alignments/CcruzaQ_174.align.Z


1.  T. cruzi epimastigote normalized cDNA Library
2. T.cruzi epimastigote non-normalized cDNA Library
3. T.cruzi epimastigote normalized cDNA Library
4. Trypanosoma cruzi Y (Tomoo Tanaka)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 174 ******************** . : . : . : . : . : . : 1658206_1+ GGGGGGGGGGGGNTATTGGCCTCTTAGGCCNATTANTCN----N---C-A--CT--A--- 45 1658183_1+ T-GCAAANANGCTT--TT--TTTT 19 1658209_1+ GTTT--TT--AATT 10 1694407_1+ TAATCGGCAC-N 11 1658217_1+ AANT 4 1658204_1+ AANT 4 1658200_1+ AAAT 4 1658214_1+ AANT 4 1658182_1+ AANT 4 ____________________________________________________________ consensus GGGGGGGGGGGGNTATTGGCCTCTTAGGCCNATTANTCGCAAANANGCTA--CT--AANT 56 . : . : . : . : . : . : 1658206_1+ -----------------G--G----TT----TT----------------G---T------ 53 1658183_1+ NNT--CT-TTT------------TTTT----TN--N------A-A-A--G---G-C-A-- 41 1658209_1+ -NT--CT-TTT-----------TTTTT----TT--T-------------T---T-T-T-- 29 1694407_1+ AGG--CT-TTT-----------TTTTT----TT--T-------------T---T-T-T-- 31 1658217_1+ CGGCACNAGGT------------TTTT----TT--T-------------G---G-C-A-- 26 1658204_1+ CGGCACGAGGT-----------TTTTT----TT--T---GGGAGAGA--G---G-C-A-- 35 1658200_1+ CGGCACGAGGT------------TTTT----TTGAN----------A--G---G-C-A-- 29 1658214_1+ CGGCACGAGGT-----------TTTTT----TT--T-------------T---T-T-T-T 28 1658182_1+ CGGCACGAGGT-----------TTTTT----TT--T-------------T---T-T-T-- 27 1206418_3+ GGCACGA--G--G-TT-TT----TT--T-------------G-----C-A-- 19 1658232_1+ GGCACNA--G--G-TCCNT----TT--T------------------------ 17 1206415_3+ GGCACGA--G--G-TTTTT----TT--T-------------T---T-T-T-T 22 1206420_3+ GGCACGA--G--G-TTTTT----TT--T-------------T---T-T-T-T 22 1206393_3+ GACGA-----GTTTTTTTTTTTT--TTTTGGGAG--A--G--AG-C-A-- 33 1828042_1+ ACACAA---CAG-----T----T---G----GGAGAGA--G---G-C-A-- 23 1206391_3+ CCACGAAAGCCGCAACTT----TT--T-------------T---T-T-T-T 26 1658185_1+ AA-NAGGCTTTTT----TT--TT------------N---T-N-N-T 21 1206481_3+ CAACTTTTTNCTTTTT-T-T 18 1658195_1+ NTTGTCN 7 1658225_1+ A 1 ____________________________________________________________ consensus CGGCACGAGGT---------G-TTTTT----TT--T-------------G---T-T-T-- 80 . : . : . : . : . : . : 1658206_1+ ---G-------T--------------AGAG--AA-C-A-A--A----A------AGAAAA 72 1658183_1+ ---G-------T--------------AAAA--AA-C-G-A--A----A------AGAAAA 60 1658209_1+ TT---------T--------------AAAA--AA-C-A-A--A----A------AAAAAA 49 1694407_1+ TT---------T--T------------GAA--AA-C-G-A--A----A------AGAAAA 51 1658217_1+ ---G-------T--------------AGAA--AA-C-G-A--A----A------AGAAAA 45 1658204_1+ ---G-------T--------------AGAA--AA-C-G-A--A----A------AGAAAA 54 1658200_1+ ---G-------T--------------ANAA--AA-C-G-A--A----A------AGAAAA 48 1658214_1+ TT-G-------T--------------AGAA--AA-C-G-A--A----A------AGAAAA 49 1658182_1+ TT-G-------T--------------AAAN--AA-C-A-A--A----A------AGAAAA 48 1206418_3+ ---G-------T--------------AGAG--AA-C-A-A--A----A------AGAAAA 38 1658232_1+ -----------T--------------AGAA--AA-C-N-A--A----A------AGAAAA 35 1206415_3+ TTTT-------T--T---TT-TTTTTAGAA--AA-C-N-A--A----A------AGAAAA 52 1206420_3+ TTTT-------T--T-T-TTTTTTTTAGAG--AA-C-A-A--A----A------AGAAAA 54 1206393_3+ ---G-------T--------------ACAA--AA-C-G-A--A----A------AGAA-A 51 1828042_1+ ---G-------T--------------AGAA--AA-C-G-A--A----A------AGAAAA 42 1206391_3+ TT-T-------T--T---TT-TTTT-ACAA--AA-C-G-A--A----A------AGAA-A 53 1658185_1+ TT-T-------T--------------AGAA--AA-C-G-A--A----A------AGAAAA 42 1206481_3+ TTTTTTT----T--------------AGAA--AA-C-G-A--A----A------AGAAAA 43 1658195_1+ TTTTTTN----T--A-----------A-AA--AA-C-A-A--A----A------ANAAAA 32 1658225_1+ ATCGGCACGAGG--------------AGAA--AA-C---A--AG---A------AGAAAA 30 1658208_1+ TTGGGCNCCTTT-TTG----------A-AA--AA---A-A--AC---AT-TTT-ANAAAA 35 1838677_1+ T-----------AGAA--AA-C-G-A--A----A------AGAAAA 18 1381656_3+ T-----------AGAA--AA-C-G-A--A----A------AGAAAA 18 1206390_3+ GGCACG-AGGTGTT-TTTGTAGAA-GA--C---A--AG---A------AGAA-A 34 1833693_1+ TG--T-------AGAG--AA-C-A-A--A----A------AGAAAA 20 1792823_1- G-CAG--T-------AGAA--AA-C-G-A--A----A------AGAAAA 22 1868773_1+ TGCAG--T-------AGAG--AA-C-G-A--A----A------AGAAAA 23 1694572_1+ ATTGCCNA-TTC---G--GNACGAG---GCA--A----AA-----AGAAAA 31 1830205_1+ T-GTA-GAG---AACAAAAAGAAAA 20 1658213_1+ GAGANGCAGTA-NAN---AACAAAAAGAAAA 27 1658191_1+ TAA---AACNAAAAGAAAA 16 1792648_1+ AG---AACAAAAAGAAAA 15 1206510_3+ GGCACGAGGG-AACAAAAAGAAAA 23 1658223_1+ NGACCAACAAAAANAAAA 18 1804722_1- AGAG-AACAAAAAGAAAA 17 1792774_1- CGAAAAGAAAA 11 1868980_1- AAAAGAAAA 9 1658205_1+ GAAGAANA 8 ____________________________________________________________ consensus TT-G-------T--------------AGAA--AA-C-G-A--A----A------AGAAAA 101 . : . : . : . : . : . : 1658206_1+ CAA--AAGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 130 1658183_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACNTNTGGGTCACCGTGGCTCANCNAC 118 1658209_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACNTNTGGGTCACCGTGGCTCAGCNAC 107 1694407_1+ CAAC-AA-CAAACCAATCCTATTCTGTAGGGCTACNTGTGGGTCACCGTGGCTCAGCGAC 109 1658217_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACNTGTGGGTCACCGTGGCTCAGCGAC 103 1658204_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACNTGTGGGTCACCGTGGCTCAGCGAC 112 1658200_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 106 1658214_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACNTGTGGGTCACCGTGGCTCAGCGAC 107 1658182_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACNTGTGGGTCACCGTGGCTCAGCGAC 106 1206418_3+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 96 1658232_1+ NAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 93 1206415_3+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACNTGTGGGTCACCGTGGCTCAACAAC 110 1206420_3+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCNAC 112 1206393_3+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 109 1828042_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 100 1206391_3+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCAC-GTGGCTCAGCGAC 110 1658185_1+ CNAC-AA-CAAACCAATCCTATTCTATAGGGCTACNTGTGGGTCACCGTGGCTCANCNAC 100 1206481_3+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 101 1658195_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACNTNTGGGTCACCGTGGCTCAACNAC 90 1658225_1+ CAACGAA--AAAACAATCCTATTCTATGGGGCTACNTGTGGGTCACCGTGGCTCAGCGAC 88 1658208_1+ CAAC--AGCAAACCAATCCTATTCTANAGGGCCACTTGTGGGTNACCGTGGCTCATCNAC 93 1838677_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 76 1381656_3+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 76 1206390_3+ CAACGAA-NAAA-CAATCCTATTCTATGGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 92 1833693_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 78 1792823_1- CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 80 1868773_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 81 1694572_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCANCGAC 89 1830205_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 78 1658213_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 85 1658191_1+ CNAC-NA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCNAC 74 1792648_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 73 1206510_3+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 81 1658223_1+ CAAC--AGCAAANCAATCCTATTCTATAGGGCTACNTGTGGGTCACCGTGGCTCAGCNAC 76 1804722_1- CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 75 1792774_1- CAAC-AA-CAAACCAATCCTATTCTGTAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 69 1868980_1- CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 67 1658205_1+ CAA--AAGCAAACCAATCCTATTCTATAGGGCTACNTGTGGGTCACCGTGGCTCAGCGAC 66 1830268_1+ CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 58 1805632_1+ CAAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 58 1830235_1+ AAC--AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 57 1833641_1+ AGCAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 54 1838633_1+ CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 52 1824593_1+ TCTATGGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 38 1797111_1+ TAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 34 1838691_1+ AGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 33 1841561_1+ GGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 32 1805782_1+ GGCTACGTGTGGGTCACCGTGGCTCAGCGAC 31 1797370_1+ GCTACGTGTGGGTCACCGTGGCTCAGCGAC 30 1797322_1+ GTGTGGGTCACCGTGGCTCAGCGAC 25 1804633_1- AGCGAC 6 ____________________________________________________________ consensus CAAC-AA-CAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGAC 159 . : . : . : . : . : . : 1658206_1+ NACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 189 1658183_1+ AANGGCCACCCAGGTGCATCTAACATNTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 177 1658209_1+ AANGGNCACCCAGGTGCATCTACCATNTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 166 1694407_1+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 168 1658217_1+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 162 1658204_1+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 171 1658200_1+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 165 1658214_1+ AANGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 166 1658182_1+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 165 1206418_3+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCTTCTCTACGC-TCGGCCTGAAGGC 155 1658232_1+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 152 1206415_3+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 169 1206420_3+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCTTCTCTACGC-TCGGCCTGAAGGC 171 1206393_3+ GACGGC-ACC-AGGTGCATCTAACAT-TTGCGCCCC-TCCCTGCGC-T-GGCCTGAAGGC 163 1828042_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 159 1206391_3+ AACGGC-ACC-AGGTGCATCTAACAT-TTGCGCCCC-TC-CTGC-CCT-GGCCTGAAG-C 162 1658185_1+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 159 1206481_3+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 160 1658195_1+ AANGGCCACCCAGGTGCATCTACCATNTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 149 1658225_1+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCGTCTCTGCGCTT-GGCCTGAAGGC 147 1658208_1+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACAC-TCNGNCTGAAGGC 152 1838677_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCATGCGCCT-GGCCTGAAGGC 135 1381656_3+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 135 1206390_3+ NACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCGTCTCTGCGC-TGGGCCTGAAGGC 151 1833693_1+ GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 137 1792823_1- GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-G--CTGAAGGC 137 1868773_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 140 1694572_1+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 148 1830205_1+ GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 137 1658213_1+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 144 1658191_1+ AACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCATGCGCCT-GGCCTGAAGGC 133 1792648_1+ GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCTTCTCTACGC-TCGGCCTGAAGGC 132 1206510_3+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCTTCTCTACGC-TCGGCCTGAAGGC 140 1658223_1+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 135 1804722_1- GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCTTCTCTACGA-TCG-CCTGAAGGC 133 1792774_1- GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-G--CTGAAGGC 126 1868980_1- GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 126 1658205_1+ AACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 125 1830268_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 117 1805632_1+ GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCCTCCCTGCGCCTCGCCC-GAAG-C 116 1830235_1+ GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAG-C 115 1833641_1+ GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCGGCCTGAAGGC 113 1838633_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 111 1824593_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCGTCTCTGCGCTT-GGCCTGAAGGC 97 1797111_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 93 1838691_1+ GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCCTCCCTGCGCCTCG-CCTGAAGGC 92 1841561_1+ GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCCTCCCTGCGCCTCG-CCTGAAGGC 91 1805782_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 90 1797370_1+ GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 89 1797322_1+ GACGGCCACCCAGGTGCGTCTGCCATGTTGCGCCCCTTCTCTACGC-TCGGCCTGAAG-C 83 1804633_1- GACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCGTCTCTACGC-TCG-CCTGAAGGC 64 667670_4- GGTGAANCNAAAATGNTGCGCCCCCTCCCTGCCCCT-GCCCTGNAGCC 47 1792618_1- ATCTACCATGTTGCGCCCCTTCTCTACGC-TCG-CCTGAAGGC 41 1789641_1- CTGAAGGC 8 1792841_1- CTGAAGGC 8 ____________________________________________________________ consensus GACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCT-GGCCTGAAGGC 218 . : . : . : . : . : . : 1658206_1+ CACTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 246 1658183_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCNCCA 234 1658209_1+ CACTCTA-ANCGCTGGGCGTCNCCCT-CNCC-TTCTTGCTGCTCTTGTGCTTCTTCCCCA 223 1694407_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 225 1658217_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 219 1658204_1+ CGCTCTA-AGCGCTGGGCNTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 228 1658200_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 222 1658214_1+ CGCTCTA-ANCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCNCCA 223 1658182_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 222 1206418_3+ CACTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 212 1658232_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 209 1206415_3+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 226 1206420_3+ CACTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 228 1206393_3+ -GCTCTA-A-CGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCT-GTGCTTCT-CCCCA 215 1828042_1+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 214 1206391_3+ CGCTCTA-A-CGCTGG-CGTC-CCCT-C-CC-TT 215 1658185_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 216 1206481_3+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 215 1658195_1+ CACTCTA-ANCGCTGGGCGTCCCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCNCCA 206 1658225_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 204 1658208_1+ CACTCTA-ANCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 209 1838677_1+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 190 1381656_3+ -GCTCTA-AGCGCTGGGCGTCGCC-TNCGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 191 1206390_3+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 208 1833693_1+ -ACTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 192 1792823_1- CGCTCTA-AGCGCTGG-CGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 193 1868773_1+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 195 1694572_1+ CACTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 205 1830205_1+ -ACTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 192 1658213_1+ CACTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 201 1658191_1+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 190 1792648_1+ -ACTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 187 1206510_3+ CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 197 1658223_1+ CACTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 192 1804722_1- CACTCTA-AGCGCTG--CGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 188 1792774_1- CGCTCTA-AGCGCTGG-CGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 182 1868980_1- CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 183 1658205_1+ CACTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 182 1830268_1+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 172 1805632_1+ CACTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 172 1830235_1+ CACTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 171 1833641_1+ -ACTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 169 1838633_1+ -GCTCTA-AGCGCTGGGCGTCGCCCT-CGCCCTTCTTGCTGCTCTTGTGCTTCTTCGCCA 168 1824593_1+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 152 1797111_1+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 148 1838691_1+ CACTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 148 1841561_1+ CACTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 147 1805782_1+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 145 1797370_1+ -GCTCTA-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 144 1797322_1+ CACTCTG-AGCGCTGGGCGTCGCC-T-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 139 1804633_1- CACTCTACAGCGCTGG-CGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 121 667670_4- CGCTCTA-AGCNCTGGGCGTCGCCCT-CGCC-TTCTTTCTGCTCTTGTGCCTCTTCGCCA 104 1792618_1- CACTCTA-AGCGCTGG-CGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 97 1789641_1- CGCTCTA-AGCGCTGG-CGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 64 1792841_1- CGCTCTA-AGCGCTGG-CGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 64 1745916_3- CTCTA-AGCGCTGG-CGTCGCCTT-CGCT-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 54 1606161_3- TGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 43 1609465_3- GTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 40 1868928_1- TCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 39 1765793_1- C-TTCTTGCTGCTCTTGTGCTTCTCCGCCA 29 1789592_1- TGCTCTTGTGCTTCTTCGCCA 21 1765682_1- CTTGTGCTTCTTCGCCA 17 1804649_1- TCGCCA 6 1792733_1- CGCCA 5 ____________________________________________________________ consensus CGCTCTA-AGCGCTGGGCGTCGCCCT-CGCC-TTCTTGCTGCTCTTGTGCTTCTTCGCCA 275 . : . : . : . : . : . : 1658206_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACATCGTC-A-C-ATCCTTC-A 300 1658183_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCNACAGCGTC-A-C-ATCCTTC-A 288 1658209_1+ NCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGANAGCGTC-A-C-ATCCTTC-A 277 1694407_1+ NCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAG 283 1658217_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 273 1658204_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 282 1658200_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 276 1658214_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCNACAGCGTC-A-C-ATCCTTC-A 277 1658182_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 276 1206418_3+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 266 1658232_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCNACAGCGTC-A-C-ATCCTTC-A 263 1206415_3+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCNACAGCGTC-A-C-ATCCTTC-A 280 1206420_3+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 282 1206393_3+ GC-CCTT-TTC-AG-CTCG-CATCACACCAC--ACGCAAC-GCGTC---C-ATCCTTC-A 262 1828042_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGT 272 1658185_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCNTC-A-C-ATCCTTC-A 270 1206481_3+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAG--TC-ATC-ATCCTTC-A 268 1658195_1+ NCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCNANAGCGTC-A-C-ATCCTTC-A 260 1658225_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACNCGACAGCGTC-A-C-ATCCTTC-A 258 1658208_1+ ACGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCNACAGCGTC-A-C-ATCCTTC-A 263 1838677_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-C-ATCCTTC-A 243 1381656_3+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAG--TC-AGC-ATCCTTC-A 244 1206390_3+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCAACAGCTTC-A-C-ATCCTTC-A 262 1833693_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-C-ATCCTTC-A 245 1792823_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 247 1868773_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-CGATCCTTC-A 249 1694572_1+ ACGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-N-C-ATCCTTC-A 259 1830205_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAG--TC-A-C-ATCCTTC-A 244 1658213_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCNACAGCGTC-A-C-ATCCTTC-A 255 1658191_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 244 1792648_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGN-TC-A-C-ATCCTTC-A 240 1206510_3+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 251 1658223_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 246 1804722_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 242 1792774_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 236 1868980_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 237 1658205_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCNACATCGTC-A-C-ATCCTTC-A 236 1830268_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-C-ATCCTTC-A 225 1805632_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-C-ATCCTTC-A 225 1830235_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-C-ATCCTTC-A 224 1833641_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGAC 227 1838633_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAG--TCCACC-ATCCTTCCA 223 1824593_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAG--TC-A-C-ATCCTTC-A 204 1797111_1+ GCGCCTTGTTC-AGGCTCGGC 207 1838691_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-C-ATCCTTC-A 201 1841561_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAG--TC-AGC-ATCCTTC-A 200 1805782_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-C-ATCCTTC-A 198 1797370_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGC-TC-A-C-ATCCTTC-A 197 1797322_1+ GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACA-CGTC-G-C-ATCCTTC-A 192 1804633_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 175 667670_4- GCGCCTAGTTC-AGGCTCGGCC 163 1792618_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 151 1789641_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 118 1792841_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 118 1745916_3- GCGCTTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 108 1606161_3- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 97 1609465_3- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 94 1868928_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 93 1765793_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 83 1789592_1- GCGCCTTGATC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 75 1765682_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 71 1804649_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 60 1792733_1- GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 59 1688918_1- CNTTGTTC-AGGNTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 51 1688920_1- CNTTGTTC-AGGTTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 51 1688921_1- CTTGTTC-AGGNTCGGCATCACACCAC-CACGCGACATCGTC-A-C-ATCCTTC-A 50 1688916_1- TTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCTTTC-A 50 1688922_1- TNTTCNAGGCTCGGCATCACACCAC-CACGCGANAGCGTC-A-C-ATCTTTCAN 50 1688915_1- GTTC-AGGNTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 47 1688919_1- GTTC-AGGTTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 47 1744264_3- TCGGCATCACACCACTCACGCGACAGCGTC-A-C-ATCCTTC-A 40 1782620_1- CGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 38 1765664_1- GCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 36 1792757_1- ACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 31 ____________________________________________________________ consensus GCGCCTTGTTC-AGGCTCGGCATCACACCAC-CACGCGACAGCGTC-A-C-ATCCTTC-A 329 . : . : . : . : . : . : 1658206_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 358 1658183_1+ GGAACATGCCNAGGTCGTCNTCNTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 346 1658209_1+ GGAACATGCCGANGTCNTCNTCNTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTNTCAG 335 1658217_1+ GGANCATGCCGAGGTCNTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 331 1658204_1+ GGANCATGCCGAGGTCGTCGTCNTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 340 1658200_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 334 1658214_1+ GGANCATGCCNAGGTCGTCNTCNTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 335 1658182_1+ GGANCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 334 1206418_3+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 324 1658232_1+ GGANCATGCCNAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 321 1206415_3+ GGANCATGCCAAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 338 1206420_3+ GGAACATGCCAANGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 340 1206393_3+ -GAACATGCC-ANGTC-TC-TCTTGG-C 317 1658185_1+ GGANCATGCCGAGGTCNTCNTCNTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 328 1206481_3+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAANGCGTTACCGTGCGGGGTTTCAG 327 1658195_1+ GGAACATGCCAAAGTCTTCTTCTTGG-CGCACGGCAA-NCGTCACCGTGCGGGGTGTNAG 318 1658225_1+ GGAGCGTGCCNAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 316 1658208_1+ GGANCATGCCAAGGTCGTCGTCGTGG-CGCACGGNNA-NCNTCACCGTGCGGGGTGTCAG 321 1838677_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 301 1381656_3+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 302 1206390_3+ GGANCGTNCCGAAGTCGTCTTCTTGA-CGCACGGCAA--CGTCACCGTGCGGGGTGTCAG 319 1833693_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 303 1792823_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 305 1868773_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 307 1694572_1+ GGANCATGCCNAGGTC 319 1830205_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGT 302 1658213_1+ GGANCATGCCNANGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 313 1658191_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 302 1792648_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 298 1206510_3+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 309 1658223_1+ GGANCATGCCNAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 304 1804722_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 300 1792774_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 294 1868980_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 295 1658205_1+ GGANCATGCCNAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 294 1830268_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 283 1805632_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 283 1830235_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 282 1838633_1+ GGAGCATGC-GAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGT 280 1824593_1+ GGAGCGTGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 262 1838691_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 259 1841561_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCANCGTGCGGGGTGTCAG 258 1805782_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 256 1797370_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTC 255 1797322_1+ GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 250 1804633_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 233 1792618_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 209 1789641_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 176 1792841_1- GNAGCGTGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 176 1745916_3- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 166 1606161_3- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 155 1609465_3- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 152 1868928_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 151 1765793_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 141 1789592_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 133 1765682_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 129 1804649_1- GGAGCGTGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 118 1792733_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 117 1688918_1- GGAGCATGCCGAGGTTGTNGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 109 1688920_1- GGAGCATGCCGAGGTTGTTGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 109 1688921_1- GGAGCATGCCGAGGTNGTNGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 108 1688916_1- GGAGCATGCCGAGGTNGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 108 1688922_1- GGNGCATGCNGAGGTCGTCGTNTTGN-CGTACGGCAA-GNGTCACCGTGTGGGGTGTCAG 108 1688915_1- GGAGCATGCCGAGGTTGTNGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 105 1688919_1- GGAGCGTGCCGAGGTTGTNGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 105 1744264_3- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 98 1782620_1- GGAGCGTGCCGAGGTCGTCGTCGTGGGCGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 97 1765664_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 94 1792757_1- GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 89 1792782_1- G-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 33 ____________________________________________________________ consensus GGAGCATGCCGAGGTCGTCGTCGTGG-CGCACGGCAA-GCGTCACCGTGCGGGGTGTCAG 387 . : . : . : . : . : . : 1658206_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGGGACA-GCTCCAGCAGCT 415 1658183_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 402 1658209_1+ G-CGCTTCGGCTTCTTTNCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCANCAGCT 391 1658217_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 387 1658204_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 396 1658200_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 390 1658214_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCANCT 391 1658182_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 390 1206418_3+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-A 381 1658232_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 377 1206415_3+ GGCGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-A 396 1206420_3+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCC 398 1658185_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 384 1206481_3+ G-CGCTT 386 1658195_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTC-CCGCCTTCACGG-AAA-NCTCCAACAACT 373 1658225_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 372 1658208_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCNCCGCCTTCACGG-ANA-GCTCCAGCAGCT 377 1838677_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 357 1381656_3+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGGCTTCACGG-ACAGGTTCCAGCAGCT 359 1206390_3+ G-CGCTTCGGCTTCTTT 378 1833693_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 359 1792823_1- G-CGCTTCGGCTTCTTTGCCTGCGTG-CTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 361 1868773_1+ G-CGC 366 1658213_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 369 1658191_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCA-CT 357 1792648_1+ G-CGCTTCGGCTTCTTTGCCTG 357 1206510_3+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 365 1658223_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 360 1804722_1- G-CGCTTCGGCTTCTTTGCCTGC-TG-CTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 355 1792774_1- G-CGCTTCGGCTTCTTTGCCTGC-TG-CTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 349 1868980_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 351 1658205_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 350 1830268_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 339 1805632_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 339 1830235_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 338 1824593_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 318 1838691_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 315 1841561_1+ G-CGCTTCGGCTTCTTTGCC 317 1805782_1+ G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 312 1797322_1+ G-CGCTTCGGCTTCTTTGCCTGC 309 1804633_1- G-CGCTTCGGCTTCTTTGCCTGC-TG-CTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 288 1792618_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 265 1789641_1- G-CGCTTCGGCTTCTTTGCCTGC-TGG-TCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 231 1792841_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 232 1745916_3- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCTTTCACGG-ACA-GCTCCAGCAGCT 222 1606161_3- G-CGCTTCGGCTTCTTTGCCTGC-TG-CTCGCCGCNTTCACGG-ACA-GCTCCAGCAGCT 210 1609465_3- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 208 1868928_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 207 1765793_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 197 1789592_1- G-CGCTTCGGCTTCTTTGCATGC-TGG-TCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 188 1765682_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGGTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 185 1804649_1- G-CGCTTCGGCTTCTTTGCCTGC-TGG-TCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 173 1792733_1- G-CGCTTCGGCTTCTTTGCCTGC-TGG-TCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 172 1688918_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGNTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 165 1688920_1- G-CGCTTCGGTTTCTTTGCCTGC-TGGNTCGCCGCCTTCACGG-ACA-GCTCCAGCAGNT 165 1688921_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 164 1688916_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCTTTCACGG-ACA-GCTCCAGCAGNT 164 1688922_1- G-CGCTTCGGNTTCTTTGCTTGT-TGGNTCGCCGCGTTCACGG-ACA-GNTCCAGCAGTT 164 1688915_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 161 1688919_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGNT 161 1744264_3- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACATGCTCCAGCAGCT 155 1782620_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 153 1765664_1- G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 150 1792757_1- G-CGCTTCGGCTTCTTTGCCTGC-TGG-TCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 144 1792782_1- G-CGCTTCGGCTTCTTTGCCTGC-TG-CTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 88 1792764_1- TCACGG-ACA-GCTCCAGCAGCT 21 ____________________________________________________________ consensus G-CGCTTCGGCTTCTTTGCCTGC-TGGCTCGCCGCCTTCACGG-ACA-GCTCCAGCAGCT 443 . : . : . : . : . : . : 1658206_1+ CGGCTGTCAGGTACTCCAGCATCGCCGCCATGTTACACAGCG-C-CCGAC--CGCCGA-T 470 1658183_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-NCACAGCG-C-CCGACG-CGCCNA-T 457 1658209_1+ CGGNTGTCANGTNCTCCAACACCGCCNCCATGT-ATNCANCG-C-CCGAC--CGCCCA-T 445 1658217_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CNCCGA-T 442 1658204_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGAC--CNCCGA-T 450 1658200_1+ CGGCTGTCAGGTACTCCAACACCGCCGCCATGTTACACAGCG-C-CCGACN-CNCCAA-T 446 1658214_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACANCG-C-CCGACG-CGCCGA-T 446 1658182_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-NCACAGCG-C-CCGACG-CGCCNA-T 445 1658232_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 432 1658185_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGTTANACANCG-C-CCNACN-CGCCAA-T 440 1658195_1+ CGGCTGTCANGTA-TCCANCACCGCCGCCATGT-NTACATCN-C-CCGAC--CNCCNAAT 427 1658225_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 427 1658208_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAACN-C-CCGACG-CNCCGA-N 432 1838677_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 412 1381656_3+ CGGGTGTCAAGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACGGCGGCGATT 416 1833693_1+ CGGCTGTCAGG 419 1792823_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGC-GA-T 415 1658213_1+ CGGCTGTCAGGTACTCCAACACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 424 1658191_1+ CGGCTGTCANGTACTCCANCACCGCCGCCATGTTA-ACAACG-C-CCGAAG-CNCCNAAT 413 1206510_3+ CGGCTGTCANGTACTCCAGCACCGCCGCCATGTTACACAGCG-C-CCGACG-CGCCCAAT 422 1658223_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCNA-T 415 1804722_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACA-CGGC-CCGACG--GCCGA-T 409 1792774_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG--GCCGA-T 403 1868980_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 406 1658205_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGAC--CGCCGA-T 404 1830268_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGAC 396 1805632_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG 398 1830235_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CC 395 1824593_1+ CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCG 375 1838691_1+ CGGCTGTCAGGTACTCCAGCATCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 370 1805782_1+ CGGCTGTCAGG 372 1804633_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG--GCCGA-T 342 1792618_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 320 1789641_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CNC-GA-T 285 1792841_1- CGGCTGTCAGATACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 287 1745916_3- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 277 1606161_3- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAN-G-C-CCGACG--NCCGA-T 263 1609465_3- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 263 1868928_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 262 1765793_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 252 1789592_1- CGGCTGTCAGCTACTCCAGCACCGCCGCCATGC-ACACAG-G-C-CCGACG-C-CCGA-C 241 1765682_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 240 1804649_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 228 1792733_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCA 232 1688918_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 220 1688920_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 220 1688921_1- CGGCTGTCAGGTACTCCAGCATCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 219 1688916_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 219 1688922_1- CGGCTGTCAGGTATTCCAGCACCGCCGCCANGT-ACACAGCG-C-CCGANG-CGCCGA-N 219 1688915_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 216 1688919_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 216 1744264_3- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 210 1782620_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 208 1765664_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 205 1792757_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 199 1792782_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 143 1792764_1- CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-CGCCGACG-CGCCGA-T 77 ____________________________________________________________ consensus CGGCTGTCAGGTACTCCAGCACCGCCGCCATGT-ACACAGCG-C-CCGACG-CGCCGA-T 498 . : . : . : . : . : . : 1658206_1+ GCNG-CGGGCA-TA-C-TGG-CCGCGGCGCAACAACGAACCC--A-AC-GG-CCA-CGGG 519 1658183_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAACAACNAACCC--ACAC-GG-CCA-CGGG 507 1658209_1+ ACGG-CGGGNA-TA-C-TGG-CNGCGGNGCTNCANCGAACC---ACCC-AA-CCA-GGGG 494 1658217_1+ GCGG-CGGGCA-TA-C-TGGGCCGCGGCGCA-CAACGAACCC--ACACNGG-CCA-CNGG 493 1658204_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCA-CANC-AACCC--ACAC-GG-CCA-CGGG 498 1658200_1+ GCGG-CGGGCA-TA-C-TGG-CC-CNGNGCA-CA-CCAACCC--ACAC-GG-CCN-CGGG 493 1658214_1+ GCGG-GGGGCA-TA-C-TGG-CCGCGGCGCA-CAGCNAACCC--ACAC-GGCCCA-CGGG 496 1658182_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCA-CANCGAACCC--ACAC-GGNCCA-CNGG 495 1658232_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAACAACGAACCC--ACAC-GGNCCA-CGGG 483 1658185_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGGNCAACAACAAACCC--ACAC-GGCCCA-CGGG 491 1658195_1+ CCGG--GGGCA-TA---TGG-CCGCGGNGCAACAACNAACCC--ACACNGG-CCA-CGGG 476 1658225_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAACAACAAACCC--ACAC-GGGCCA-CGGG 478 1658208_1+ GCGGGCGGGCA-TA-C-TGG-CCGCGGNGCANCAGCAAACNC--ACCC-GGCCCC-CGGG 484 1838677_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 463 1381656_3+ GCGG--GGGCAATAAC-TGGGC-GCGGGGGAG-AGGAAGCCCCAACAC-GGGCCAAGGGG 470 1792823_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GG-CCA-CGGG 465 1658213_1+ GCGG-GGGGCA-TA-C-TGG-CCGCGGCGCA-CAGCGA-CCC--ACAC-GGCCCA-CGGG 473 1658191_1+ GCGG-GNGGCA-TA-C-TGGGCCGCNGGGCAACAACNAANCCAAA-AN-GG-CCAANGGG 466 1206510_3+ TCGG 482 1658223_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAACAACNAACCC--ACAC-GGCCCA-CGGG 466 1804722_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GG-CCA-CGGG 459 1792774_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GG-CCA-CGGG 453 1868980_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 457 1658205_1+ GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAACANC-AACCC--ACAC-NGCCCA-CNGG 454 1838691_1+ GCG--C-GGCA-TA-C-TGG-CCGCGGC 423 1804633_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GG 394 1792618_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCG 375 1789641_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 336 1792841_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 338 1745916_3- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-C 328 1606161_3- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GG-CCA-CGGN 313 1609465_3- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 314 1868928_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 313 1765793_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACACCGGCCCA-CGGG 304 1789592_1- GCGG-CGGGCA-CA-C-TG 297 1765682_1- GCGG-CGGGCA-TA-CGTGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCC 293 1804649_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 279 1688918_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 271 1688920_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 271 1688921_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 270 1688916_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 270 1688922_1- GGGG-CGGGCA-TA--GTGG-CCGNGGNGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 270 1688915_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 267 1688919_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 267 1744264_3- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 261 1782620_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 259 1765664_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 256 1792757_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 250 1792782_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 194 1792764_1- GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 128 ____________________________________________________________ consensus GCGG-CGGGCA-TA-C-TGG-CCGCGGCGCAGCAGCGAGCCC--ACAC-GGCCCA-CGGG 549 . : . : . : . : . : . : 1658206_1+ G-AAAA-TCAAA-C--GG-CTTC-CCNGA-ACNGCC-CAA 570 1658183_1+ G-AAAA-TNAAA-C--GGCCTTC-GCGGA-ACGGCCGCAAACTTA-T 559 1658209_1+ GGAAAAAT-AAA-C--NGNCTTC-CCGGAANN 549 1658217_1+ G-AAAA-TNAAAAC--GGCCTTC-NCGGA-ACGGCNCCAACCT-A-TCCC 545 1658204_1+ G-AAAA-TCAAA-C--GGCCTTC-CC-GA-ACGGCCCCAA-CTTA-T 548 1658200_1+ G-AAAAAT-AAAAC---GCCT-C-CCCGA-ACGGCNGCAACTTTTTTC 545 1658214_1+ G-AAAA-TCAAA-C--GGGCTTC-GCGGA-ACNGCCGCAA-CTT 548 1658182_1+ G-AAAA-TCAAA-C--GGCCTTC-GCGGA-ACNGGCGCAAACTT 548 1658232_1+ G-AAAA-TCAAA-C--GGCCTTC-NCCGA-ACG 536 1658185_1+ G-AAAA-T-ANAACC--G-CTTC-GCGGA-ACN 543 1658195_1+ G-AAAA-TTAAAAC--AG-CTTC-CCCGAAAC 530 1658225_1+ G-AAAA-TCAAAAC--GGCCTTT-GCGGA--CGGCC-CAAGCTTA-TCCCTTTAATGAN- 528 1658208_1+ G-AAAAAT-AAAAC--GGGCTTT-TCGGA-ACGGCC-CAAACNTANTCCCTTTAATNAAA 537 1838677_1+ G-AAGA-TCAGA-CC-GGCCTTC-GCGGAG 518 1381656_3+ G-AAGA-TNAAAACCGGGCCTTTTG 528 1792823_1- G-AAGA-TCAGA-CC-GGCCTT 521 1658213_1+ G-AAAA-TCAAA-C--GGNCTTC-NCGGA-ACGGGCGCAAACTTATTCCCTTTAATGAA- 525 1658191_1+ N-AAAAAT-AAAACN-GGCCTCC-CCGNA-AC 521 1658223_1+ G-AAAA-TCA-A-NC-GGCCTTC-GCGGAC 520 1792774_1- G-AAGA-TCAGA-CC-GGCCTTCCG 509 1868980_1- G-AAGA-TCAGA-CC-GGCCTTC-GCG 512 1658205_1+ G-AAAA-TCAAA-C--GGCCTTC-NCGGA-ACGGCCGCAANCTTA-TCCCTTTAATGAA- 505 1789641_1- G-AAGA-T 394 1792841_1- G-A 397 1606161_3- G-AAGA-TCAGA-CC-GGCCTTC 369 1609465_3- G-AAGA-NCAGA-CC-GGCC 370 1868928_1- G-AAGA-TCAGA-CC-GGCCTT 369 1765793_1- G-AAGA-TCAGA-CC-GGCCTTC-GCGG 359 1804649_1- G-A 338 1688918_1- G-AAGA-TCAGA-CC-GGCTTTC-GCGGA-GCGGCC 325 1688920_1- G-AAGA-TCAGA-CC-GGCTTTC-GCGGA-GCGGCC 325 1688921_1- G-AAGA-TCAGA-CC-GGCTTTC-GCGGA-GCGGCC 324 1688916_1- G-AAGA-TCAGA-CC-GGCNTTC-GCGGA-GCGGCC 324 1688922_1- G-ANGA-TCAGA-CC-GG-CTTTGGCGGA-NCGNCC 324 1688915_1- G-AAGA-TCAGA-CC-GGCCTTC-GCGGA-GCGGCC 321 1688919_1- G-AAGA-TCAGA-CC-GGCCTTT-GCGGA-GCGGCC 321 1744264_3- G-AAGA-TCAGA-CC-GGCCTT 317 1782620_1- G 319 1765664_1- G-AAGA-TCAGA-CC-GGCCTTC-GCGG 311 1792757_1- G-A 309 1792782_1- G-A 253 1792764_1- G-AAGA-TCAGA-CC-GGCCTTC-GCG 183 ____________________________________________________________ consensus G-AAGA-TCAGA-CC-GGCCTTC-GCGGA-ACGGCCGCAAACTTA-TCCCTTTAATGAA- 601 . : . : . : . : . : . : 1658225_1+ -GTTA 562 1658208_1+ GGGTAATTTTA-TT 571 1658213_1+ GGTTAATTTAACTT 560 1658205_1+ GGTTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 540 ____________________________________________________________ consensus GGTTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 636

Date: 16:19:30 on Sun 17 Dec 117.