alignments/CcruzaQ_941.align.Z


1.  T. cruzi epimastigote normalized cDNA Library
2. T.cruzi epimastigote non-normalized cDNA Library
3. T.cruzi epimastigote normalized cDNA Library
4. Trypanosoma cruzi Y (Tomoo Tanaka)
Library numbers are appended to the dbEST_ID with _# +/- indicates the orientation of each clone.

******************* Contig 941 ******************** . : . : . : . : . : . : 1797215_1- GACAAGCCGGTGCAGCGCACGGTACTGATGATGGGTCGTTACCAGGAGGCAGTGGAGGAC 60 ____________________________________________________________ consensus GACAAGCCGGTGCAGCGCACGGTACTGATGATGGGTCGTTACCAGGAGGCAGTGGAGGAC 60 . : . : . : . : . : . : 1797215_1- CATCCGTGCGGCAACGTTGTTGGTCTGGTGGGTGTTGACAAGTACATTGTGAAATCCGCC 120 ____________________________________________________________ consensus CATCCGTGCGGCAACGTTGTTGGTCTGGTGGGTGTTGACAAGTACATTGTGAAATCCGCC 120 . : . : . : . : . : . : 1797215_1- ACCATCACGGACGACGGCGAGAGCCCCCACCCGCTGCGAGACATGAAGTACTCGGTGTCG 180 ____________________________________________________________ consensus ACCATCACGGACGACGGCGAGAGCCCCCACCCGCTGCGAGACATGAAGTACTCGGTGTCG 180 . : . : . : . : . : . : 1797215_1- CCCGTTGTGCGTGTTGCGGTGGAGGCGAAAAACCCCTCCGACCTGCCGAAGCTTGTCGAG 240 ____________________________________________________________ consensus CCCGTTGTGCGTGTTGCGGTGGAGGCGAAAAACCCCTCCGACCTGCCGAAGCTTGTCGAG 240 . : . : . : . : . : . : 1797215_1- GGTCTGAAGCGCCTCTCGAAGTCTGATCCCCTTGTCGTGTGCACGATTGAGGAGAGTGGC 300 ____________________________________________________________ consensus GGTCTGAAGCGCCTCTCGAAGTCTGATCCCCTTGTCGTGTGCACGATTGAGGAGAGTGGC 300 . : . : . : . : . : . : 1797215_1- GAACACATTGTTGCCGGCGCTGGCGAACTTCACCTGGAGATCTGCCTCAAGGACCTACAG 360 ____________________________________________________________ consensus GAACACATTGTTGCCGGCGCTGGCGAACTTCACCTGGAGATCTGCCTCAAGGACCTACAG 360 . : . : . : . : . : . : 1797215_1- GAAGACTTTAT--GAACG----GCGCACCACTGAAGGTGTCGGAGCCTGTTGTGTCTTTC 414 1694411_1+ TAATCNGCACGAGGGGCGCACCNCTGAAGGTGTCGGAGCCTGTTGTGTCTTTC 53 ____________________________________________________________ consensus GAAGACTTAATCNGAACGAGGGGCGCACCACTGAAGGTGTCGGAGCCTGTTGTGTCTTTC 420 . : . : . : . : . : . : 1797215_1- CGTGAAACGGTGACGGATGTGTCGTCGATCCAGT 474 1694411_1+ CGTGAAACGGTGACGGATGTGTCGNCNATCCAGTGTCTTTCCAAGTCCGCGAACAAGCAT 113 ____________________________________________________________ consensus CGTGAAACGGTGACGGATGTGTCGTCGATCCAGTGTCTTTCCAAGTCCGCGAACAAGCAT 480 . : . : . : . : . : . : 1694411_1+ AACCGTTTGTTCTGCCGCGGTGCTCCGCTAACGGAGGAGTTGTGCGTCNANATGGAGGAA 173 ____________________________________________________________ consensus AACCGTTTGTTCTGCCGCGGTGCTCCGCTAACGGAGGAGTTGTGCGTCNANATGGAGGAA 540 . : . : . : . : . : . : 1694411_1+ GGCCTGAACGCCGGCTCGGAGGCCGACCCNAAGGTGCGTGCCCGCTTCCTTGCGGACAAN 233 ____________________________________________________________ consensus GGCCTGAACGCCGGCTCGGAGGCCGACCCNAAGGTGCGTGCCCGCTTCCTTGCGGACAAN 600 . : . : . : . : . : . : 1694411_1+ TTTGACTGGGACGTTGCAAAAGCGCGCAANATCTG 268 ____________________________________________________________ consensus TTTGACTGGGACGTTGCAAAAGCGCGCAANATCTG 635

Date: 14:54:4 on Sun 17 Dec 117.