alignments/CcruzaQ_1846.align.Z


1.  T. cruzi epimastigote normalized cDNA Library
2. T.cruzi epimastigote non-normalized cDNA Library
3. T.cruzi epimastigote normalized cDNA Library
4. Trypanosoma cruzi Y (Tomoo Tanaka)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 1846 ******************** . : . : . : . : . : . : 1805748_1- AAACGTAGTCCCCCGACTAACGCCTCAAACCAACAAGACACACACCCACCATAGGACAAA 60 ____________________________________________________________ consensus AAACGTAGTCCCCCGACTAACGCCTCAAACCAACAAGACACACACCCACCATAGGACAAA 60 . : . : . : . : . : . : 1805748_1- CACATACGAAACAAGGACTGACCACTGCAAGATGCCCGTGAGGTGGGGATGTTGCTGGTC 120 ____________________________________________________________ consensus CACATACGAAACAAGGACTGACCACTGCAAGATGCCCGTGAGGTGGGGATGTTGCTGGTC 120 . : . : . : . : . : . : 1805748_1- CTTTCCCCAGACGCGTGCCACAAGATCCACCTGCAACAAAGAAAATATGGAGGCGTGCTC 180 ____________________________________________________________ consensus CTTTCCCCAGACGCGTGCCACAAGATCCACCTGCAACAAAGAAAATATGGAGGCGTGCTC 180 . : . : . : . : . : . : 1805748_1- CAAGGCATCGCCAAACGCACAAAAAAAGGGAAGCTGCCTCACAAGTAGTTGTACTGCTTT 240 1805777_1- TCACAAGTAGTTGTACTGCTTT 22 ____________________________________________________________ consensus CAAGGCATCGCCAAACGCACAAAAAAAGGGAAGCTGCCTCACAAGTAGTTGTACTGCTTT 240 . : . : . : . : . : . : 1805748_1- GTGCCCTTTTCCTGCCGCTCCTGCCGCCTCAGTGGCGCCATGCGGATGTCCTGATCCGTC 300 1805777_1- GTGCCCTTTTCCTGCCGCTCCTGCCGCCTCAGTGGCGCCATGCGGATGTCCTGATCCGTC 82 ____________________________________________________________ consensus GTGCCCTTTTCCTGCCGCTCCTGCCGCCTCAGTGGCGCCATGCGGATGTCCTGATCCGTC 300 . : . : . : . : . : . : 1805748_1- ATGTACATCACTCGTTCCGGCACCGTCGCAGAAACAGCAA 360 1805777_1- ATGTACATCACTCGTTCCGGCACCGTCGCAGAAACAGCAAGGACCTCGCGCTTAACTAAT 142 ____________________________________________________________ consensus ATGTACATCACTCGTTCCGGCACCGTCGCAGAAACAGCAAGGACCTCGCGCTTAACTAAT 360 . : . : . : . : . : . : 1805777_1- GCGG 146 ____________________________________________________________ consensus GCGG 364

Date: 14:50:41 on Sun 17 Dec 117.