alignments/CBrugiaQ_420.align.Z


1.  Brugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
2. Brugia malayi L4 JHU93SL-BmL4
3. Brugia malayi adult female cDNA (SAW96MLW-BmAF)
4. Brugia malayi adult male cDNA (SAW94NL-BmAM)
5. Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
6. Brugia malayi infective L3 JHU93SL-BmL3
7. Brugia malayi infective L4 JHU93SL-BmL4
8. Brugia malayi infective larva cDNA (SAW94WL-BmL3)
9. Brugia malayi microfilaria cDNA (SAW94LS-BmMF)
10. Brugia malayi second stage larvae JHU96SL-BmL2
11. JHU93SL-BmL4 (JHU)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 420 ******************** . : . : . : . : . : . : 885495_9- GGTTTTTTTTTTAAAAA-T-CATCTTT--ATTTTCTAACAT-GGACC-GGTAA-TACAAA 53 885480_9- TAAAAAAT-CATCTTTT-ATTATCTAACAT-AGACC-AGTAAATACAAA 45 871313_9- AAAAAAT-CATCTTTT-ATTATCTAAC-TTAGACC-AGTAAATACAAA 44 885597_9- AAAAAATT--TTTTTTTATTATTTAAACT-GGGCCCGGTAAAAACAAA 45 1221245_9- AAAAAATTCATCTTTT-ATTATCTAAAAT-AGACC-AGTAA-TACAAA 44 1191887_9- TTCATCTTTTTATTATCTAACAT-AGACCCAGTAAATACAAA 41 1191924_9- TCATCTCTTTATTATCTAACAT-AGACC-AGTAAATACAAA 39 1213907_9- TCATCTTTT-ATTATCTAACAT-AGACC-AGTAAATACAAA 38 1191933_9- ATCTAACAT-GGACC-GGTAAATACAAA 26 867584_9- ATCTAACATTAGACC-AGTAA-TACAAA 26 ____________________________________________________________ consensus GGTTTTTTTTTTAAAAAATTCATCTTTT-ATTATCTAACAT-AGACC-AGTAAATACAAA 57 . : . : . : . : . : . : 885495_9- ACCAAATAGGAGG-GATAATT-CGTTGCCAAATG-AGTATCA-CTTAAA-CATTAAATAT 108 885480_9- ACAAAATATGAGG-AATAAAT-CGTTGCCAAATG-AGTATCA-CTTAA--CATTAAATAT 99 871313_9- ACAAAATAGGAGG--ATAAAT-CGTTGCCAAATG-AGTATCA-CTTAA--CATTAAATAT 97 885597_9- ACCAAATGGG-GGGGATATTT-TGTTGCCAA-GGGGGTATCA-ATTAAA-CATTAAATA- 99 1221245_9- ACAAAATAGGAGG--ATAATT--GTTGCCAAATG-AGT-TCA-ATTAAA-CATTAAATAT 96 1191887_9- ACAAAATATGAGGGAATAAAT-CGTTGCCAAATG-AGTATCA-CTTAA--CATTAAATAT 96 1191924_9- ACAAAATATGAGG-AATAAAT-CGTTGCCAAATG-AGTATCA-CTTAA--CATTAAATAT 93 1213907_9- ACAAAATATGAGGGAATAAAT-CGTTGCCAAATG-AGTATCA-CTTAA--CATTAAATAT 93 1191933_9- ACAAAATNGGAGG--ATAAATTCGTTGCCAAATGGAGTATCAACTTAA--CATTAAATAT 82 867584_9- -CAAAATATGAGG--ATAA-T-CGTTGCCAAATG-AGTATCA-CTTA---CATTAA-TAT 75 683802_9- TATTT-TGTTGCCAAAGGGGGTTTCA-ATTAAAACATTAAATNT 42 1153854_3- TAAAT-CGTTGCCAAATG-AGTATCA-CTTAA--CATTAAATAT 39 ____________________________________________________________ consensus ACAAAATAGGAGG-AATAAAT-CGTTGCCAAATG-AGTATCA-CTTAA--CATTAAATAT 111 . : . : . : . : . : . : 885495_9- -ACAATCTA--ACA-AGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ATT-CATA-GAT 156 885480_9- -ACAATCTA--ACA-CGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ACT-CATA-GAT 147 871313_9- -ACAATCTA--ACA-CGC-AAAGATCA-GTTCTGG-AGTAAG-CATG-ATT-CATA-GAT 146 885597_9- AACAATCTA--A-A-AGC-AAGGATCA-GTT--GGGAGTAGG-CATG-ATT-CATA-GAT 147 1221245_9- -ACAATCTA--ACA-CGC-AAAGGTCA-GTTC-GG-AGTAAG-CATGAA-T-CATA-GAT 144 1191887_9- -ACAATCTA--ACA-CGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ACTTCATA-GAT 145 1191924_9- -ACAATCTA--ACA-CGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ACT-CATA-GAT 141 1213907_9- -ACAATCTA--ACA-CGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ACT-CATA-GAT 141 1191933_9- -ACAATCTA--ACA-CGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ACTTCATA-GAT 131 867584_9- -ACAATCTA---CA-CGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ACT-CATA-GAT 122 683802_9- NACATTTTAAAACAACGC-AAGGTTCA-GTTTTGGGAGTAAGGCAGGGAATTCATAGGAT 100 1153854_3- -ACAATCTA--ACA-CGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ACT-CATA-GAT 87 867579_9- ACAATCTA--ACA-CGCCAAAGATCA-GTTCNG--AGTAGG-CANG-A-T-CATA-GAT 48 445168_9- CTA--NCA-C-CCAAAGATCAAGT-CTG--AGTAAG-CATG-ACT-CATAAGAT 44 1153862_3- AAGATCA-GTTCTG--AGTAAG-CATG-ACT-CATA-GAT 33 ____________________________________________________________ consensus -ACAATCTA--ACA-CGC-AAAGATCA-GTTCTG--AGTAAG-CATG-ACT-CATA-GAT 159 . : . : . : . : . : . : 885495_9- TTGTGGCCCT-AAAG--AGGCCCG-TTGG--TTTTGTG-CGCA-TA-CA-GATAATTA-C 205 885480_9- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 197 871313_9- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 196 885597_9- TGG-GGCCCTTAAAG--AGG-CCG-TTGG---TTTGGGGCGCA-TA-CA-GATAAT-AAC 195 1221245_9- TTGTGGCC-TTAAAG--AGG-CCG-TTGG--TTTTGTG-CGCA-TA-CA-GATAATTA-C 192 1191887_9- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 195 1191924_9- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 191 1213907_9- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 191 1191933_9- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 181 867584_9- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 172 683802_9- TTGTGGCCCTTAAAGGGAGGGCCGGTTGGGGTTTTGTGGCGCA-TAACA-GATAATTAAC 158 1153854_3- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 137 867579_9- TNGTGGCCNT-AAAG--AGG--CG-TTGG---TTTGNG-CGCA-TA-CA-GATAATTA-C 94 445168_9- TTGTGGCCCTAAAAG--AGG-CCG-TTGGT-TTTTGTG-CGCAATA-CAAGATAATTA-C 96 1153862_3- TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 83 1116152_3- A-TA-CA-GATAATTA-C 14 898352_3- A-GATAATTA-C 10 898505_3- GATAATTA-C 9 522100_4- AAC 3 ____________________________________________________________ consensus TTGTGGCCCT-AAAG--AGGGCCG-TTGGG-TTTTGTG-CGCA-TA-CA-GATAATTA-C 209 . : . : . : . : . : . : 885495_9- A-CG-CTG-ATGG-TT-TC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 251 885480_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 244 871313_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCACA-CAA- 243 885597_9- A-CG--TG-ATGG-TTTT--GT-AAGTTCGT-CTTAACC-ACC---AAAACCATA-CAA- 240 1221245_9- A-CG--TG-ATGG-GT-TC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 237 1191887_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 242 1191924_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 238 1213907_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 238 1191933_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 228 867584_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 219 683802_9- AACGGCTGGATGGGTTTTC-GT-AAGGTTGTTCTTAACC-ACCC--AAAACCATAACAA- 212 1153854_3- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 184 867579_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 141 445168_9- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACCC--AAAACCATA-CAA- 144 1153862_3- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 130 1116152_3- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 61 898352_3- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 57 898505_3- A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 56 522100_4- G-CGCCTGGGTGGGGTCTCCGTGAAGGTCGTCCTTANCCCACCCAAAAAACCATA-CAAA 61 1153609_3- C-ACC---AAAACCATA-CAA- 16 ____________________________________________________________ consensus A-CG-CTG-ATGG-GTCTC-GT-AAGGTCGT-CTTAACC-ACC---AAAACCATA-CAA- 256 . : . : . : . : . : . : 885495_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 304 885480_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 297 871313_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 296 885597_9- TG-AACGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 293 1221245_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 290 1191887_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 295 1191924_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 291 1213907_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 291 1191933_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 281 867584_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 272 683802_9- TGTAACGTCCCTTGGGCGTTTTCAAAGGCATA-GAACAACATCCATTGCTGTAACTGNCT 271 1153854_3- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 237 867579_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 194 445168_9- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 197 1153862_3- TGTA-CGTCC-TTGG-CGTTT-CGACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 183 1116152_3- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 114 898352_3- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 110 898505_3- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 109 522100_4- TGGA-CGTCC-TTGG-CGTTT-CAACG-CATAAGA-CAACATCCATTGCTGTAACTGTCT 115 1153609_3- TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTTTCT 69 898336_3- ATA-GA-CAACATCCATTGCTGTAACTGTCT 29 ____________________________________________________________ consensus TGTA-CGTCC-TTGG-CGTTT-CAACG-CATA-GA-CAACATCCATTGCTGTAACTGTCT 309 . : . : . : . : . : . : 885495_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 359 885480_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 352 871313_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 351 885597_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 348 1221245_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 345 1191887_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 350 1191924_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 346 1213907_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 346 1191933_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 336 867584_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 327 683802_9- TTTCGTTTTCGGCGTGCTCACAATATGTTACAGCGTCACGTATGACATTTCTCCAAAAA- 330 1153854_3- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 292 867579_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 249 445168_9- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCNAAAA- 252 1153862_3- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 238 1116152_3- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 169 898352_3- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 165 898505_3- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 164 522100_4- TT-CGTGT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 170 1153609_3- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 124 898336_3- TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 84 715929_4- CTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 42 1153636_3- TCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 41 350182_9- TTCCAAAAAA 10 ____________________________________________________________ consensus TT-CGTTT-CG-CGTGCTCACAATATGTTACAGCGTCACGTATGACATT-CTCCAAAAA- 364 . : . : . : . : . : . : 885495_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 417 885480_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 410 871313_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 409 885597_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 406 1221245_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 403 1191887_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 408 1191924_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 404 1213907_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 404 1191933_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 394 867584_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 385 683802_9- CACTTTCAATACGCCACGTGNCN-NTTCATAAATCAAG-CCCGAAATACGTTTCACACCA 388 1153854_3- CACTTTCAATACGCCACGTGTCT-TTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 350 867579_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 307 445168_9- CACTTTCAANACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAANACGTTTCACACCA 310 1153862_3- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 296 1116152_3- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 227 898352_3- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 223 898505_3- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 222 522100_4- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 228 1153609_3- CACTTTCAATACGCCACGTGTTT-CTTCATAAATCAATTCCCGAAATACGTTTCACACCA 183 898336_3- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAAATCCCGAAATACGTTTCACACCA 143 715929_4- CACTTTCAATA-GCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 99 1153636_3- CACTTTCAATACGCCACGTGTTTTCTTCATAAATCAAATCCCGAAATACGTTTCACACCA 101 350182_9- CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 68 ____________________________________________________________ consensus CACTTTCAATACGCCACGTGTCT-CTTCATAAATCAA-TCCCGAAATACGTTTCACACCA 422 . : . : . : . : . : . : 885495_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 477 885480_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 470 871313_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 469 885597_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 466 1221245_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 463 1191887_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 468 1191924_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 464 1213907_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 464 1191933_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 454 867584_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 445 683802_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 448 1153854_3- CCACGTCGTGCCAAACGTCGAATAGCTGGNTTTGTTATTCCTTGAATATTGTCACGCAGC 410 867579_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 367 445168_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 370 1153862_3- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 356 1116152_3- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 287 898352_3- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 283 898505_3- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 282 522100_4- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 288 1153609_3- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 243 898336_3- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 203 715929_4- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 159 1153636_3- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 161 350182_9- CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 128 ____________________________________________________________ consensus CCACGTCGTGCCAAACGTCGAATAGCTGGCTTTGTTATTCCTTGAATATTGTCACGCAGC 482 . : . : . : . : . : . : 885495_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 537 885480_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 530 871313_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 529 885597_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 526 1221245_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 523 1191887_9- ACTTTACGATGACGCTTCGCTCCACCTTTCCCAAGTCCTTTACCGCCTTTACCACGTCCT 528 1191924_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 524 1213907_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 524 1191933_9- ACTTTACGATGACGCTTCGCTCCACCTTTCCCAAGTCCTTTACCGCCTTTACCACGTCCT 514 867584_9- ACTTTACGATGACGCTTCGCTCCAC 505 683802_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGNCCTTTACCGCCTTTACCACGTCCT 508 1153854_3- ACTTTACGATGACGCTTCGCTCCACCTTTCCCAAGTCCTTTACCGCCTTTACCACGTCCT 470 867579_9- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 427 445168_9- ACTTTNCGATGACGCTTCGCTCCACCTTTCCCAAGTCCTTTACCGCCTTTACCACGTCCT 430 1153862_3- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 416 1116152_3- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 347 898352_3- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 343 898505_3- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 342 522100_4- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 348 1153609_3- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 303 898336_3- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 263 715929_4- ACTTTACGATG-CG-TTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 217 1153636_3- ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 221 350182_9- ACTTTACGATG-C--TTCGCTCCACCTTTTCCAAGTCCTTTACTGCCTTTACCACGTCCT 185 ____________________________________________________________ consensus ACTTTACGATGACGCTTCGCTCCACCTTTTCCAAGTCCTTTACCGCCTTTACCACGTCCT 542 . : . : . : . : . : . : 885495_9- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 594 885480_9- GACATCTTCACGAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 587 871313_9- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 586 885597_9- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACAC 583 1221245_9- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 580 1191887_9- GACATCTTCACAAGTAACAGCGATCACATACGAANACACTGGTACACGTGTNGCACACAA 588 1191924_9- GACATCTTCA 584 1213907_9- GACATCTTCACGAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 581 1191933_9- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 571 683802_9- GACAGCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 565 1153854_3- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 527 867579_9- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 484 445168_9- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 487 1153862_3- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 473 1116152_3- GACATCTTCACGAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCG 404 898352_3- GACATCTTCACGAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 400 898505_3- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACA 399 522100_4- GACATCTTCACGAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 405 1153609_3- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 360 898336_3- GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 320 715929_4- GACATCTTCACGAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 274 1153636_3- GACATCTTCACGAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 278 350182_9- GACATCTTCACAAGTAACAACGATCACA-ACGAAAACACTGGTA-AC-TG---CACACAA 239 ____________________________________________________________ consensus GACATCTTCACAAGTAACAGCGATCACA-ACGAAAACACTGGTA-AC-TGTCGCACACAA 599 . : . : . : . : . : . : 885495_9- CTGAAC 654 885480_9- CTG 647 871313_9- CTGAAC 646 1221245_9- CTG 640 1191887_9- C 648 1213907_9- CTGAAC 641 1191933_9- CTG 631 683802_9- CTGAAC 625 1153854_3- CTGAAC 587 867579_9- CTGAA 544 445168_9- CTGAAC 547 1153862_3- CTGAAC 533 898352_3- CTGAAC 460 522100_4- CTGAACCTCGTGCCGAATTCGGCACGAG 465 1153609_3- CTGAACCTCGTGCCGAATTCGGCACGAG 420 898336_3- CTGAAC 380 715929_4- C 334 1153636_3- CTG 338 350182_9- C 299 1116225_3+ CTCGTGCCGAATTCGGCACGAGATTAGGTGGGAGTTTTGCTGAATGTTCCAGGA 54 ____________________________________________________________ consensus CTGAACCTCGTGCCGAATTCGGCACGAGATTAGGTGGGAGTTTTGCTGAATGTTCCAGGA 659 . : . : . : . : . : . : 1116225_3+ TTTCGATTGTTTGTTCATACTTGTTTTAGGAAAAAGTATTTGAACAAATAAATGATCACC 114 ____________________________________________________________ consensus TTTCGATTGTTTGTTCATACTTGTTTTAGGAAAAAGTATTTGAACAAATAAATGATCACC 719 . : . : . : . : . : . : 1116225_3+ GCTTATAAAATTGCGCCAGTTGGTTTATTGCTTTGCTACAAATGAAATATTTGTTTAGTT 174 ____________________________________________________________ consensus GCTTATAAAATTGCGCCAGTTGGTTTATTGCTTTGCTACAAATGAAATATTTGTTTAGTT 779 . : . : . : . : . : . : 1116225_3+ ATATTGGATTGTTTTTTGCTTTAGTTATCATTCTTAATTAATTGGTTTTTAAGTTTATCT 234 ____________________________________________________________ consensus ATATTGGATTGTTTTTTGCTTTAGTTATCATTCTTAATTAATTGGTTTTTAAGTTTATCT 839 . : . : . : . : . : . : 1116225_3+ TAACTATTTANAATGAAATCAGCTTTGAATGAATATTTTGTGC 277 ____________________________________________________________ consensus TAACTATTTANAATGAAATCAGCTTTGAATGAATATTTTGTGC 882

Date: 17:31:33 on Mon 18 Dec 117.