGACGAACAG-CTGGAA-GCCGCTG-T-NGACGAAATA 407 1077736_8+ AAA-TTGCT-GATGATCT-GAGCGACGAACAG-CTGGAA-GCCGCTG-T-NNACGAAATA 407 481172_8+ AAA-TTGCT-GATGATCTTGAGCGACGA-CAGGCTGGAA-GNCGTTG-T-AGACGAAATA 408 300509_8+ AAN-TTGNT-GATGATCT-CAGCGACCAACAAGNTGCCCCCCC 413 530426_8+ GATATT 6 ____________________________________________________________ consensus AAA-TTGCT-GATGATCT-GAGCGACGAACAG-CTGGAA-GCCGCTG-T-NGACGAAATA 515 . : . : . : . : . : . : 1277449_9+ NATGATGAT-GGTTC-TGGAAAGATT-GAATTTGAA-GAATTTTGGGAA-TTAATGGGCG 491 1277448_9+ GATGAAGAT-GGTTC-TGGAAAGATT-GAATTTGAA-GAATTTTGGGAA-TTAATGGCCG 491 864039_8+ AAT-AAGAT-GGT-CNTGGAAAAAT--NA-TTTNAA-AAATTT-GGGAATTTN 481 756624_3+ GATGAGGAT-GGTTC-TGGANAGATT-GAATTTGAA-GAATTTTGGGAA-TTAATGGCCG 482 1261848_1+ GATNAGGAT-GGTTC-TGGAAAGATT-GAATTTG 483 864044_8+ AATTAGGATNGGTCCCTGGAAAAATTTGAATTTGAAAAAATTTTGGGAAA 480 1077728_8+ AAT-NGGAT-GGTNCCTGGAAA-ATT-GNATTTGNA-AAATTTTGGGA 469 1261843_1+ GATGAGGAT-GGTTC-TGGAAAGATT-GAATTTGAA-GAATTTTGGGAA-TTAATGGCCG 465 896297_8+ -AT-A-GAT--GT-CCT-GA-AGAT--GA-TTT-AA--AATTT--GGA--TT-ATGC 438 1235506_9+ NATGAAGAT-NGTTCCTNGAAAGATTTGAATTTGAAAGAATTTTGGGAA-TTAATGGGCG 476 924596_8+ GATGAGGAT-GGTTC-TGGAAAGATT-GAATTTGAA-GAATTTTGGGAA-TTAATGGCCG 462 1077736_8+ GATGAGGAT-GGTTC-TGGAAAGATT-GAATTTGAA-GAATTTT 463 481172_8+ GATGAGGAT 468 530426_8+ GATGA-GAT---T-C-TGGAAAGATT-GAATTTGAA-GAATTTTGGGAA-TTAATGGCCG 57 1193961_5+ CA 2 ____________________________________________________________ consensus GATGAGGAT-GGTTC-TGGAAAGATT-GAATTTGAA-GAATTTTGGGAA-TTAATGGCCG 570 . : . : . : . : . : . : 1277449_9+ -GTGATGCTGACTGAACAATAACAGTTGACN-ATT-TCTAACCTTTC-TTTTTGAATTTA 547 1277448_9+ -GTGATGCTGACTGAACAATAACAGTTGACA-ATT-TCTAACCTTTC-TTTTTGAATTTA 547 756624_3+ -GTGATGCTGACTGAACAATAACAGTTGACA-ATT-TCTAACCTTTC-TTTTTGAATTTA 538 1261843_1+ -GTGATGCTGACTGAACAATAACAGTTGACA-ATT-TCTAACCTTTC-TTTTTGAATTTA 521 1235506_9+ -GTGATGCTGACTGAACCATAACCGTTGACA-ATT-TCTAACCTTTCCTTTTTGAATTTA 533 924596_8+ -GTGATGCTGACTG 521 530426_8+ -GTGATGCTGACTGAACAATAACAGTTGACA-ATT-TCTAACCTTTC-TTNGNGAATTTA 113 1193961_5+ CGAG-TGCTGACTGGGCACCCACCGTTGACATAAT-G--AACCTTTC-TTTTTGAATTTT 57 1193875_5+ CTGACTGAGCAATAACAGTTGAGA-ATCCTCTAACCTTTC-TAATTGAATTTT 51 1366846_5+ TTGACA-ATT-TTTAACCTTTC-TTTTTGAATTTT 32 ____________________________________________________________ consensus -GTGATGCTGACTGAACAATAACAGTTGACA-ATT-TCTAACCTTTC-TTTTTGAATTTA 626 . : . : . : . : . : . : 1277449_9+ -ATTACTGGTACGAAAATCTGCCTATATTTATC-GTTTGTTGTTCTAT-----ATGTT-T 599 1277448_9+ -ATTACTGGTTCGAAAATCTGCCTATATTTATC-GTTTGTTGTTCTAT-----ATGTT-T 599 1261843_1+ -ATTACTGGTACGAAAATCTGCCTATATTTATC-GTTTGTTGTACTAT-----ATGTTAT 574 1235506_9+ -ATTACTGGTTCGAAAATCTGCCTATATTTATCCGTTTGTTGTTCTAT-----ATGTTNT 587 530426_8+ -ATTACTGGTACGAAAATCTGCCTATATTTATC-GNTTGTTGTACTAT-----ATGT-AT 165 1193961_5+ GATTACTGGTACGAAAATCGGCCTGTATTTATG-GTTTGTTGTACGATGCTAAATGT-AT 115 1193875_5+ GATTACTGGTACTAAAATAGGCCTGTATTTATG-GTTTGTTGTACTATGCTATATGT-AC 109 1366846_5+ GATTACTGGTACGAAAATCGGCCTGTATTTATG-GTTTGTTGTACGATGCTATATGT-AT 90 ____________________________________________________________ consensus -ATTACTGGTACGAAAATCTGCCTATATTTATC-GTTTGTTGTACTAT-----ATGTTAT 679 . : . : . : . : . : . : 1277449_9+ TATCCATGTT-ATTGAAATNTTTTTTA-GATTTGAAATTAACNTN-TTT 656 1277448_9+ TATCCATGTT-ATNGAAATNTTTT-TAAGATTTGAAAT-AACTTT-TTT 655 1261843_1+ TATCAATGTT-ATAGAAATATTTT-TAAGATATGAAATAAACATTATTTAAATATAATTT 632 1235506_9+ TATCCATGTTTNTNGAAATNTTTTTTAAGATNTGAAATTAACCTTATTTNAATTTTATTT 647 530426_8+ TATCAATGTT-ATAGAAATATTTT-TAAGATATGAAATAAACATTATTTAAATATAATTT 223 1193961_5+ TATCTATATT-AGAGAAACATTTT-TAAGATATGAAATAAATATTATTTAAATATAATTT 173 1193875_5+ TATCAAAATT-AGAGAAAC-TTTTCTAAGATATGAAATAAATATTATCTAAATATAATTT 167 1366846_5+ TATCAATATT-AGAGAAACATTTT-TAAGATATGAAATAAATATTATTTAAATATAATTT 148 ____________________________________________________________ consensus TATCAATGTT-ATAGAAATATTTT-TAAGATATGAAATAAACATTATTTAAATATAATTT 737 . : . : . : . : . : . : 1235506_9+ TAATAA-CGATCGATTTCC 702 530426_8+ -AATAAACGATCGATTACGTGAACTAAA 278 1193961_5+ -AATAAACGATCGACTATGTGAAAAAAAAAAAAAAAAACCCCGGGGGGGGGCCGGG 228 1193875_5+ -AATAAACGATCGACT 222 1366846_5+ -AATAAACGATCGACT 203 ____________________________________________________________ consensus -AATAAACGATCGACTACGTGAAAAAAAAAAAAAAAAACCCCGGGGGGGGGCCGGG 792

Date: 17:10:48 on Mon 18 Dec 117.