alignments/CShisMan2_386.align.Z


1.  3303/TCZ2 adult worm mini-library
2. C2/25RY adult worm mini-library
3. C2/C2 adult worm mini-library
4. C2/G1 lung-stage schistosomula mini-library
5. C2/S1 day seven schistosomula mini-library
6. C2/SK adult worm mini-library
7. C2/tcz2 adult worm mini-library
8. ENR2/ENR2 three hour schistosomula worm
9. G1/C2 Lung-stage schistosomula mini-library
10. G1/G1 adult worm mini-library
11. G1/G2 3h schistosomula mini-library
12. G1/G2 adult worm mini-library
13. G2/G2 adult worm mini-library
14. G2/KS adult worm mini-library
15. G2/SK lung-stage schistosomula mini-library
16. LA1/LA2 adult worm mini-library
17. S. mansoni Schistosomule Lambda Zap
18. S. mansoni adult Lambda Zap
19. S. mansoni adult Lambda gt11
20. S. mansoni cDNA
21. S. mansoni cDNA adult worm (R.Guerra-Sa)
22. S. mansoni cercarial Lambda Zap
23. S. mansoni cercarial Lambda gt11
24. S. mansoni female adult Lambda Zap
25. S. mansoni sporocyst Lambda gt11
26. S. mansoni, female enriched, subtractive, HHU(A)
27. Schistosoma Lambda Zap II
28. Schistosoma Lambda Zap II cercariae
29. Schistosoma mansoni Lambda Gt11 (Mohamed MM)
30. Schistosoma mansoni adult worm Lambda ZAP II library
31. Schistosoma mansoni, Lambda gt11, Clontech
32. Schistosoma mansoni, Phil LoVerde/Joe Merrick
33. Schistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
34. Schistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
35. Schistosoma mansoni, adult worm, Gloria Franco
36. Schistosoma mansoni, cercariae
37. Schistosoma mansoni, egg stage
38. Schistosoma mansoni, lung stage
39. SmAW
40. SmL
41. TBRI-Saber-cercaria-A
42. York-Harrop-lung-A
43. tcz2/KS adult worm mini-library
44. tcz3/ks adult worm mini-library
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 386 ******************** . : . : . : . : . : . : 419238_39+ AATAACAGTTGTNGGAGTGNAAATNCGGNTTGGAACAGAAGAACGAAACTAATCACAANG 60 824833_33- GGCAACTA-T-ACA-CG 14 ____________________________________________________________ consensus AATAACAGTTGTNGGAGTGNAAATNCGGNTTGGAACAGAAGAACGAAACTAATCACAACG 60 . : . : . : . : . : . : 419238_39+ NTGGATCAAAAACTCAGTAACTCAATTAGTNGA-AAAANTAGTAAAAGTAAGGAGTTA-- 117 824833_33- TTG-ATCCGAT--TGA-TAAA-CGAG-A-T-GACAAATCCAGGAA--GTTGGGAATTAGG 64 ____________________________________________________________ consensus TTGGATCAAAAACTCAGTAAATCAAGTAGTNGACAAAACCAGGAAAAGTAAGGAATTAGG 120 . : . : . : . : . : . : 419238_39+ AACTTGGACCAAAGCGGATCTAGACAAA-ATGGTTTAGAGGCATCTAAAATGAGTGGTCA 176 824833_33- AA-TTGG-CGGAAGCAGTTCTGGACAGAGA-GGTTTGGAAGCATCTAAAATGAGTGGT-T 120 1869602_26+ TCTAAAATGAGTGGTCN 17 ____________________________________________________________ consensus AACTTGGACCAAAGCAGATCTAGACAAAGATGGTTTAGAAGCATCTAAAATGAGTGGTCN 180 . : . : . : . : . : . : 419238_39+ TTCTAGATCTCAATATAAACACAAAAAATATGGACATCTCAAAGCTAAAGGCAAA-TTCC 235 824833_33- TTCTAGATCTCGATATAGACACAGAAAATATGGACATCTCAAAGCTAAAGGCAAA-TTCC 179 1869602_26+ TCCTAAATCTCAATATANACCCCANAAATNTGGACATCTCAAAGCTAAAGGCAAA-TTCC 76 824851_33- TGGACATCTCAAAGCTAAAGGCAAAATTCC 30 824829_33- ATCTCAAAGCTAAAGGCAAA-TTCC 24 ____________________________________________________________ consensus TTCTAGATCTCAATATANACACAAAAAATATGGACATCTCAAAGCTAAAGGCAAA-TTCC 239 . : . : . : . : . : . : 419238_39+ GTTCACGTGGACTCGGTAGACACGGTATCGTATCATCAGAATCTACATATTATGTAATTG 295 824833_33- GTTCACGTGGACTCGGTAGACACGGTATCGTGTCATCAGAATCTACATATTATGTAATTG 239 1869602_26+ GTTCACGTGGACTCGGTTGACACGGTATCCTATCATCAGAATCTACNTATTATGTANTTG 136 824851_33- GTTCACGTGGACTCGGTAGACACGGTATCGTGTCATCAGAATCTACATATTATGTAATTG 90 824829_33- GTTCACGTGGACTCGGTAGACACGGTATCGTGTCATCAGAATCTACATATTATGTAATTG 84 1869499_26+ TGTAATTG 8 ____________________________________________________________ consensus GTTCACGTGGACTCGGTAGACACGGTATCGTGTCATCAGAATCTACATATTATGTAATTG 299 . : . : . : . : . : . : 419238_39+ AAGGCAAATTCGNTAG-AT-ATGGTCGAAAGAGACCTACTAACTCGAAATTC-AAAACTC 352 824833_33- AAGGCAAATTCGATAG-AT-ATGGTCGAAAGAGACCTACTAACTCGAAATTC-AAAACTC 296 1869602_26+ AAGGCAAATTCGATAN-AT-TTGGTC 194 824851_33- AAGGCAAATTCGATAG-AT-ATGGTCGAAAGAGACCTACTAACTCGAAATTC-AAAACTC 147 824829_33- AAGGCAAATTCGATAG-AT-ATGGTCGAAAGAGTCCTACTAACTCGAAATTC-AAAACTC 141 1869499_26+ AAGGCAAATTCGATAG-AT-ATGGTCGAAAGAGACCTACTAACTCGAAATTC-AAAACTC 65 1525953_27+ GGCACGA-GGTCGAAAGAGACCTACTAACTCGAAATTC-AAAACTC 44 1152942_34- CNTANTAACTCGAAATTCCAAAACTC 26 824787_33- AACTCGAAATTC-AAAACTC 19 824788_33- AACTCGAAATTC-AAAACTC 19 ____________________________________________________________ consensus AAGGCAAATTCGATAG-AT-ATGGTCGAAAGAGACCTACTAACTCGAAATTC-AAAACTC 356 . : . : . : . : . : . : 419238_39+ GNGGGAAAAGAGA-AAANATATTCTAAAAAAN-TGGTGGATAATC-AATTCGATATT-CA 408 824833_33- GTGG-AAAAGAGA-AAAAATATTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 351 824851_33- GTGG-AAAAGAGA-AAAAATATTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 202 824829_33- GTGG-AAAAGAG-CAAAAATATTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 196 1869499_26+ GTGG-AAAAGAGA-AAAAATNTTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 120 1525953_27+ GTGG-AAAAGAGA-AAAAATATTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 99 1152942_34- TTGG-AAAGGGGA-AAAATTATTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 81 824787_33- GTGG-AAAAGAGA-AAAAATATTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 74 824788_33- GTGG-AAAAGAGA-AAAAATATTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 74 824837_33- AAAGAGTCAAAAATATTCTAAAAAAAATTGTTGATAATC-AATTCGATATT-CA 52 824819_33- AAAA-T-GTTGTTAATCCAAT-CGATATT-CA 28 824818_33- ATC-AATTCGATATTTCA 17 ____________________________________________________________ consensus GTGG-AAAAGAGA-AAAAATATTCTAAAAAAA-TTGTTGATAATC-AATTCGATATT-CA 411 . : . : . : . : . : . : 419238_39+ AGG-TGGGTTTAATTGGANG-AA-CGTNAATATTAAA-CGAACTGG-TGGATCATCAAG- 462 824833_33- AGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 401 824851_33- AGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 252 824829_33- CGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 246 1869499_26+ AGG-TGG-TTTAATTG-AAN-AA-CGTTAATAT-AAA-CGAACTGGGTG-ATTATCAAG- 171 1525953_27+ AGG-TGG-TTTAATTG-AAG-AAGC-TAAATAT-AAAGC-AACTGG-TG-ATTAT-AAG- 148 1152942_34- AGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 131 824787_33- AGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 124 824788_33- AGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 124 824837_33- AGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 102 824819_33- AGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 78 824818_33- AGGATGG-TTTAATTG-AAGGAA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 69 824812_33- TTTATCAAGG 10 ____________________________________________________________ consensus AGG-TGG-TTTAATTG-AAG-AA-CGTAAATAT-AAA-CGAACTGG-TG-ATTATCAAG- 461 . : . : . : . : . : . : 419238_39+ CG-AATTGG 521 824833_33- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 452 824851_33- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 303 824829_33- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTG-AGCTGAACATCATGCTTCTT 296 1869499_26+ CG-AAT-GGT-ACTCAT-GCT--TATNT---CCAAGTTGGAGCTGAACAACAAGCTTCTT 222 1525953_27+ CGCAA--GGT-A-TC-TAGCTCTTATATAAGCCG-GTTG-AG-TCAA 200 1152942_34- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 182 824787_33- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 175 824788_33- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 175 824837_33- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 153 824819_33- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 129 824818_33- CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 120 824812_33- CG-AAT-GGTTACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 62 1152968_34- TGGAGCTGANCATCATGCTTCTT 23 824869_33- CTGAACATCATGCTTCTT 18 824874_33- GAACATCATGCTTCTT 16 ____________________________________________________________ consensus CG-AAT-GGT-ACTCAT-GCT--TATAT---CCAAGTTGGAGCTGAACATCATGCTTCTT 512 . : . : . : . : . : . : 824833_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 509 824851_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 360 824829_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 353 1869499_26+ C-AGCTTTAA-ATGTNAA-AAGGAGTGAAAACNAACATTCAGATAAGAACAAGGAATTTG 279 1152942_34- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 239 824787_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 232 824788_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 232 824837_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 210 824819_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 186 824818_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 177 824812_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 119 1152968_34- TGAA-TACAAGA-GCAAATAATT-GCGAAAGCAAACATTCACAAAAGGACAAGCAATTTG 80 824869_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 75 824874_33- TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 73 1152967_34- AGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATGTG 49 ____________________________________________________________ consensus TGAA-TACAAGA-GCAAATAAT-AGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 569 . : . : . : . : . : . : 824833_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 562 824851_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 413 824829_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 406 1869499_26+ AATTTAAGCTTAGCTCTAACGATN-CCAGAAAACAGAGAAGTGAGGATNTTCG--AGCAT 336 1152942_34- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 292 824787_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 285 824788_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 285 824837_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 263 824819_33- ATTTTAATCTTAACAATAACG-TAACCATTAAN-AG----GTTAG-ATTTGCGACAGCAA 239 824818_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 230 824812_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-ACA----TTAG-ATTTGCGACAGCAA 172 1152968_34- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 133 824869_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 128 824874_33- ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 126 1152967_34- ATTTTAATCTTAACAATAACG-TAACCATTWAA-AG----GTTAG-ATTTGCGACAGCAA 102 ____________________________________________________________ consensus ATTTTAATCTTAACAATAACG-TAACCATTAAA-AG----GTTAG-ATTTGCGACAGCAA 622 . : . : . : . : . : . : 824833_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 622 824851_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 473 824829_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 466 1869499_26+ ---TAAAC-ATTTCAACNATTTTACAAATNTAATTTCTTTTTGACTATTATAAAAATAAT 392 1152942_34- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 352 824787_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 345 824788_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 345 824837_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 323 824819_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 299 824818_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 290 824812_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 232 1152968_34- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 193 824869_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 188 824874_33- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 186 1152967_34- AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 162 ____________________________________________________________ consensus AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 682 . : . : . : . : . : . : 824833_33- ATCGATTTTCATGTTAATAACCTTTTG 663 824851_33- ATCGATTTTCATGTTAATAACCTTTTG 514 824829_33- ATCGATTGTCATGTTAATAACCTTTTG 507 1869499_26+ ATCGATTTTCATGTTAA-AA--TTNTAATTTAT 430 1152942_34- ATCGATTTTCATGTTAATAACC------TTT-TGCTCGTGC 386 824787_33- ATCGATTTTCATGTTAATAACCTTTTG 386 824788_33- ATCGATTTTCATGTTAATAACCTTTTG 386 824837_33- ATCGATTTTCATGTTAATAACCTTTTG 364 824819_33- ATCGATTTTCATGTTAATAACCTTTTG 340 824818_33- ATCGATTTTCATGTTAATAACCTTTTG 331 824812_33- ATCGATTTTCATGTTAATAACCTTTTG 273 1152968_34- ATCGATTTTCATGTTAATAACC------TTT-TGCTCGTGC 227 824869_33- ATCGATTTTCATGTTAATAACCTTTTG 229 824874_33- ATCGATTTTCATGTTAATAACCTTTTG 227 1152967_34- ATCGATTTTCATGTTAATAACC------TTT-TGCTCGTGC 196 ____________________________________________________________ consensus ATCGATTTTCATGTTAATAACCTTTTG-TTT-TGCTCGTGC 721

Date: 14:45:34 on Sun 17 Dec 117.