alignments/CBrugiaQ_2864.align.Z


1.  Brugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
2. Brugia malayi L4 JHU93SL-BmL4
3. Brugia malayi adult female cDNA (SAW96MLW-BmAF)
4. Brugia malayi adult male cDNA (SAW94NL-BmAM)
5. Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
6. Brugia malayi infective L3 JHU93SL-BmL3
7. Brugia malayi infective L4 JHU93SL-BmL4
8. Brugia malayi infective larva cDNA (SAW94WL-BmL3)
9. Brugia malayi microfilaria cDNA (SAW94LS-BmMF)
10. Brugia malayi second stage larvae JHU96SL-BmL2
11. JHU93SL-BmL4 (JHU)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 2864 ******************** . : . : . : . : . : . : 1048102_3- TTCATCCGCATCATAATCGAAAATTTCATTTTCATCCATTGCTTCCTTTGTGTAAAACAG 60 ____________________________________________________________ consensus TTCATCCGCATCATAATCGAAAATTTCATTTTCATCCATTGCTTCCTTTGTGTAAAACAG 60 . : . : . : . : . : . : 1048102_3- CACTGCTCTAGGCACAATTTGGTCACGGAATAGCTGACCAATCTCAAAATCAGCTTGCAA 120 ____________________________________________________________ consensus CACTGCTCTAGGCACAATTTGGTCACGGAATAGCTGACCAATCTCAAAATCAGCTTGCAA 120 . : . : . : . : . : . : 1048102_3- CAGTTCCTGAGTTTCAATGTCATCATCATTTCCACTGATTTCATTCTTATTTTCCATGAG 180 898464_3- G 1 ____________________________________________________________ consensus CAGTTCCTGAGTTTCAATGTCATCATCATTTCCACTGATTTCATTCTTATTTTCCATGAG 180 . : . : . : . : . : . : 1048102_3- TGGAGGGTCGAAGAAGTTGAAGAAAGAGTCAGCTTTCACAGTTTTCGTAATGAAACGACC 240 898464_3- TGGAGGGTCGAAGAAGTTGAAGAAAGAGTCAGCTTTCACAGTTTTCGTAATGAAACGACC 61 ____________________________________________________________ consensus TGGAGGGTCGAAGAAGTTGAAGAAAGAGTCAGCTTTCACAGTTTTCGTAATGAAACGACC 240 . : . : . : . : . : . : 1048102_3- AGCAGCGCTGCCTTTCTTCTGCTTTTTCTTAATAATTTTCTTTGTAACGTTTTTTCCCTC 300 898464_3- AGCAGCGCTGCCTTTCTTCTGCTTTTTCTTAATAATTTTCTTTGTAACGTTTTTTCCCTC 121 ____________________________________________________________ consensus AGCAGCGCTGCCTTTCTTCTGCTTTTTCTTAATAATTTTCTTTGTAACGTTTTTTCCCTC 300 . : . : . : . : . : . : 1048102_3- TTTCCAATCTATTTCGGTACCTTTAGCATTAAT 360 898464_3- TTTCCAATCTATTTCGGTACCTTTAGCATTAATTATTACTGGACCATCGTAATCAAAAAT 181 ____________________________________________________________ consensus TTTCCAATCTATTTCGGTACCTTTAGCATTAATTATTACTGGACCATCGTAATCAAAAAT 360 . : . : . : . : . : . : 898464_3- ATCGTCTTCATCCGGAGCAACTTGTAGGGTATAAAATTTCTTCAACTCTGTCTGAGTGAA 241 ____________________________________________________________ consensus ATCGTCTTCATCCGGAGCAACTTGTAGGGTATAAAATTTCTTCAACTCTGTCTGAGTGAA 420 . : . : . : . : . : . : 898464_3- ATATTCATTGGGTTCGAAATGGAATGTCAGGGTATATGAATCCGGG 287 ____________________________________________________________ consensus ATATTCATTGGGTTCGAAATGGAATGTCAGGGTATATGAATCCGGG 466

Date: 17:15:36 on Mon 18 Dec 117.