alignments/CcruzaQ_452.align.Z


1.  T. cruzi epimastigote normalized cDNA Library
2. T.cruzi epimastigote non-normalized cDNA Library
3. T.cruzi epimastigote normalized cDNA Library
4. Trypanosoma cruzi Y (Tomoo Tanaka)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 452 ******************** . : . : . : . : . : . : 1697059_1- AGGGCAAGCCCAGTTTTTCCGTNACTTCCGTNGNGTTCAGGGCATNGGGAAGTTNTTNTT 60 ____________________________________________________________ consensus AGGGCAAGCCCAGTTTTTCCGTNACTTCCGTNGNGTTCAGGGCATNGGGAAGTTNTTNTT 60 . : . : . : . : . : . : 1697059_1- TGTTGGCAAATACAAGAAGCACGGCATTGCGAAGCTNGTCCTCTGTGAACATNTTCTCCA 120 ____________________________________________________________ consensus TGTTGGCAAATACAAGAAGCACGGCATTGCGAAGCTNGTCCTCTGTGAACATNTTCTCCA 120 . : . : . : . : . : . : 1697059_1- GCTCCCTGTCGTGCCTTACCGATACGCTCCCTGTCATTGGAGTCCACGACAAAGATGAGG 180 1206462_3- TCCCTGTCATTGGAGTCCACGACAAAGATGAGG 33 ____________________________________________________________ consensus GCTCCCTGTCGTGCCTTACCGATACGCTCCCTGTCATTGGAGTCCACGACAAAGATGAGG 180 . : . : . : . : . : . : 1697059_1- CCGTT-CGTGTTCTGGTAGTAGTGACGCCACAGCGGGCGCAGAACGTCCTGGCCGCCAAC 239 1206462_3- CCGTTTCGTGTTCTGGTAGTAGTGACGCCACAGCGGGCGCAGAACGTCCTGGCCACCGAC 93 ____________________________________________________________ consensus CCGTTTCGTGTTCTGGTAGTAGTGACGCCACAGCGGGCGCAGAACGTCCTGGCCACCAAC 240 . : . : . : . : . : . : 1697059_1- GTCCCACATGGTAAACTTGAGGTTNTTGTACTCCACCGTNTCCACATTAAACCCGATGGT 299 1206462_3- GTCCCACATGGTAAATTTGAGGTTCTTGTACTCCACCGTCTCCACATTAAACCCGATCGT 153 ____________________________________________________________ consensus GTCCCACATGGTAAACTTGAGGTTCTTGTACTCCACCGTCTCCACATTAAACCCGATCGT 300 . : . : . : . : . : . : 1697059_1- GGGGATCGTTGTAACGATCTCGCCAAGTTTAAGTTTGTACAGAATTGTNGTCTTACCAGC 359 1206462_3- GGGAATCGTTGTAACGATCTCACCAAGTTTAAGTTTGTACAGAATTGTTGTCTTACCAGC 213 ____________________________________________________________ consensus GGGAATCGTTGTAACGATCTCACCAAGTTTAAGTTTGTACAGAATTGTTGTCTTACCAGC 360 . : . : . : . : . : . : 1697059_1- AGCGTCAAGGCCCACCATCAGAATGCGCACCTCCTGCTTGCCCAGGAGCGANTTGAATGC 419 1206462_3- AGCGTCAAGGCCCACCATCAGAATGCGCACCTCCTGCTTGCCCAGGAGCGACTTGAATGC 273 ____________________________________________________________ consensus AGCGTCAAGGCCCACCATCAGAATGCGCACCTCCTGCTTGCCCAGGAGCGACTTGAATGC 420 . : . : . : . : . : . : 1697059_1- GGACGCTAACCACTGGCCCATTGAATTTACTTCTTAT-CCTTGTATTCNNAGCGTTTTTT 478 1206462_3- GGACGCTAACCACTGGCCCATTGAATTTACTTCTTATACCTTGTATTCCTAGCGTTTTAT 333 ____________________________________________________________ consensus GGACGCTAACCACTGGCCCATTGAATTTACTTCTTATACCTTGTATTCCTAGCGTTTTAT 480 . : . : . : . : . : . : 1697059_1- TTTTAGGAGGCNCAATCCTCGTGCTT-GA-ATAATTNNCCTCAGAGGCCAA 532 1206462_3- TTTTAGGAGGCTC--TTGAAGTACACAGACA-AAGGCAGCT--GAG-CCTCGTGCC 383 ____________________________________________________________ consensus TTTTAGGAGGCTCAATCCAAGTACACAGACATAAGGCACCTCAGAGGCCAAGTGCC 536

Date: 16:25:16 on Sun 17 Dec 117.