alignments/CShisMan2_839.align.Z


1.  3303/TCZ2 adult worm mini-library
2. C2/25RY adult worm mini-library
3. C2/C2 adult worm mini-library
4. C2/G1 lung-stage schistosomula mini-library
5. C2/S1 day seven schistosomula mini-library
6. C2/SK adult worm mini-library
7. C2/tcz2 adult worm mini-library
8. ENR2/ENR2 three hour schistosomula worm
9. G1/C2 Lung-stage schistosomula mini-library
10. G1/G1 adult worm mini-library
11. G1/G2 3h schistosomula mini-library
12. G1/G2 adult worm mini-library
13. G2/G2 adult worm mini-library
14. G2/KS adult worm mini-library
15. G2/SK lung-stage schistosomula mini-library
16. LA1/LA2 adult worm mini-library
17. S. mansoni Schistosomule Lambda Zap
18. S. mansoni adult Lambda Zap
19. S. mansoni adult Lambda gt11
20. S. mansoni cDNA
21. S. mansoni cDNA adult worm (R.Guerra-Sa)
22. S. mansoni cercarial Lambda Zap
23. S. mansoni cercarial Lambda gt11
24. S. mansoni female adult Lambda Zap
25. S. mansoni sporocyst Lambda gt11
26. S. mansoni, female enriched, subtractive, HHU(A)
27. Schistosoma Lambda Zap II
28. Schistosoma Lambda Zap II cercariae
29. Schistosoma mansoni Lambda Gt11 (Mohamed MM)
30. Schistosoma mansoni adult worm Lambda ZAP II library
31. Schistosoma mansoni, Lambda gt11, Clontech
32. Schistosoma mansoni, Phil LoVerde/Joe Merrick
33. Schistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
34. Schistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
35. Schistosoma mansoni, adult worm, Gloria Franco
36. Schistosoma mansoni, cercariae
37. Schistosoma mansoni, egg stage
38. Schistosoma mansoni, lung stage
39. SmAW
40. SmL
41. TBRI-Saber-cercaria-A
42. York-Harrop-lung-A
43. tcz2/KS adult worm mini-library
44. tcz3/ks adult worm mini-library
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 839 ******************** . : . : . : . : . : . : 1815435_32- ATATCATGATGTGAACGTATAATATTTTTTAAATCATCATCAACTACCATACCAGGACCT 60 ____________________________________________________________ consensus ATATCATGATGTGAACGTATAATATTTTTTAAATCATCATCAACTACCATACCAGGACCT 60 . : . : . : . : . : . : 1815435_32- TGAGTACATGGACCACCAAGAAATAACATAACTCTAGCTCCAGTATTAGGATAAGCAGCT 120 ____________________________________________________________ consensus TGAGTACATGGACCACCAAGAAATAACATAACTCTAGCTCCAGTATTAGGATAAGCAGCT 120 . : . : . : . : . : . : 1815435_32- TCTAATAAACCAACTGCAATACTTAATGCTGTACCAACTGAACGTAAAGGACGTTTACCT 180 ____________________________________________________________ consensus TCTAATAAACCAACTGCAATACTTAATGCTGTACCAACTGAACGTAAAGGACGTTTACCT 180 . : . : . : . : . : . : 1815435_32- TGAGGTACAGGCCAAGGATCTGGTTGTAATTCAGTAAGTAAATCAGTGATTAAAGCATCA 240 ____________________________________________________________ consensus TGAGGTACAGGCCAAGGATCTGGTTGTAATTCAGTAAGTAAATCAGTGATTAAAGCATCA 240 . : . : . : . : . : . : 1815435_32- CACCGTTCCATTGGTTGAATAAATC-TATTGTATGGCAATTGAGCCATTTGTGGTTGTTG 299 1815567_32- CCATTGGTTGAATAAA-CATATTGCATGGCAATTGAGCCATTTGTGGTTGTTG 52 ____________________________________________________________ consensus CACCGTTCCATTGGTTGAATAAATCATATTGCATGGCAATTGAGCCATTTGTGGTTGTTG 300 . : . : . : . : . : . : 1815435_32- AAATTGCTTTTCAGAATTGTAGACACCTTTGGGAGCACCTGGAGGTGAATTTGCATTGAA 359 1815567_32- AAATTGCTTTTCCGAATTGTAGACACCTTTGGGAGCACCTGGAGGTGAATTTGCATTGAA 112 ____________________________________________________________ consensus AAATTGCTTTTCAGAATTGTAGACACCTTTGGGAGCACCTGGAGGTGAATTTGCATTGAA 360 . : . : . : . : . : . : 1815435_32- TACAGAAGCAGGT 417 1815567_32- TACTGAAGCAGGTTGATTAGCATTTGTAACTGAACTACGACCAACACTTAACATAACC 170 ____________________________________________________________ consensus TACAGAAGCAGGTTGATTAGCATTTGTAACTGAACTACGACCAACACTTAACATAACC 418

Date: 16:26:31 on Sun 17 Dec 117.