alignments/CBrugiaQ_266.align.Z


1.  Brugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
2. Brugia malayi L4 JHU93SL-BmL4
3. Brugia malayi adult female cDNA (SAW96MLW-BmAF)
4. Brugia malayi adult male cDNA (SAW94NL-BmAM)
5. Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
6. Brugia malayi infective L3 JHU93SL-BmL3
7. Brugia malayi infective L4 JHU93SL-BmL4
8. Brugia malayi infective larva cDNA (SAW94WL-BmL3)
9. Brugia malayi microfilaria cDNA (SAW94LS-BmMF)
10. Brugia malayi second stage larvae JHU96SL-BmL2
11. JHU93SL-BmL4 (JHU)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 266 ******************** . : . : . : . : . : . : 910000_9- GCCAGTTGNGGGCAAAAAGGTAAATGTTTGTAAATACCGCAAATTGTCCTGGTAATTGTG 60 ____________________________________________________________ consensus GCCAGTTGNGGGCAAAAAGGTAAATGTTTGTAAATACCGCAAATTGTCCTGGTAATTGTG 60 . : . : . : . : . : . : 910000_9- GGTTTGGGCGCCNAAAATTTTGTCCANGTTGTCCCCAAACGTTGCCGTTATTNAGTTCAC 120 ____________________________________________________________ consensus GGTTTGGGCGCCNAAAATTTTGTCCANGTTGTCCCCAAACGTTGCCGTTATTNAGTTCAC 120 . : . : . : . : . : . : 910000_9- CCAAAACCTGGTTGCAAGTATTGCNTGCCTGGGAAGGCCTTCGGGTGCATATTGACGATA 180 ____________________________________________________________ consensus CCAAAACCTGGTTGCAAGTATTGCNTGCCTGGGAAGGCCTTCGGGTGCATATTGACGATA 180 . : . : . : . : . : . : 910000_9- TTGTTGCTGTGAATAGAATTGCTGGGCAGCAGTAATAACATTTGTCGAATTTTGAACCGA 240 ____________________________________________________________ consensus TTGTTGCTGTGAATAGAATTGCTGGGCAGCAGTAATAACATTTGTCGAATTTTGAACCGA 240 . : . : . : . : . : . : 910000_9- CTGTGCTTGTTGCTGTTGTATTAACTTTGAAAAAATCCTGTGCCGAAGTGGTAATGGTGG 300 ____________________________________________________________ consensus CTGTGCTTGTTGCTGTTGTATTAACTTTGAAAAAATCCTGTGCCGAAGTGGTAATGGTGG 300 . : . : . : . : . : . : 910000_9- TAGTGCATGATGTTGTTGGTGCAGAAATCTGTTGTTGTTGCTGCTGTTGCTGTTGTTGCT 360 ____________________________________________________________ consensus TAGTGCATGATGTTGTTGGTGCAGAAATCTGTTGTTGTTGCTGCTGTTGCTGTTGTTGCT 360 . : . : . : . : . : . : 910000_9- GCGGTCTAACAGCTGCAATTTGTTGATTTGTACCGAAATATTGTGTTGCCGACATCATAT 420 867546_9- AACCGACATATTGTGTCCCCAACATCATAT 30 ____________________________________________________________ consensus GCGGTCTAACAGCTGCAATTTGTTGATTTGAACCGAAATATTGTGTCCCCAACATCATAT 420 . : . : . : . : . : . : 910000_9- AGCATTGGCCATTATGGTGAACAAGCATGAACTGTCCAGGCGACGCAGAAGTTAGCATTA 480 867546_9- TGCAT-GGCCGTTNTGGTGAACA-GCATGAACTNTCCAGG-GACGCAGAACTTTGCATTC 87 ____________________________________________________________ consensus AGCATTGGCCATTATGGTGAACAAGCATGAACTGTCCAGGCGACGCAGAACTTAGCATTA 480 . : . : . : . : . : . : 910000_9- ACGGTGCTTGCGGAACCATTTGAGTAGCAGAAGATGAACTGACGACTGCGGTCGAAGTTT 540 867546_9- ACGGTGCTAGCGGTACCATTTGAGTAGCAGAAGATGAAGAGACGACTGCGGTCGAAGTGT 147 ____________________________________________________________ consensus ACGGTGCTAGCGGAACCATTTGAGTAGCAGAAGATGAACAGACGACTGCGGTCGAAGTGT 540 . : . : . : . : . : . : 910000_9- TTGTCTTATCAGTGGAGTCCTTTTTACTACGAGATGTTGGTTTACGGCGACTTTTTGGCG 600 867546_9- TTGTCTNNTCAGTGGAGTCNTTTTNACNACGAGANGCTGCTTNGCGGCGACTTTATGGCG 207 ____________________________________________________________ consensus TTGTCTTATCAGTGGAGTCCTTTTTACTACGAGATGCTGCTTTACGGCGACTTTATGGCG 600 . : . : . : . : . : . : 910000_9- CTGGTTGTGGTGTTGATGATGTTGAAGAAGCCCTCGTGCCGAATCTT 660 867546_9- CTGGTTGTGGTGTTGATGATGTTGAAGANGCCGTC-T-CGGCNT-TNCTACNACTTGCTG 264 ____________________________________________________________ consensus CTGGTTGTGGTGTTGATGATGTTGAAGAAGCCCTCGTGCCGAATCTTCTACNACTTGCTG 660 . : . : . : . : . : . : 867546_9- ANATTGTNGTTGCTTCTTCAGCTGCTGCNCTACCTTCAGCGCTAACATTAGTTGCATTTA 324 ____________________________________________________________ consensus ANATTGTNGTTGCTTCTTCAGCTGCTGCNCTACCTTCAGCGCTAACATTAGTTGCATTTA 720 . : . : . : . : . : . : 867546_9- TTGTATCCGATATTACNCTCTTACTCGATGATGACACAGNNATGNTAGCAGAGGCTGANG 384 ____________________________________________________________ consensus TTGTATCCGATATTACNCTCTTACTCGATGATGACACAGNNATGNTAGCAGAGGCTGANG 780 . : . : . : . : . : . : 867546_9- TNACTTGCATTGNAT 399 ____________________________________________________________ consensus TNACTTGCATTGNAT 795

Date: 17:24:56 on Mon 18 Dec 117.