alignments/CcruzaQ_2211.align.Z


1.  T. cruzi epimastigote normalized cDNA Library
2. T.cruzi epimastigote non-normalized cDNA Library
3. T.cruzi epimastigote normalized cDNA Library
4. Trypanosoma cruzi Y (Tomoo Tanaka)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 2211 ******************** . : . : . : . : . : . : 1658148_1+ TATANACGCANGAGGTTGGCCCTTTTTTTAAANTTTTTTTTAAATGCTTAATCATGTTAG 60 1745935_3- AAATGCTTAATCATGTTAG 19 ____________________________________________________________ consensus TATANACGCANGAGGTTGGCCCTTTTTTTAAANTTTTTTTTAAATGCTTAATCATGTTAG 60 . : . : . : . : . : . : 1658148_1+ CAACAACCGCGTAGCTGTGAAACACAAAATATGTTTTCCCTCATTGCTTCTTGTTCTTCT 120 1745935_3- CAACGACCGCGTAGCTGTGAGACACAAAATATGTTTTCCCTCATTGCTTCTTGTTCTTCT 79 ____________________________________________________________ consensus CAACAACCGCGTAGCTGTGAAACACAAAATATGTTTTCCCTCATTGCTTCTTGTTCTTCT 120 . : . : . : . : . : . : 1658148_1+ GTTGTTGTTGCTTTTTTTTTTTT-GCTCGTTCGTCCCTCTCGTTGCTGTTGGCTGANCTT 179 1745935_3- GTTGTTGTTGCTTTTTTTTTTTTTGCTCGTTCGTCCCTCTCGTTGCTGTTGGCTGAGCTT 139 ____________________________________________________________ consensus GTTGTTGTTGCTTTTTTTTTTTTTGCTCGTTCGTCCCTCTCGTTGCTGTTGGCTGAGCTT 180 . : . : . : . : . : . : 1658148_1+ TTCGCGTTTTTTTTTTATGTTTGTCTTGGCCAGGTATTCGTGTTGCCCTCAGTCCCCATG 239 1745935_3- TTCGCGTTTTTTTTTTATGTTTGTCTTGGCCAGGTATTCGTGTTGCCCTCAGTCCCCATG 199 ____________________________________________________________ consensus TTCGCGTTTTTTTTTTATGTTTGTCTTGGCCAGGTATTCGTGTTGCCCTCAGTCCCCATG 240 . : . : . : . : . : . : 1658148_1+ CTTTTTCTCTTTTCCTCCCGCCTAGGANTTCCGCCTCCTGTTTCTTGGCGTCGGTGANCC 299 1745935_3- CTTTTTCTCTTTTCCTCCCGCCTAGGACTTCCGCCTCCT 259 ____________________________________________________________ consensus CTTTTTCTCTTTTCCTCCCGCCTAGGACTTCCGCCTCCTGTTTCTTGGCGTCGGTGANCC 300 . : . : . : . : . : . : 1658148_1+ CNC 302 ____________________________________________________________ consensus CNC 303

Date: 16:27:36 on Sun 17 Dec 117.