alignments/CcruzaQ_85.align.Z


1.  T. cruzi epimastigote normalized cDNA Library
2. T.cruzi epimastigote non-normalized cDNA Library
3. T.cruzi epimastigote normalized cDNA Library
4. Trypanosoma cruzi Y (Tomoo Tanaka)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 85 ******************** . : . : . : . : . : . : 1833712_1+ GATGCTTTTTGACAAGTACACCTCCACCAAGGCGGTTGCGCAAACAAGACACTTGCCTCT 60 ____________________________________________________________ consensus GATGCTTTTTGACAAGTACACCTCCACCAAGGCGGTTGCGCAAACAAGACACTTGCCTCT 60 . : . : . : . : . : . : 1833712_1+ CGCACAGCCGCAGATGAGGTGCGGGAGTACAATCGTGAGCGCGATCACCTTGAACGGAAC 120 ____________________________________________________________ consensus CGCACAGCCGCAGATGAGGTGCGGGAGTACAATCGTGAGCGCGATCACCTTGAACGGAAC 120 . : . : . : . : . : . : 1833712_1+ CTTGCAGGGCTGAAGAACAAGGTGAACAAGGACGCGGAGAACAATCGCACCGACAAGAAT 180 1824328_1+ CTGAAGAACAAGGTGAACAAGGACGCGGAGAACAATCGCACCGACAAGAAT 51 ____________________________________________________________ consensus CTTGCAGGGCTGAAGAACAAGGTGAACAAGGACGCGGAGAACAATCGCACCGACAAGAAT 180 . : . : . : . : . : . : 1833712_1+ CGTATCACCACAGAGAACGTCATTCTCATCAGGGAGATCAACGACTTGCGCAAGGAGGCA 240 1824328_1+ CGTATCACCACAGAGAACGTCATTCTCATCAGGGAGATCAACGACTTGCGGAAGGAGGCA 111 ____________________________________________________________ consensus CGTATCACCACAGAGAACGTCATTCTCATCAGGGAGATCAACGACTTGCGCAAGGAGGCA 240 . : . : . : . : . : . : 1833712_1+ CGACGGTTGGCTGAGAAAGCGGGCGCCTGGCGAAAGACGGAAAAGTGTGGCGCATCCTTG 300 1824328_1+ CGACGGTTGGCTGAGAAGGCGGGTGC-TGGCGACAGACGGAAAAGTGTGGCGCATCCTTG 170 ____________________________________________________________ consensus CGACGGTTGGCTGAGAAAGCGGGCGCCTGGCGAAAGACGGAAAAGTGTGGCGCATCCTTG 300 . : . : . : . : . : . : 1833712_1+ CAACAAGAGGAGACGAAACGCGAACTTGCGATGCAACGGGCGGAATTGAAGCGTCTGCGC 360 1824328_1+ CAACAAGAGGAGACGAAACGCGAGCTTGCGATGCAACGGGCGGAATTGAAGCGTCTGCGC 230 ____________________________________________________________ consensus CAACAAGAGGAGACGAAACGCGAACTTGCGATGCAACGGGCGGAATTGAAGCGTCTGCGC 360 . : . : . : . : . : . : 1833712_1+ GCCTTGGCGAGAAAACTGGCAGAAGAGGCACGTGAAAAAGGCATCACGTTAACGCTCCCT 420 1824328_1+ GCCTTGGC-AGAAAACTGGCAGAAGAGGCACGTGAAAAAGGAATCACGTTAACGCTCCCT 289 ____________________________________________________________ consensus GCCTTGGCGAGAAAACTGGCAGAAGAGGCACGTGAAAAAGGAATCACGTTAACGCTCCCT 420 . : . : . : . : . : . : 1833712_1+ TCCTTGACTGAAGGTAGACCGGGGAGTTGAGTTGTCATCGATGTATTTTTATTTGTGGAT 480 1824328_1+ TCCTTGACTGAAAGTAGACCGGGGAGTTGAGTTGTCATCG 349 ____________________________________________________________ consensus TCCTTGACTGAAAGTAGACCGGGGAGTTGAGTTGTCATCGATGTATTTTTATTTGTGGAT 480 . : . : . : . : . : . : 1833712_1+ TGTGTTTTTTTCTTTCTTTTATTTTTTCCCCTTTGGTTGTTTCTCTCTTGTTTATGTGCG 540 ____________________________________________________________ consensus TGTGTTTTTTTCTTTCTTTTATTTTTTCCCCTTTGGTTGTTTCTCTCTTGTTTATGTGCG 540 . : . : . : . : . : . : 1833712_1+ TGGACGTGGACGTGATTGTTCATTTG 566 ____________________________________________________________ consensus TGGACGTGGACGTGATTGTTCATTTG 566

Date: 17:20:23 on Mon 18 Dec 117.