blastn_dbest_files/1206389_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  1206389
        (584 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|1206389 AA556016 TENF0109 5' Lib=854[Trypanoso...  2892  1.1e-124  1
A cbil|dbest|1176804 AA532208 TENF0153 5' Lib=854[Trypanoso...   373  7.1e-11   1
A cbil|dbest|649890 C06876 C06876  Lib=480[Rattus...   371  9.3e-11   1
A cbil|dbest|1636179 AA908148 TENS0990 5' Lib=1138[Trypanos...   362  2.3e-10   1
A cbil|dbest|1475768 AA754094 97GS0814  Lib=1073[O...   293  3.5e-07   1
A cbil|dbest|542304 W34469 ma98e09.r1 5' Lib=431[Mus_muscu...   313  4.9e-06   1
A cbil|dbest|329389 D53161 HUM100F07B 5' Lib=318[Homo_sapi...   270  6.3e-06   1
A cbil|dbest|1182161 C24612 C24612  Lib=945[Dictyo...   267  1.0e-05   1
A cbil|dbest|1235915 AA585430 TH747 5'/3' Lib=184[Homo_sapi...   298  1.1e-05   1
A cbil|dbest|1728779 AA991144 BSBmMFSZ06N12SK 5' Lib=283[Br...   302  2.1e-05   1
A cbil|dbest|1155941 AA511301 vj22b05.r1 5' Lib=855[Mus_mus...   290  3.2e-05   1
A cbil|dbest|696969 C14391 C14391 5' Lib=313[Homo_sapiens|...   251  6.9e-05   1
A cbil|dbest|1474886 AA752907 97AS0632  Lib=1073[O...   288  7.2e-05   1
A cbil|dbest|1658049 AA926432 TENS1054 5' Lib=1138[Trypanos...   241  9.2e-05   2
A cbil|dbest|520899 W13928 mb36h06.r1 5' Lib=431[Mus_muscu...   289  0.00014   1
A cbil|dbest|334738 D59751 HUM063B08B 5' Lib=318[Homo_sapi...   242  0.00019   1
A cbil|dbest|696900 C14322 C14322 5' Lib=313[Homo_sapiens|...   267  0.00024   1
A cbil|dbest|1643390 AA915331 vz28f01.r1 5' Lib=544[Mus_mus...   284  0.00031   1
A cbil|dbest|1647612 C89908 C89908  Lib=945[Dictyo...   232  0.00065   1
A cbil|dbest|1673442 C90773 C90773  Lib=1272[Dicty...   231  0.00074   1
A cbil|dbest|1746106 C93975 C93975  Lib=945[Dictyo...   230  0.00079   1
A cbil|dbest|1636119 AA908088 TENS0928 5' Lib=1138[Trypanos...   265  0.00079   1
A cbil|dbest|331125 D54897 HUM157D02B 5' Lib=318[Homo_sapi...   249  0.00086   1
A cbil|dbest|520703 W13737 ma94b01.r1 5' Lib=431[Mus_muscu...   273  0.0012    1
A cbil|dbest|1827979 AI073242 UI-R-Y0-lx-h-08-0-UI.s1 3' Li...   231  0.0014    1
A cbil|dbest|1473451 AA751777 96AS0610  Lib=1073[O...   253  0.0016    1
A cbil|dbest|862350 AA223020 mv72f09.r1 5' Lib=593[Mus_mus...   261  0.0027    1
A cbil|dbest|698870 C16292 C16292 5' Lib=313[Homo_sapiens|...   240  0.0029    1
A cbil|dbest|1739187 C93857 C93857  Lib=1272[Dicty...   223  0.0036    1
A cbil|dbest|1066408 C23827 C23827  Lib=865[Dictyo...   217  0.0040    1
A cbil|dbest|698868 C16290 C16290 5' Lib=313[Homo_sapiens|...   237  0.0075    1
A cbil|dbest|1745040 AI006372 ua71c05.r1 5' Lib=544[Mus_mus...   212  0.0076    1
A cbil|dbest|908915 AA267943 va03f07.r1 5' Lib=567[Mus_mus...   210  0.0091    1
A cbil|dbest|1739100 C93770 C93770  Lib=1272[Dicty...   214  0.0092    1
A cbil|dbest|697698 C15120 C15120 5' Lib=313[Homo_sapiens|...   236  0.012     1
A cbil|dbest|1687788 C92660 C92660  Lib=945[Dictyo...   207  0.013     1
A cbil|dbest|1647972 C90268 C90268  Lib=945[Dictyo...   210  0.013     1
A cbil|dbest|1235601 AA585116 ATH354 5'/3' Lib=184[Homo_sap...   208  0.020     1
A cbil|dbest|1688369 C93241 C93241  Lib=945[Dictyo...   202  0.021     1
A cbil|dbest|1694399 AA958268 TENS1551 5' Lib=1138[Trypanos...   202  0.025     1
A cbil|dbest|1870790 AI112271 UI-R-Y0-mo-c-08-0-UI.s2 3' Li...   202  0.025     1
A cbil|dbest|1174595 AA529955 vj12g07.r1 5' Lib=918[Mus_mus...   239  0.026     1
A cbil|dbest|1618926 AA890895 TENS0745 5' Lib=1138[Trypanos...   201  0.027     1
A cbil|dbest|804695 AA166384 mt73a06.r1 5' Lib=567[Mus_mus...   198  0.032     1
A cbil|dbest|1648179 C90475 C90475  Lib=945[Dictyo...   199  0.033     1
A cbil|dbest|1618957 AA890926 TENS0776 5' Lib=1138[Trypanos...   200  0.033     1
A cbil|dbest|834862 AA197341 zp92a10.s1 3' Lib=527[Homo_sa...   201  0.036     1
A cbil|dbest|1745979 AI007410 TENU0430 3' Lib=854[Trypanoso...   197  0.036     1
A cbil|dbest|1687399 C92271 C92271  Lib=945[Dictyo...   196  0.041     1
A cbil|dbest|1688500 C93372 C93372  Lib=945[Dictyo...   199  0.043     1
A cbil|dbest|1557932 AA835801 of53f07.s1  Lib=1080...   214  0.043     1
A cbil|dbest|198209 R28164 yh65c12.r1 5' Lib=271[Homo_sapi...   195  0.044     1
A cbil|dbest|1579755 AA854100 aj63f07.s1 3' Lib=417[Homo_sa...   194  0.050     1
A cbil|dbest|1689020 AA952694 TENS1878 5' Lib=1138[Trypanos...   195  0.051     1
A cbil|dbest|1739122 C93792 C93792  Lib=1272[Dicty...   194  0.066     1
A cbil|dbest|908398 AA267430 mz99a05.r1 5' Lib=567[Mus_mus...   192  0.066     1
A cbil|dbest|1640231 AA912172 ol21b07.s1 3' Lib=1042[Homo_s...   192  0.070     1
A cbil|dbest|1133877 AA489207 aa57c07.s1 3' Lib=595[Homo_sa...   191  0.072     1
A cbil|dbest|1688002 C92874 C92874  Lib=945[Dictyo...   191  0.072     1
A cbil|dbest|1463360 AA746478 nw62e03.s1 3' Lib=595[Homo_sa...   192  0.075     1
A cbil|dbest|1182454 C25639 C25639  Lib=945[Dictyo...   192  0.093     1
A cbil|dbest|543848 W35976 mc61d03.r1 5' Lib=437[Mus_muscu...   190  0.094     1
A cbil|dbest|1673624 C90955 C90955  Lib=1272[Dicty...   195  0.097     1
A cbil|dbest|14638 Z17511 ATTS0085 3' Lib=23[Arabidopsis_...   188  0.099     1
A cbil|dbest|1765771 AI026563 TENU0775 3' Lib=1138[Trypanos...   188  0.11      1
A cbil|dbest|1742033 C94900 C94900  Lib=1316[Sus_s...   187  0.12      1
A cbil|dbest|1739080 C93750 C93750  Lib=1272[Dicty...   189  0.13      1
A cbil|dbest|1138339 AA493655 nh05d04.s1  Lib=889[...   185  0.14      1
A cbil|dbest|28930 T09834 0412m7  Lib=9[Plasmodi...   188  0.14      1
A cbil|dbest|1871273 AI112754 UI-R-Y0-mj-e-03-0-UI.s1 3' Li...   185  0.15      1
A cbil|dbest|1207928 AA557547 nl02h02.s1 3' Lib=882[Homo_sa...   185  0.15      1
A cbil|dbest|1688907 AA952581 TENS1765 5' Lib=1138[Trypanos...   184  0.16      1
A cbil|dbest|675256 W82718 mf07g01.r1 5' Lib=431[Mus_muscu...   183  0.17      1
A cbil|dbest|1428713 AA721377 nz69h10.s1 3' Lib=595[Homo_sa...   185  0.17      1
A cbil|dbest|1687833 C92705 C92705  Lib=945[Dictyo...   184  0.17      1
A cbil|dbest|1537101 AA815283 ai59a08.s1 3' Lib=628[Homo_sa...   183  0.17      1
A cbil|dbest|14446 Z18047 ATTS0531 3' Lib=23[Arabidopsis_...   183  0.17      1
A cbil|dbest|1687276 C92148 C92148  Lib=945[Dictyo...   186  0.18      1
A cbil|dbest|1156494 AA511854 vg17b03.r1 5' Lib=855[Mus_mus...   185  0.20      1
A cbil|dbest|646776 AA033096 mi24f08.r1 5' Lib=437[Mus_mus...   186  0.20      1
A cbil|dbest|1618899 AA890868 TENS0718 5' Lib=1138[Trypanos...   182  0.20      1
A cbil|dbest|1490465 AA768720 oc86f11.s1 3' Lib=595[Homo_sa...   186  0.20      1
A cbil|dbest|1616218 C84089 C84089  Lib=945[Dictyo...   181  0.21      1
A cbil|dbest|1609665 AA882703 TENS0277 5' Lib=1138[Trypanos...   182  0.22      1
A cbil|dbest|1673613 C90944 C90944  Lib=1272[Dicty...   181  0.22      1
A cbil|dbest|1616290 C84161 C84161  Lib=945[Dictyo...   183  0.23      1
A cbil|dbest|1647527 C89823 C89823  Lib=945[Dictyo...   183  0.23      1
A cbil|dbest|1853506 AI095119 qa19b05.x1 3' Lib=1318[Homo_s...   179  0.25      1
A cbil|dbest|504671 N97821 1347C3  Lib=114[Plasmo...   180  0.26      1
A cbil|dbest|1739083 C93753 C93753  Lib=1272[Dicty...   187  0.26      1
A cbil|dbest|1474042 AA753420 96BS0407  Lib=1073[O...   222  0.27      1
A cbil|dbest|1739042 C93712 C93712  Lib=1272[Dicty...   180  0.27      1
A cbil|dbest|1358266 AA654462 nt62e07.s1  Lib=575[...   179  0.27      1
A cbil|dbest|206733 R36672 yh89h01.s1 3' Lib=271[Homo_sapi...   184  0.27      1
A cbil|dbest|1658111 AA926494 TENS1116 5' Lib=1138[Trypanos...   182  0.28      1
A cbil|dbest|429178 N28048 EST000285 5'-end Lib=317[Schist...   181  0.29      1
A cbil|dbest|209122 R39060 yd08f11.s1 3' Lib=263[Homo_sapi...   179  0.29      1
A cbil|dbest|1694418 AA958037 TENS1570 5' Lib=1138[Trypanos...   178  0.30      1
A cbil|dbest|1782999 AI043711 UI-R-C0-jl-h-06-0-UI.s1 3' Li...   214  0.31      1
A cbil|dbest|1746167 C94036 C94036  Lib=945[Dictyo...   178  0.31      1
A cbil|dbest|1482458 AA760782 nz14c04.s1 3' Lib=595[Homo_sa...   202  0.32      1
A cbil|dbest|1782661 AI043326 TENU0967 3' Lib=1138[Trypanos...   180  0.33      1
A cbil|dbest|64905 T25610 EST00479 3' Lib=189[Mus_musculu...   182  0.34      1
A cbil|dbest|1797361 AI057910 TENU2002 5' Lib=1138[Trypanos...   176  0.34      1
A cbil|dbest|1654756 AA922966 ok77c11.s1 3' Lib=1050[Homo_s...   176  0.34      1
A cbil|dbest|1528013 AA806720 ob87e04.s1 3' Lib=595[Homo_sa...   176  0.35      1
A cbil|dbest|1855695 AI097248 qb60b08.x1 3' Lib=1318[Homo_s...   178  0.35      1
A cbil|dbest|1336779 AA633143 nq39f07.s1 3' Lib=956[Homo_sa...   176  0.37      1
A cbil|dbest|1687388 C92260 C92260  Lib=945[Dictyo...   176  0.38      1
A cbil|dbest|1673657 C90988 C90988  Lib=1272[Dicty...   176  0.39      1
A cbil|dbest|89907 Z47672 ATTS4528 3' Lib=28[Arabidopsis_...   174  0.41      1
A cbil|dbest|895466 AA254562 va13c06.r1 5' Lib=567[Mus_mus...   174  0.42      1
A cbil|dbest|548716 W41551 mc50d09.r1 5' Lib=431[Mus_muscu...   221  0.42      1
A cbil|dbest|325360 D51446 HUM038F09B 5' Lib=318[Homo_sapi...   209  0.43      1
A cbil|dbest|872824 AA233289 zr30e12.s1 3' Lib=536[Homo_sa...   175  0.44      1
A cbil|dbest|1647770 C90066 C90066  Lib=945[Dictyo...   179  0.45      1
A cbil|dbest|1580160 AA854505 aj75d11.s1 3' Lib=417[Homo_sa...   173  0.45      1
A cbil|dbest|196948 R26903 yh46c05.s1 3' Lib=271[Homo_sapi...   173  0.45      1
A cbil|dbest|1648853 C91403 C91403  Lib=945[Dictyo...   214  0.46      1
A cbil|dbest|1173248 AA528608 nf02d03.s1  Lib=890[...   176  0.48      1
A cbil|dbest|698872 C16294 C16294 5' Lib=313[Homo_sapiens|...   206  0.48      1
A cbil|dbest|1694501 AA958120 TENS1653 5' Lib=1138[Trypanos...   173  0.49      1
A cbil|dbest|229090 R44211 yg34f06.s1 3' Lib=263[Homo_sapi...   173  0.49      1
A cbil|dbest|613038 AA003705 mg61a02.r1 5' Lib=437[Mus_mus...   187  0.49      1
A cbil|dbest|1746582 C94451 C94451  Lib=945[Dictyo...   176  0.50      1
A cbil|dbest|1235895 AA585410 PTH334 5'/3' Lib=184[Homo_sap...   176  0.50      1
A cbil|dbest|1746464 C94333 C94333  Lib=945[Dictyo...   173  0.51      1
A cbil|dbest|790600 AA150698 zl46c02.s1 3' Lib=474[Homo_sa...   199  0.51      1
A cbil|dbest|231113 R44721 yg30b04.s1 3' Lib=263[Homo_sapi...   173  0.52      1
A cbil|dbest|1182410 C25595 C25595  Lib=945[Dictyo...   171  0.52      1
A cbil|dbest|1640112 AA912053 og22h06.s1 3' Lib=1081[Homo_s...   171  0.52      1
A cbil|dbest|1113978 C23866 C23866  Lib=635[Dictyo...   211  0.53      1
A cbil|dbest|1114005 C24342 C24342  Lib=635[Dictyo...   211  0.54      1
A cbil|dbest|1233241 AA581902 nn32a09.s1 3' Lib=989[Homo_sa...   206  0.54      1
A cbil|dbest|1547938 AA825590 od57g02.s1 3' Lib=595[Homo_sa...   176  0.55      1
A cbil|dbest|1863898 AI105474 SWAMCAC22C08SK 5' Lib=281[Bru...   172  0.56      1
A cbil|dbest|936149 C23619 C23619  Lib=193[Oryza_...   171  0.57      1
A cbil|dbest|1387012 AA680947 LmFrAm0555 5' Lib=1040[Leishm...   180  0.58      1
A cbil|dbest|585096 W77124 me61d08.r1 5' Lib=437[Mus_muscu...   207  0.58      1
A cbil|dbest|869499 AA230158 nc38d09.s1  Lib=574[...   170  0.58      1
A cbil|dbest|1636184 AA908153 TENS0995 5' Lib=1138[Trypanos...   211  0.58      1
A cbil|dbest|1205249 AA554881 nl15e08.s1 3' Lib=895[Homo_sa...   171  0.58      1
A cbil|dbest|1066334 C23753 C23753  Lib=635[Dictyo...   211  0.59      1
A cbil|dbest|547698 W39844 340  Lib=436[Mus_muscu...   176  0.59      1
A cbil|dbest|1609632 AA882670 TENS0243 5' Lib=1138[Trypanos...   170  0.59      1
A cbil|dbest|1605684 AA878843 of84a03.s1 3' Lib=1077[Homo_s...   170  0.59      1
A cbil|dbest|1371509 AA665990 ag69h09.s1 3' Lib=898[Homo_sa...   176  0.61      1
A cbil|dbest|1378463 AA672863 vu05c11.r1 5' Lib=868[Mus_mus...   209  0.61      1
A cbil|dbest|771916 AA132051 zo05g05.s1 3' Lib=523[Homo_sa...   196  0.63      1
A cbil|dbest|504888 N98038 2099C3  Lib=114[Plasmo...   176  0.63      1
A cbil|dbest|344533 R95337 SWOvL3CA121SK 5' Lib=284[Onchoc...   170  0.63      1
A cbil|dbest|344528 R95332 SWOvL3CA115SK 5' Lib=284[Onchoc...   170  0.64      1
A cbil|dbest|31585 Z25686 ATTS1151  Lib=29[Arabi...   169  0.64      1
A cbil|dbest|1312378 AA614677 np48d07.s1 3' Lib=894[Homo_sa...   173  0.67      1
A cbil|dbest|1688456 C93328 C93328  Lib=945[Dictyo...   170  0.67      1
A cbil|dbest|1585284 AA858609 UI-R-E0-bq-a-10-0-UI.s1 3' Li...   206  0.67      1
A cbil|dbest|1688382 C93254 C93254  Lib=945[Dictyo...   170  0.68      1
A cbil|dbest|1689023 AA952697 TENS1881 5' Lib=1138[Trypanos...   168  0.68      1
A cbil|dbest|574702 W67100 me25b07.r1 5' Lib=437[Mus_muscu...   214  0.69      1
A cbil|dbest|1552606 AA830471 oc67g05.s1 3' Lib=595[Homo_sa...   205  0.70      1
A cbil|dbest|1517622 AA795947 vu05h12.r1 5' Lib=868[Mus_mus...   205  0.71      1
A cbil|dbest|1320129 AA622385 no45b10.s1 3' Lib=994[Homo_sa...   169  0.71      1
A cbil|dbest|496158 N89819 zb34e07.s1 3' Lib=417[Homo_sapi...   167  0.71      1
A cbil|dbest|1660491 AF030586 AF030586  Lib=1225[G...   166  0.73      1
A cbil|dbest|696786 C14208 C14208 5' Lib=313[Homo_sapiens|...   205  0.73      1
A cbil|dbest|206217 R36156 yh92h02.s1 3' Lib=271[Homo_sapi...   166  0.74      1
A cbil|dbest|1131271 AA488429 ab39e09.s1 3' Lib=527[Homo_sa...   168  0.74      1
A cbil|dbest|504953 N98087 2164C3  Lib=114[Plasmo...   167  0.74      1
A cbil|dbest|1571519 AA846369 ai84h02.s1 3' Lib=417[Homo_sa...   166  0.75      1
A cbil|dbest|1232006 AA581573 nd87e07.s1 3' Lib=996[Homo_sa...   200  0.75      1
A cbil|dbest|1616326 C84197 C84197  Lib=945[Dictyo...   167  0.76      1
A cbil|dbest|1673634 C90965 C90965  Lib=1272[Dicty...   174  0.77      1
A cbil|dbest|294670 H34046 EST110573 5'-end Lib=304[Rattus...   189  0.77      1
A cbil|dbest|1631205 AA903174 ok53f12.s1 3' Lib=1187[Homo_s...   165  0.80      1
A cbil|dbest|1828888 AI073952 ou65c12.x1 3' Lib=1049[Homo_s...   168  0.80      1
A cbil|dbest|249233 R72375 yj89b10.r1 5' Lib=278[Homo_sapi...   165  0.80      1
A cbil|dbest|260885 H01005 yj28g07.s1 3' Lib=271[Homo_sapi...   178  0.80      1
A cbil|dbest|1688202 C93074 C93074  Lib=945[Dictyo...   166  0.80      1
A cbil|dbest|1298586 AA603930 np27f07.s1 3' Lib=910[Homo_sa...   208  0.80      1
A cbil|dbest|1547088 C84798 C84798  Lib=945[Dictyo...   166  0.81      1
A cbil|dbest|1376101 AA670515 SWOv3MCAM02G03SK 5' Lib=651[O...   205  0.81      1
A cbil|dbest|242314 R65559 14063  Lib=71[Arabidop...   165  0.82      1
A cbil|dbest|1804901 AI065446 af83b07.s1 3' Lib=1368[Zea_ma...   166  0.82      1
A cbil|dbest|1490241 AA768496 oa65g03.s1 3' Lib=595[Homo_sa...   166  0.82      1
A cbil|dbest|392582 H90171 yu85a01.r1 5' Lib=262[Homo_sapi...   165  0.82      1
A cbil|dbest|335506 D60519 HUM114E03B 5' Lib=318[Homo_sapi...   165  0.83      1
A cbil|dbest|419540 N22203 yw37e09.s1 3' Lib=371[Homo_sapi...   164  0.83      1
A cbil|dbest|1647608 C89904 C89904  Lib=945[Dictyo...   167  0.84      1
A cbil|dbest|1755264 AI016107 ot87d03.s1 3' Lib=843[Homo_sa...   182  0.84      1
A cbil|dbest|1628245 AA900214 UI-R-E0-dd-f-01-0-UI.s1 3' Li...   177  0.84      1
A cbil|dbest|89899 Z47666 ATTS4522 3' Lib=28[Arabidopsis_...   203  0.84      1
A cbil|dbest|1798804 AI059353 UI-R-C1-ld-a-07-0-UI.s1 3' Li...   168  0.85      1
A cbil|dbest|1746539 C94408 C94408  Lib=945[Dictyo...   164  0.85      1
A cbil|dbest|697876 C15298 C15298 5' Lib=313[Homo_sapiens|...   163  0.85      1
A cbil|dbest|1648477 C91027 C91027  Lib=945[Dictyo...   204  0.86      1
A cbil|dbest|29583 Z24471 ATTS913 5' Lib=81[Arabidopsis_t...   172  0.86      1
A cbil|dbest|265182 H05302 yl80e02.s1 3' Lib=263[Homo_sapi...   167  0.86      1
A cbil|dbest|70577 D38901 RICC2334B  Lib=75[Oryz...   163  0.87      1
A cbil|dbest|1168976 AA524269 ng34d01.s1 3' Lib=882[Homo_sa...   163  0.87      1
A cbil|dbest|868547 AA229548 nc13g11.r1  Lib=573[...   164  0.87      1
A cbil|dbest|1553498 AA831363 oc74d01.s1 3' Lib=595[Homo_sa...   197  0.87      1
A cbil|dbest|1673430 C90761 C90761  Lib=1272[Dicty...   164  0.87      1
A cbil|dbest|1153446 AA508768 ni23d11.s1 3' Lib=896[Homo_sa...   164  0.88      1
A cbil|dbest|1153459 AA508781 ni23f11.s1 3' Lib=896[Homo_sa...   164  0.88      1
A cbil|dbest|1141879 AA497249 fa03h08.s1 3' Lib=899[Danio_r...   165  0.88      1
A cbil|dbest|232435 R43199 yg18g03.s1 3' Lib=263[Homo_sapi...   198  0.89      1
A cbil|dbest|1140078 AA495401 fa01c05.s1 3' Lib=899[Danio_r...   165  0.89      1
A cbil|dbest|1692436 AA956110 UI-R-E1-fi-e-09-0-UI.s1 3' Li...   163  0.89      1
A cbil|dbest|1487632 AA765957 oa14h06.s1 3' Lib=595[Homo_sa...   164  0.89      1
A cbil|dbest|1316597 AA618853 SWOv3MCA1823SK 5' Lib=651[Onc...   205  0.90      1
A cbil|dbest|1147690 AA503060 ne44a08.s1 3' Lib=882[Homo_sa...   183  0.90      1
A cbil|dbest|1224564 AA574164 nl78a10.s1 3' Lib=895[Homo_sa...   165  0.90      1
A cbil|dbest|1536225 AA814407 nz12c07.s1 3' Lib=595[Homo_sa...   197  0.90      1
A cbil|dbest|1805640 AI066132 TENU2523 5' Lib=1138[Trypanos...   199  0.90      1
A cbil|dbest|1688001 C92873 C92873  Lib=945[Dictyo...   166  0.90      1
A cbil|dbest|1636182 AA908151 TENS0993 5' Lib=1138[Trypanos...   202  0.91      1
A cbil|dbest|680768 AA054992 zf18d08.s1 3' Lib=424[Homo_sa...   163  0.91      1
A cbil|dbest|477519 N71425 za38d07.s1 3' Lib=262[Homo_sapi...   164  0.92      1
A cbil|dbest|1446177 T43551 6814  Lib=71[Arabidops...   161  0.92      1
A cbil|dbest|1502471 AA780796 ag14d05.s1 3' Lib=898[Homo_sa...   167  0.92      1
A cbil|dbest|52598 Z34995 ATTS3634 3' Lib=28[Arabidopsis_...   180  0.92      1
A cbil|dbest|1387011 AA680946 LmFrAm0554 5' Lib=1040[Leishm...   170  0.92      1
A cbil|dbest|338790 R93657 yq34c05.r1 5' Lib=262[Homo_sapi...   162  0.92      1
A cbil|dbest|1584974 AA859288 UI-R-E0-cj-a-01-0-UI.s1 3' Li...   162  0.92      1
A cbil|dbest|1408182 AA701597 zi34h06.s1 3' Lib=452[Homo_sa...   197  0.93      1
A cbil|dbest|1547150 C84860 C84860  Lib=945[Dictyo...   161  0.93      1
A cbil|dbest|1190348 AA545706 vj64c05.r1 5' Lib=850[Mus_mus...   161  0.93      1
A cbil|dbest|1600935 AA867963 TENS0071 5' Lib=1138[Trypanos...   160  0.93      1
A cbil|dbest|1692089 AA955763 UI-R-E1-fg-g-08-0-UI.s1 3' Li...   161  0.93      1
A cbil|dbest|1410005 AA703292 L0-47M13R 5' Lib=1039[Mesembr...   162  0.93      1
A cbil|dbest|1600956 AF051129 AF051129  Lib=1141[R...   193  0.94      1
A cbil|dbest|1200664 AA550654 1891m3  Lib=9[Plasmo...   196  0.94      1
A cbil|dbest|1473757 AA752083 96BS0009  Lib=1073[O...   203  0.94      1
A cbil|dbest|1739489 AI001583 EST0165  Lib=1314[Ti...   161  0.94      1
A cbil|dbest|1583502 AA857847 of76g02.s1 3' Lib=1079[Homo_s...   166  0.94      1
A cbil|dbest|1689151 AA952814 SMTBCEA000197SK 5' Lib=1128[S...   160  0.94      1
A cbil|dbest|1749669 AI010512 EST204963 3'-end Lib=1089[Rat...   163  0.94      1
A cbil|dbest|229229 R45357 yg46g11.s1 3' Lib=263[Homo_sapi...   161  0.95      1
A cbil|dbest|196499 R26454 yh50d11.s1 3' Lib=271[Homo_sapi...   161  0.95      1
A cbil|dbest|203545 R33485 yh83c08.s1 3' Lib=271[Homo_sapi...   160  0.95      1
A cbil|dbest|1490266 AA768521 oa66h07.s1 3' Lib=595[Homo_sa...   162  0.95      1
A cbil|dbest|504376 N98194 0261C3  Lib=114[Plasmo...   163  0.95      1
A cbil|dbest|1064656 AA420594 nc61c05.r1  Lib=573[...   161  0.95      1
A cbil|dbest|1472282 AA750608 ISGS0187  Lib=1073[O...   160  0.95      1
A cbil|dbest|662039 AA047306 zl65b12.s1 3' Lib=486[Homo_sa...   159  0.95      1
A cbil|dbest|1639798 AA911767 og19c07.s1 3' Lib=1081[Homo_s...   162  0.95      1
A cbil|dbest|1487993 AA766318 oa31a01.s1 3' Lib=595[Homo_sa...   159  0.95      1
A cbil|dbest|696880 C14302 C14302 5' Lib=313[Homo_sapiens|...   161  0.96      1
A cbil|dbest|991563 AA350100 EST57421 3'-end Lib=688[Homo_...   161  0.96      1
A cbil|dbest|1474182 AA753560 96BS0899  Lib=1073[O...   202  0.96      1


WARNING:  Descriptions of 155 database sequences were not reported due to the
          limiting value of parameter V = 250.



>cbil|dbest|1206389 AA556016 TENF0109 5'
            Lib=854[Trypanosoma_cruzi|||epimastigote||] Length=584 Author_cmt:
            T. cruzi 5.8S ribosomal internal transcribed spacer
            Length = 584

  Plus Strand HSPs:

 Score = 2892 (433.9 bits), Expect = 1.1e-124, P = 1.1e-124
 Identities = 580/584 (99%), Positives = 580/584 (99%), Strand = Plus / Plus

Query:     1 GGCACGAGGTTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAA 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 GGCACGAGGTTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAA 60

Query:    61 ACACACACAGGCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAAC 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 ACACACACAGGCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAAC 120

Query:   121 AACAACAACAACGTGGTTGCATAAAAGTTAGCGTTGCTCTCGATTTTCATACGTCCAGAA 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 AACAACAACAACGTGGTTGCATAAAAGTTAGCGTTGCTCTCGATTTTCATACGTCCAGAA 180

Query:   181 GGAAAGACAATCAACAAGAAGAGCAACAAAGAGACCCGCCTGTGGGGCATTTATGAATTC 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 GGAAAGACAATCAACAAGAAGAGCAACAAAGAGACCCGCCTGTGGGGCATTTATGAATTC 240

Query:   241 TTCACGAGATATGCAAAGCGGCTCTGCCGTGGAGATGAGATCAAATGCCTCCTGCACGAC 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 TTCACGAGATATGCAAAGCGGCTCTGCCGTGGAGATGAGATCAAATGCCTCCTGCACGAC 300

Query:   301 TGTTTCCCGTGAGGGCACCTCAATTCCCGCTGCCACCAGTTTCGTGTGTGTTTCTCTTAA 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 TGTTTCCCGTGAGGGCACCTCAATTCCCGCTGCCACCAGTTTCGTGTGTGTTTCTCTTAA 360

Query:   361 AGAATTATTCACATGCACGGGTTTCAAGTTACCACNCCCCNCCATGTTCTAGGATATTCC 420
             ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||
Sbjct:   361 AGAATTATTCACATGCACGGGTTTCAAGTTACCACNCCCCNCCATGTTCTAGGATATTCC 420

Query:   421 CAAAAAAAAAGCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGG 480
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct:   421 CAAAAAAAAAGCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGG 480

Query:   481 CCGCCCTTTTACACTTCCTGAACTGGAAACCCTGGGTTTNCCCACTTATCCCCTGGACAA 540
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct:   481 CCGCCCTTTTACACTTCCTGAACTGGAAACCCTGGGTTTNCCCACTTATCCCCTGGACAA 540

Query:   541 TCCCCCTTCCCCACTGGGTTTTTACAAAAGGCCCCCGATTCCCT 584
             ||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   541 TCCCCCTTCCCCACTGGGTTTTTACAAAAGGCCCCCGATTCCCT 584


>cbil|dbest|1176804 AA532208 TENF0153 5'
            Lib=854[Trypanosoma_cruzi|||epimastigote||] Length=541
            Length = 541

  Plus Strand HSPs:

 Score = 373 (56.0 bits), Expect = 7.1e-11, P = 7.1e-11
 Identities = 117/151 (77%), Positives = 117/151 (77%), Strand = Plus / Plus

Query:   428 AAAGCG-CCGCA-GCTTATCCCCNTTAATGAGGGTTTAATTTTA-CTTGGCCCTGGCCGC 484
             AA GCG CCGCA GCTTAT CCC TTA TGA GGTTTAATTTTA CTTGGC CTGGCC C
Sbjct:   385 AATGCGGCCGCAAGCTTATTCCCTTTAGTGANGGTTTAATTTTAGCTTGGCACTGGCCTC 444

Query:   485 CCTTTTACA-CTTCCTGAACTGG--AAA-CCCTGGGTTTNCCCA-CTTA-TCCCCT-GGA 537
             C TTTTACA C TC TGA CTGG  AAA CCCTGG  TT CCCA CTTA TCCCCT G A
Sbjct:   445 CGTTTTACAACNTCGTGA-CTGGGAAAAACCCTGGCGTTACCCAACTTAATCCCCTTGNA 503

Query:   538 -CAATCCCCCTTCCCCACTGGGTTTTTACAAAA 569
              CA   CCCCTT CCC    GGTT T ACAAAA
Sbjct:   504 ACACATCCCCTTTCCCCGCTGGTTAT-ACAAAA 535


>cbil|dbest|649890 C06876 C06876 
            Lib=480[Rattus_norvegicus||pancreatic_islet|||] Length=514
            Length = 514

  Plus Strand HSPs:

 Score = 371 (55.7 bits), Expect = 9.3e-11, P = 9.3e-11
 Identities = 133/182 (73%), Positives = 133/182 (73%), Strand = Plus / Plus

Query:   407 TTCTAGGATATTCCCAAAAAAAAAGCG-CC-GC-AGCTTATCCCCNTTAATGAGGGTTTA 463
             TTCT GG TA  C  AAAAAAAA G G CC G  A C  AT CCC  TA T A  G  T 
Sbjct:   316 TTCTGGG-TAA-CTGAAAAAAAAGGGGGCCCGGTACCCAATTCCCCCTA-T-ANTGAGTC 371

Query:   464 ATTTTACTTGGCCCTGGCCGCCCTTTTACA-CTTCCTGAACTGG-AAA-CCCTGGGTTTN 520
              T TTAC    C CTGGCCG C TTTTACA C TCCTGA CTGG AAA CCCTG GTT  
Sbjct:   372 GTATTACAATCCACTGGCCGTCNTTTTACAACCTCCTGA-CTGGGAAAACCCTGCGTTNC 430

Query:   521 CCCACTTATCCCCTGG-AC-AATCCCCCTT-CCCCACTGGGTTTTT-ACAAAAGGCCCCC 576
             CCCACTTATCCCCT G AC AATCCCCCTT CCCCACTGG TT T  A AAAAG CCC C
Sbjct:   431 CCCACTTATCCCCTTGCACNAATCCCCCTTTCCCCACTGGCTTATACAAAAAAGCCCCNC 490

Query:   577 GATTCCC 583
              ATTCCC
Sbjct:   491 CATTCCC 497


>cbil|dbest|1636179 AA908148 TENS0990 5'
            Lib=1138[Trypanosoma_cruzi|||epimastigote||] Length=533
            Length = 533

  Plus Strand HSPs:

 Score = 362 (54.3 bits), Expect = 2.3e-10, P = 2.3e-10
 Identities = 112/142 (78%), Positives = 112/142 (78%), Strand = Plus / Plus

Query:   422 AAAAAAAAAGCG-CCGCA-GCTTATCCCCNTTAATGAGGGTTTAATTTTAC-TTGGCCCT 478
             AAAAAA   GCG  CGCA GCTTAT CCC TTA TGAGGGTT AATTTTAC TTGGC CT
Sbjct:    42 AAAAAAGTTGCGGNCGCAAGCTTATTCCCTTTANTGAGGGTT-AATTTTACCTTGGCACT 100

Query:   479 GGCCGCCCTTTTACA-CTTCCTGAACTGG-AAA-CCCTGGGTTTNCCCA-CTTA-TCCCC 533
             GGCCG C TTTTACA C TC TGA CTGG AAA CCCTGG  TT CCCA CTTA TC CC
Sbjct:   101 GGCCGTCGTTTTACAACNTCATGA-CTGGGAAAACCCTGGCGTTACCCAACTTAATCNCC 159

Query:   534 TGG-A-CA-ATCCCCCTT-CCCCA 553
             T G A CA ATCCCCCTT C CCA
Sbjct:   160 TTGCAGCACATCCCCCTTTCNCCA 183


>cbil|dbest|1475768 AA754094 97GS0814 
            Lib=1073[Oryza_sativa||Immature_Seed|||5_days_after_pollination]
            Length=489
            Length = 489

  Plus Strand HSPs:

 Score = 293 (44.0 bits), Expect = 3.5e-07, P = 3.5e-07
 Identities = 111/155 (71%), Positives = 111/155 (71%), Strand = Plus / Plus

Query:   431 GCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGGCCGCCCTTTT 490
             GC C G A C  AT C C  TA  G G GT   ATT  A TT  C CTGGCCG C TTTT
Sbjct:   301 GCCCGGTACCCAATTCGCCCTATAGTGAGTCCTATTACAATT--CACTGGCCGTCGTTTT 358

Query:   491 ACA-CTTCCTGAACTGG-AAA-CCCTGGGTTTNCCCACTTA-TCCCCTGG-A-CA-ATCC 543
             ACA C TCCTGA CTGG AAA CCCTG GTT  CC ACTTA TCCCCT G A CA ATCC
Sbjct:   359 ACAACGTCCTGA-CTGGGAAAACCCTGCGTTACCCAACTTAATCCCCTTGCAGCACATCC 417

Query:   544 CCCTT-CCCCACTGGGTTTTTAC-AAAA-GGCCCCCGA 578
             CCCTT CCCCACTGG  T  TAC AAAA GGCCCCC A
Sbjct:   418 CCCTTTCCCCACTGGCGTAATACCAAAAAGGCCCCCCA 455


>cbil|dbest|542304 W34469 ma98e09.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=969
            Length = 969

  Plus Strand HSPs:

 Score = 313 (47.0 bits), Expect = 4.9e-06, P = 4.9e-06
 Identities = 115/164 (70%), Positives = 115/164 (70%), Strand = Plus / Plus

Query:   422 AAAAAAAAAGCGCCGCAGC--TTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTG 479
             AAAAA    GCG CG A C  TTATCCCC TTA T AGGGTTTAATTT   TTGG   T 
Sbjct:   432 AAAAACCTTGCGGCGGAACGTTTATCCCCTTTATT-AGGGTTTAATTTGG-TTGGGAATT 489

Query:   480 GCCGCCCTTTTACACTTCCTGAACTGGAAACCCTGGGTTTNCCCACTTA-TCCCCTG-GA 537
             GC G   TTTT CAC   CT A  TG AAACCCTGGG TT CCCA T A T CC T  GA
Sbjct:   490 GCGGTGGTTTT-CACCGTCTTACTTGCAAACCCTGGGGTTACCCATTAACTGCCTTAAGA 548

Query:   538 CAATCCCCCTTCCCCACTGGGTTTTTACAAAAGGCCCC-CGATTCCCT 584
              AATCCCC TT  CCACT GGT  T  CAA  GGCCC  CGATTCCCT
Sbjct:   549 -AATCCCCTTTTGCCACTTGGTAATAGCAAGGGGCCCGACGATTCCCT 595


>cbil|dbest|329389 D53161 HUM100F07B 5' Lib=318[Homo_sapiens|||||] Length=465
            Length = 465

  Plus Strand HSPs:

 Score = 270 (40.5 bits), Expect = 6.3e-06, P = 6.3e-06
 Identities = 110/160 (68%), Positives = 110/160 (68%), Strand = Plus / Plus

Query:   431 GCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGGCCGCCCTTTT 490
             GC C G A C  AT C C  TA  G G GT   ATT  A TT  C CTGGCCG C TTTT
Sbjct:   295 GCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACAATT--CACTGGCCGTCGTTTT 352

Query:   491 ACA-CTTCCTGAACTGG-AAACCCTGGGTTTNCCCACTTA-TCCCCTGG-A-CA-ATCCC 544
             ACA C TC TGA CTGG AAACCCTGG  TT CC ACTTA TC CCT G A CA ATCCC
Sbjct:   353 ACAACGTCGTGA-CTGGGAAACCCTGGCGTTACCAACTTAATCGCCTTGCAGCACATCCC 411

Query:   545 CCTTCCCCA-CTGGGTTTTTACAAAAGGCC-C-CCGATTCCCT 584
             C TTC CCA CTGGGT  T  C A AGGCC C CCGAT  CCT
Sbjct:   412 CTTTCGCCAGCTGGGTAATAGCGAGAGGCCGCACCGATCGCCT 454


>cbil|dbest|1182161 C24612 C24612 
            Lib=945[Dictyostelium_discoideum|||||slug] Length=421
            Length = 421

  Plus Strand HSPs:

 Score = 267 (40.1 bits), Expect = 1.0e-05, P = 1.0e-05
 Identities = 131/200 (65%), Positives = 131/200 (65%), Strand = Plus / Plus

Query:    10 TTTTTTTTTTTTTTTTTTTGGAGTGGAA-ATGCCAAAAAAGCAAAGATCCAAACACACAC 68
             TTTTTTT     TTTTTT G A   GA  A    AAAAAA CAAA A  CAAACA ACA 
Sbjct:   201 TTTTTTTAAAAATTTTTTAGTAAAAGATTAAAAAAAAAAAACAAACAAACAAACAAACAA 260

Query:    69 AGGCACACAAAAATAAAATAAAAATGAACAA-ATCAACAACC-CAGACGACAACAACAAC 126
             A   A ACAAAAAT  A T    AT A CAA A CAACA C  CA AC ACAACAACAAC
Sbjct:   261 ACTAA-ACAAAAATGGA-TGGGTATAACCAACAGCAACAGCAACA-ACAACAACAACAAC 317

Query:   127 AACAACGTGGT-TGCATAAAAGTTAGCGTTGCTCTCG-ATTTT-CATA-CGTCCAGAAGG 182
             AACAAC      TG AT  A GTT  C T G   T G ATTTT CATA C  CCA  A  
Sbjct:   318 AACAACACCAAATGAATCTAGGTT--CATCGGG-TGGTATTTTACATAGCCCCCAACAAC 374

Query:   183 AAAGACAATCAACAAGAAGAGCAACAA 209
             A   ACAA CAACAA AA A CAACAA
Sbjct:   375 ACCAACAA-CAACAACAACAACAACAA 400


>cbil|dbest|1235915 AA585430 TH747 5'/3' Lib=184[Homo_sapiens|||||] Length=589
            Author_cmt: Ribosomal protein L35
            Length = 589

  Plus Strand HSPs:

 Score = 298 (44.7 bits), Expect = 1.1e-05, P = 1.1e-05
 Identities = 112/159 (70%), Positives = 112/159 (70%), Strand = Plus / Plus

Query:   431 GCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGGCCGCCCTTTT 490
             GC C G A C  AT C C  TA T AG G  T  T TTAC    C CTGGCCG C TTTT
Sbjct:   319 GCCCGGTACCCAATTCGCCCTA-T-AGTGAATCGTATTACAATTCACTGGCCGTCGTTTT 376

Query:   491 ACACTTCCTGAACTGG--AAACCCTGGGTTTNCCCACTTA-TCCCCT-GGA-CAATCCCC 545
             A AC TC TGA CTGG  AAA CCTGG  TT CC ACTTA TC CCT GGA CAATCCCC
Sbjct:   377 AAACGTCGTGA-CTGGGGAAAACCTGGCGTTACCAACTTAATCGCCTTGGAACAATCCCC 435

Query:   546 CTTCCCCACTGG-GTTTTTACAAAAGGCCC-C-CGATTCCCT 584
              TTCCCCACTGG GTT T ACAAAA GCCC C C AT  CCT
Sbjct:   436 TTTCCCCACTGGCGTTATAACAAAAAGCCCGCACCATCGCCT 477


>cbil|dbest|1728779 AA991144 BSBmMFSZ06N12SK 5' Lib=283[Brugia_malayi|||||]
            Length=875
            Length = 875

  Plus Strand HSPs:

 Score = 302 (45.3 bits), Expect = 2.1e-05, P = 2.1e-05
 Identities = 90/117 (76%), Positives = 90/117 (76%), Strand = Plus / Plus

Query:   475 CCCTGGCCGCCCTTTTACACTTCCTGAACTGG-AAACCCTGGGT-TTNCCCACTTATCCC 532
             C CTGG CG C TTTTACAC TC T AAC GG AAA  C GGG  TT CCCACTTATC C
Sbjct:   686 CNCTGGGCGNCTTTTTACACNTCTT-AACGGGGAAAANCCGGGCGTTACCCACTTATCNC 744

Query:   533 CTGGACAA--TCCCCCTT-CCCCACTGG-GTTTTTACAAAA-GGCCCCC-GATTCCCT 584
             CT GA AA  T CCCCTT CCCCACTGG GTTTT  CAAAA GGCCCCC  ATTCCCT
Sbjct:   745 CTTGAAAAAATNCCCCTTTCCCCACTGGNGTTTTNCCAAAAAGGCCCCCCNATTCCCT 802


>cbil|dbest|1155941 AA511301 vj22b05.r1 5'
            Lib=855[Mus_musculus||heart|||4_weeks] Length=576 Author_cmt:
            gb:D13509 Mouse mRNA for PAP homologous protein (MOUSE);
            Length = 576

  Plus Strand HSPs:

 Score = 290 (43.5 bits), Expect = 3.2e-05, P = 3.2e-05
 Identities = 100/134 (74%), Positives = 100/134 (74%), Strand = Plus / Plus

Query:   431 GCGCCGCAG-CTTATCCCCNTTAATGAGGGTTTAATTTTAC-TTGG-CCCTGGCCGCCCT 487
             G GCCG AG CTTATCCCC TT  TG GGGT  AATTTTA  TTGG CCCTGGCCGC  T
Sbjct:   434 GGGCCGAAGGCTTATCCCCTTTGGTGGGGGT--AATTTTAGGTTGGGCCCTGGCCGCGGT 491

Query:   488 TTTACACTTCCTGAACTGGAAACC-CT-GGGTTTNCCCA-CTTATCCCCT-GGACAATCC 543
             TT A AC   C GA C GGAAA   CT GGG T  CCCA CTTATC CCT GG  AATCC
Sbjct:   492 TTAAAACGCGC-GACCGGGAAAGATCTTGGGGTGACCCANCTTATCGCCTTGGGAAATCC 550

Query:   544 CCCTTCC-CCACTGGGT 559
             CCCTT C CCA TGGGT
Sbjct:   551 CCCTTTCGCCAGTGGGT 567


>cbil|dbest|696969 C14391 C14391 5' Lib=313[Homo_sapiens|||||] Length=395
            Length = 395

  Plus Strand HSPs:

 Score = 251 (37.7 bits), Expect = 6.9e-05, P = 6.9e-05
 Identities = 102/148 (68%), Positives = 105/148 (70%), Strand = Plus / Plus

Query:   431 GCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGGCCGCCCTTTT 490
             GC C G A C  AT C C T  A G G+GT   ATT  A TT  C CTGGCCG C TTTT
Sbjct:   248 GCCCGGTACCCAATTCGCCTATA-GTGRGTCGTATTACAATT--CACTGGCCGTCGTTTT 304

Query:   491 ACA-CTTCCTGAACTGG-AAACCCTGGGTTTNCCCA-CTTA-TCCCCTGG-A-CA-ATCC 543
             ACA C TC TGA CTGG AAACCCTGG+ TT CCCA CTTA TC CCT G A +A ATCC
Sbjct:   305 ACAACGTCGTGA-CTGGGAAACCCTGGSGTTACCCAMCTTAATCGCCTTGCAGMACATCC 363

Query:   544 CCCTTCC-CCA-CTGGGTTTTTACAAAAGGCC 573
             CCCTT C CCA CTGGGT  T  C A AGGCC
Sbjct:   364 CCCTTTCGCCAGCTGGGTAATAGCGAGAGGCC 395


>cbil|dbest|1474886 AA752907 97AS0632 
            Lib=1073[Oryza_sativa||Immature_Seed|||5_days_after_pollination]
            Length=643
            Length = 643

  Plus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 7.2e-05, P = 7.2e-05
 Identities = 116/164 (70%), Positives = 116/164 (70%), Strand = Plus / Plus

Query:   431 GCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGGCCGCCCTTTT 490
             GC C G A C  AT C C  TA  G G GT   ATT  A TT  C CTGGCCG C TTTT
Sbjct:   262 GCCCGGTACCCAATNCGCCCTATAGTGAGTCGTATTACAATT--CACTGGCCGTCGTTTT 319

Query:   491 ACA-CTTCCTGAACTGG-AAACCCTGG-GTTTNCCCACTTA-TCCCCTGGA-CA-ATCCC 544
             ACA C TC TGA CTGG AAA CCTGG GTT  CCCACTTA TC CCTG A CA ATCCC
Sbjct:   320 ACAACGTCGTGA-CTGGGAAAACCTGGCGTTACCCCACTTAATCGCCTGCANCACATCCC 378

Query:   545 CC-TTCCCCACTGG-GTTTTTAC--AAAAGGCC-C-CCGATT-CCCT 584
             CC TTC CCACTGG GTT T AC  AAAA GCC C CCGAT  CCCT
Sbjct:   379 CCCTTCNCCACTGGCGTTATAACGAAAAAAGCCGCACCGATCGCCCT 425

  Minus Strand HSPs:

 Score = 206 (30.9 bits), Expect = 2.0, P = 0.87
 Identities = 82/117 (70%), Positives = 82/117 (70%), Strand = Minus / Plus

Query:   119 TTGTCGTCTGGGTTGTTGAT-TTGTTCATTTTTATTTTATTTTTGTGTGCCTGTGTGTGT 61
             TTGTCGT TG GTTGT GAT TTGTT ATTTT     T T TTTGTGT   TG  TGTG 
Sbjct:   148 TTGTCGT-TGAGTTGTGGATGTTGTTGATTTTGTGAATGTATTTGTGT---TGA-TGTGA 202

Query:    60 TTGGATCTTTGCTTTTTTGGCATTTCCACTCCAAAAAAAAAAAAAAAAAAACCTCGTG 3
              TG AT T TG T    TG  ATTT   CT  AAAAAAAAAAAAAAAAAAAC TCG G
Sbjct:   203 ATGAATTTGTGATGACCTGAGATTTTG-CT--AAAAAAAAAAAAAAAAAAAC-TCGAG 256


>cbil|dbest|1658049 AA926432 TENS1054 5'
            Lib=1138[Trypanosoma_cruzi|||epimastigote||] Length=528
            Length = 528

  Plus Strand HSPs:

 Score = 241 (36.2 bits), Expect = 9.2e-05, Sum P(2) = 9.2e-05
 Identities = 61/77 (79%), Positives = 61/77 (79%), Strand = Plus / Plus

Query:   433 GCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGGCCGCCCTTTTAC 492
             GCC CA C TA  CCC TTAATGA GGTT AATTT AC TGGCCCTGGCCG C TTTTA 
Sbjct:   450 GCCCCAACCTAATCCCCTTAATGAAGGTT-AATTTNACCTGGCCCTGGCCGNCNTTTTAA 508

Query:   493 ACTTCCTGAACTGGAAA 509
             ACTTC T AAC GGAAA
Sbjct:   509 ACTTC-TNAACNGGAAA 524

 Score = 130 (19.5 bits), Expect = 9.2e-05, Sum P(2) = 9.2e-05
 Identities = 46/69 (66%), Positives = 46/69 (66%), Strand = Plus / Plus

Query:    10 TTTTTTTTTTTTTTTTTTTGG-AGTGGAAAT-GCCAAAAAAGCAAAGATCCAAACACACA 67
             TTTTTTTTTTTTTTTTTTTG  A    AAA  G  AAAAAA  AAA A  CA    CA A
Sbjct:   206 TTTTTTTTTTTTTTTTTTTGTTAAAAAAAACAGGAAAAAAAAAAAAAAAACATNTCCATA 265

Query:    68 CAGGCACAC 76
             CA   ACAC
Sbjct:   266 CATNTACAC 274

 Score = 120 (18.0 bits), Expect = 0.00025, Sum P(2) = 0.00025
 Identities = 38/54 (70%), Positives = 38/54 (70%), Strand = Plus / Plus

Query:    10 TTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAAACA 63
             TTTTTTTTTTTTTTTTTTT G  T  AAA   CA  AAA  AAA A   AAACA
Sbjct:   205 TTTTTTTTTTTTTTTTTTTTGT-TAAAAAAAACAGGAAAAAAAAAAAAAAAACA 257


>cbil|dbest|520899 W13928 mb36h06.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=952
            Author_cmt: gb:X73331 M.musculus mRNA for ribosomal protein L37a
            (MOUSE);
            Length = 952

  Plus Strand HSPs:

 Score = 289 (43.4 bits), Expect = 0.00014, P = 0.00014
 Identities = 117/168 (69%), Positives = 117/168 (69%), Strand = Plus / Plus

Query:   422 AAAAAAAAAGCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTAC-TTGGCCCTGG 480
             AAAAA A  G GCCG A  TTA  CCC TTA  G GGG T AATTTT C TTGGC  TGG
Sbjct:   405 AAAAACATTGGGCCGAAAGTTAATCCC-TTAGGGGGGGGT-AATTTTGCCTTGGCA-TGG 461

Query:   481 CCGCCCTTTTACACTTCCTGAACT-GGAAACCCTGGGTTTNCCCACTTATCCCCT-G-GA 537
             CCG C TTTTA AC  C TG  CT GGAAACCCTGGG T  CC ACTTA C  CT G GA
Sbjct:   462 CCGGCGTTTTAAACGGC-TGTCCTTGGAAACCCTGGGGTGTCCAACTTAACTGCTTGCGA 520

Query:   538 CAA-TCCCCCTTCC-CCACTGGGTTTT-TACAAAAGGCCC-CCG-ATTCCCT 584
              AA TCCCC TTC  CCACT GGT  T T C A   GC C CCG AT CCCT
Sbjct:   521 GAAATCCCCTTTCTGCCACTTGGTAATATGCGAGGAGCACGCCGGATGCCCT 572


>cbil|dbest|334738 D59751 HUM063B08B 5' Lib=318[Homo_sapiens|||||] Length=402
            Length = 402

  Plus Strand HSPs:

 Score = 242 (36.3 bits), Expect = 0.00019, P = 0.00019
 Identities = 93/133 (69%), Positives = 94/133 (70%), Strand = Plus / Plus

Query:   431 GCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGGCCGCCCTTTT 490
             GC C G A C  AT C C  TA  G G GT   ATT  A TT  C CTGGCCG C TTTT
Sbjct:   259 GCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACAATT--CACTGGCCGTCGTTTT 316

Query:   491 ACA-CTTCCTGAACTGG-AAACCCTGGGTTTNCCCACTTA-TCCCCTGG-A-CA-ATCCC 544
             ACA C TC TGA CTGG AAACCCTGG+ TT CC ACTTA TC CCT G A CA ATCCC
Sbjct:   317 ACAACGTCGTGA-CTGGGAAACCCTGGSGTTACCAACTTAATCGCCTTGCAGCACATCCC 375

Query:   545 CCTTCCCCA-CTGGGT 559
             C TTC CCA CTGGGT
Sbjct:   376 CTTTCGCCARCTGGGT 391


>cbil|dbest|696900 C14322 C14322 5' Lib=313[Homo_sapiens|||||] Length=491
            Length = 491

  Plus Strand HSPs:

 Score = 267 (40.1 bits), Expect = 0.00024, P = 0.00024
 Identities = 111/159 (69%), Positives = 113/159 (71%), Strand = Plus / Plus

Query:   431 GCGCCGCAGCTTATCCCCNT-TAATGAGGGTTTAATTTTACTTGGCCCTGGCCGCCCTTT 489
             GC C G A C  AT C C T TA TGAG   T  ATT  A TT  C CTGGCCG C TTT
Sbjct:   293 GCCCGGTACCCAATTCGCCTATAGTGAGTCGT--ATTACAATT--CACTGGCCGTCGTTT 348

Query:   490 TACA-CTTCCTGAACTGG-AAACCCTGGGTTTNCCCACTTA-TCCCCTGG-A-CA-ATCC 543
             TACA C TC TGA CTGG AAACCCTGG+ TT CC ACTTA TC CCT G A CA ATCC
Sbjct:   349 TACAACGTCGTGA-CTGGGAAACCCTGGSGTTACCAACTTAATCGCCTTGCAGCACATCC 407

Query:   544 CCCTTCCCCA-CTGGGTTTTTACAAAAGGCC-C-CCGATTCCCT 584
             CC TTC CCA CTGGGT  T  C A +GGCC C CCGAT  CCT
Sbjct:   408 CCTTTCGCCAGCTGGGTAATAGCGAGRGGCCGCACCGATCGCCT 451


>cbil|dbest|1643390 AA915331 vz28f01.r1 5'
            Lib=544[Mus_musculus||Thymus|||4_weeks] Length=1188 Author_cmt:
            WP:C36B1.3 CE05370 DNA DIRECTED RNA POLYMERASE II ;
            Length = 1188

  Plus Strand HSPs:

 Score = 284 (42.6 bits), Expect = 0.00031, P = 0.00031
 Identities = 114/163 (69%), Positives = 114/163 (69%), Strand = Plus / Plus

Query:   422 AAAAAAAAAGCG-CCGCAG-CTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTG 479
             AAAAA AAAGCG CCGC G CTT TCCCC TT  TG GGGTTT   TT  C TGG CCTG
Sbjct:   670 AAAAAGAAAGCGGCCGCCGGCTTTTCCCCTTTGGTGGGGGTTT---TTAGCCTGGGCCTG 726

Query:   480 GCCGCCCTTTTACACTTCCTGAACTGGAAACCCTGGGTTTNCCCACTTATCCCCT-GGAC 538
              C G   TTTT CAC TC  G    GGAAACCCTGGG TT C C  TTA C CCT GGAC
Sbjct:   727 -C-GTTGTTTT-CACGTCGGGTGG-GGAAACCCTGGGGTTCCACT-TTAACGCCTTGGAC 781

Query:   539 AATCCCCCTTCCCCACTGGGTTTTTACAAAAGGCC-CCCGATTCCCT 584
               TCCCCCTT CC   TGGGT TT   A   GGCC CCCG TT CCT
Sbjct:   782 CTTCCCCCTTGCCGG-TGGGTATTGTGAGGGGGCCGCCCGTTTGCCT 827


>cbil|dbest|1647612 C89908 C89908 
            Lib=945[Dictyostelium_discoideum|||||slug] Length=370
            Length = 370

  Plus Strand HSPs:

 Score = 232 (34.8 bits), Expect = 0.00065, P = 0.00065
 Identities = 82/125 (65%), Positives = 82/125 (65%), Strand = Plus / Plus

Query:     9 GTTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAAACACACAC 68
             GTTTTT TTTTTTTTTTTT G A T  AA TG  AAAAAA  AAA A   AAA   A A 
Sbjct:   215 GTTTTTATTTTTTTTTTTTGGAAATTTAATTGAAAAAAAAAAAAAAAAAAAAAATAAGAT 274

Query:    69 AGGCACACAA-AAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAACAACAACA 127
             A G  CA AA AAA AAAA AAAAA  AA AAA  AA AA  CA A  A AA AA AA A
Sbjct:   275 AAGATCAAAACAAAAAAAAAAAAAACAAAAAAAAAAAAAAAACACAACAAAAAAAAAAAA 334

Query:   128 ACAAC 132
             A AAC
Sbjct:   335 AAAAC 339


>cbil|dbest|1673442 C90773 C90773 
            Lib=1272[Dictyostelium_discoideum|||||slug] Length=364
            Length = 364

  Plus Strand HSPs:

 Score = 231 (34.7 bits), Expect = 0.00074, P = 0.00074
 Identities = 85/132 (64%), Positives = 85/132 (64%), Strand = Plus / Plus

Query:     1 GGCACGAGG-TTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCA 59
             GG ACG GG TTTTTTTTTTTTTTTTTTT    T  AAA    AAAAAA  AAA A   A
Sbjct:   227 GGGACGGGGGTTTTTTTTTTTTTTTTTTTTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAA 286

Query:    60 AACACACACAGGCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAA 119
             AA A A A A   A A AAAAA AAAA AAAAA  AA AAA  AA AA   A A  A AA
Sbjct:   287 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 346

Query:   120 CAACAACAACAA 131
              AA AA AA AA
Sbjct:   347 AAAAAAAAAAAA 358

 Score = 221 (33.2 bits), Expect = 0.0023, P = 0.0023
 Identities = 85/133 (63%), Positives = 85/133 (63%), Strand = Plus / Plus

Query:     1 GGCACGAGG-TTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCA 59
             GG ACG GG TTTTTTTTTTTTTTTTTTT    T  AAA    AAAAAA  AAA A   A
Sbjct:   227 GGGACGGGGGTTTTTTTTTTTTTTTTTTTTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAA 286

Query:    60 AACACACACAGGCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAA 119
             AA A A A A   A A AAAAA AAAA AAAAA  AA AAA  AA AA   A A  A AA
Sbjct:   287 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 346

Query:   120 CAACAACAACAA- 131
              AA AA AA AA 
Sbjct:   347 AAAAAAAAAAAAA 359

 Score = 214 (32.1 bits), Expect = 0.0051, P = 0.0051
 Identities = 78/122 (63%), Positives = 78/122 (63%), Strand = Plus / Plus

Query:    10 TTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAAACACACACA 69
             |||||||||||||||||||  |    |||    ||||||  ||| |   ||| | | | |
Sbjct:   242 TTTTTTTTTTTTTTTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 301

Query:    70 GGCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAACAACAACAAC 129
                | | ||||| |||| |||||  || |||  || ||   | |  | || || || || 
Sbjct:   302 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 361

Query:   130 AA 131
             ||
Sbjct:   362 AA 363

 Score = 214 (32.1 bits), Expect = 0.0051, P = 0.0051
 Identities = 78/122 (63%), Positives = 78/122 (63%), Strand = Plus / Plus

Query:    10 TTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAAACACACACA 69
             |||||||||||||||||||  |    |||    ||||||  ||| |   ||| | | | |
Sbjct:   243 TTTTTTTTTTTTTTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 302

Query:    70 GGCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAACAACAACAAC 129
                | | ||||| |||| |||||  || |||  || ||   | |  | || || || || 
Sbjct:   303 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 362

Query:   130 AA 131
             ||
Sbjct:   363 AA 364

 Score = 208 (31.2 bits), Expect = 0.030, P = 0.029
 Identities = 78/122 (63%), Positives = 78/122 (63%), Strand = Plus / Plus

Query:    10 TTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAAACACACACA 69
             TTTTTTTTTTTTTTTTTTT  A    AAA    AAAAAA  AAA A   AAA A A A A
Sbjct:   242 TTTTTTTTTTTTTTTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 301

Query:    70 GGCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAACAACAACAAC 129
                A A AAAAA AAAA AAAAA  AA AAA  AA AA   A A  A AA AA AA AA 
Sbjct:   302 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA- 360

Query:   130 AA 131
             AA
Sbjct:   361 AA 362

 Score = 205 (30.8 bits), Expect = 0.11, P = 0.11
 Identities = 77/122 (63%), Positives = 77/122 (63%), Strand = Plus / Plus

Query:    10 TTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAAACACACACA 69
             |||||||||||||||||||       |||    ||||||  ||| |   ||| | | | |
Sbjct:   240 TTTTTTTTTTTTTTTTTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 299

Query:    70 GGCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAACAACAACAAC 129
                | | ||||| |||| |||||  || |||  || ||   | |  | || || || || 
Sbjct:   300 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 359

Query:   130 AA 131
             ||
Sbjct:   360 AA 361


>cbil|dbest|1746106 C93975 C93975 
            Lib=945[Dictyostelium_discoideum|||||slug] Length=384
            Length = 384

  Plus Strand HSPs:

 Score = 230 (34.5 bits), Expect = 0.00079, P = 0.00079
 Identities = 80/121 (66%), Positives = 80/121 (66%), Strand = Plus / Plus

Query:    12 TTTTTTTTTTTTTTTTTGGAG-TGGAAATGCCAAAAAAGCAAAGATCCAAACACACACAG 70
             TTTTT TTTTTTTTTTTGGA  T  AA TG  AAAAAA  AAA A   AAA   A A A 
Sbjct:   231 TTTTTATTTTTTTTTTTGGAAATTTAATTGAAAAAAAAAAAAAAAAAAAAAATAAGATAA 290

Query:    71 GCACACAAAAATAAAATAAAAATGAACAAATCAACAACCCAGACGACAACAACAACAACA 130
             G  CA AA AA AAAA AAAAA  AA AAA  AA AA   A AC ACAA AA AA AA A
Sbjct:   291 GATCAAAACAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAACACAACAAAAAAAAAAAAA 350

Query:   131 A 131
             A
Sbjct:   351 A 351

 Score = 225 (33.8 bits), Expect = 0.0014, P = 0.0014
 Identities = 85/125 (68%), Positives = 85/125 (68%), Strand = Plus / Plus

Query:    12 TTTTTTTTTTTTTTTTTGGAG-TGGAAATGCCAAAAAAGCAAAGATCCAAAC

Date: 16:24:36 on Sun 17 Dec 117.