blastn_dbest_files/1327770_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  1327770
        (339 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|1327770 AA629496 MU000072.Y2R  Lib=98...  1695  2.2e-70   1
A cbil|dbest|642933 Z78319 HSZ78319 5' Lib=477[Homo_sapien...   691  1.9e-25   1
A cbil|dbest|718050 AA082820 zn25d04.r1 5' Lib=524[Homo_sa...   685  5.7e-25   1
A cbil|dbest|962901 AA321522 EST24093 5'-end Lib=803[Homo_...   690  6.0e-25   1
A cbil|dbest|957099 AA315780 EST187542 5'-end Lib=842[Homo...   664  6.3e-24   1
A cbil|dbest|1857278 AI098888 ue33g09.y1 5' Lib=1299[Mus_mu...   636  1.0e-22   1
A cbil|dbest|1425271 AA718558 vt85f02.r1 5' Lib=868[Mus_mus...   633  2.0e-22   1
A cbil|dbest|1116597 AA471827 vg96f03.r1 5' Lib=609[Mus_mus...   627  3.2e-22   1
A cbil|dbest|520057 W12951 ma88a08.r1 5' Lib=431[Mus_muscu...   627  3.3e-22   1
A cbil|dbest|543720 W35907 ma81d12.r1 5' Lib=431[Mus_muscu...   628  3.3e-22   1
A cbil|dbest|1166713 AA522061 vi08h03.r1 5' Lib=916[Mus_mus...   627  3.4e-22   1
A cbil|dbest|667230 AA051552 mj53g11.r1 5' Lib=437[Mus_mus...   627  3.7e-22   1
A cbil|dbest|1758255 AI019098 ub19b10.r1 5' Lib=544[Mus_mus...   627  3.7e-22   1
A cbil|dbest|609154 AA000900 mg24g03.r1 5' Lib=437[Mus_mus...   627  3.9e-22   1
A cbil|dbest|1661403 AA929519 vt40d01.r1 5' Lib=918[Mus_mus...   614  1.4e-21   1
A cbil|dbest|677879 AA052239 mb91d05.r1 5' Lib=431[Mus_mus...   612  1.7e-21   1
A cbil|dbest|1139373 AA494696 fa10f04.r1 5' Lib=899[Danio_r...   610  2.2e-21   1
A cbil|dbest|471067 N65065 20105  Lib=71[Arabidop...   607  2.3e-21   1
A cbil|dbest|685975 AA060235 mj72f08.r1 5' Lib=431[Mus_mus...   611  2.6e-21   1
A cbil|dbest|1436173 N38443 19670 3' Lib=71[Arabidopsis_tha...   604  2.9e-21   1
A cbil|dbest|814215 AA175235 ms83b01.r1 5' Lib=553[Mus_mus...   591  1.7e-20   1
A cbil|dbest|1744959 AI006291 ua68d10.r1 5' Lib=544[Mus_mus...   582  5.8e-20   1
A cbil|dbest|1716174 AA979720 MEST1-A2.EK1.Seq 5' Lib=1305[...   523  1.1e-17   1
A cbil|dbest|1255222 C47815 C47815 5' Lib=162[Caenorhabditi...   461  1.1e-14   1
A cbil|dbest|1252795 C45388 C45388 5' Lib=162[Caenorhabditi...   460  1.3e-14   1
A cbil|dbest|670134 C09652 C09652 5' Lib=162[Caenorhabditi...   458  1.6e-14   1
A cbil|dbest|1148353 AA503723 ne50f09.s1 3' Lib=882[Homo_sa...   456  3.0e-14   1
A cbil|dbest|654386 AA038729 mi93b11.r1 5' Lib=431[Mus_mus...   403  5.6e-12   1
A cbil|dbest|811306 AA173018 mt02f11.r1 5' Lib=553[Mus_mus...   354  1.6e-09   1
A cbil|dbest|1243372 C35965 C35965 3' Lib=162[Caenorhabditi...   334  7.4e-09   1
A cbil|dbest|1240883 C34186 C34186 3' Lib=162[Caenorhabditi...   333  8.3e-09   1
A cbil|dbest|168146 T97990 ye56b04.s1 3' Lib=262[Homo_sapi...   152  0.80      1
A cbil|dbest|339925 D62701 HUM316G01B 5' Lib=313[Homo_sapi...   149  0.93      1
A cbil|dbest|443072 N41618 yw67d02.r1 5' Lib=368[Homo_sapi...   176  0.99      1



>cbil|dbest|1327770 AA629496 MU000072.Y2R 
            Lib=983[Schistosoma_mansoni||lung|||] Length=339
            Length = 339

  Plus Strand HSPs:

 Score = 1695 (254.3 bits), Expect = 2.2e-70, P = 2.2e-70
 Identities = 339/339 (100%), Positives = 339/339 (100%), Strand = Plus / Plus

Query:     1 GGAATTCGGCACGAGGCTACATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATC 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 GGAATTCGGCACGAGGCTACATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATC 60

Query:    61 CTAATTTGCCTTTCAAAGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGA 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 CTAATTTGCCTTTCAAAGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGA 120

Query:   121 AGTTTGCTGCTGAAGAATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATG 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 AGTTTGCTGCTGAAGAATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATG 180

Query:   181 GGATCGGTATAAATCCTCAACAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACT 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 GGATCGGTATAAATCCTCAACAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACT 240

Query:   241 TGCGATTAATTCCTAGGGATCGTGTTGGTGGCCTGTGATATTCTTCTTTCCTTGTTTATT 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 TGCGATTAATTCCTAGGGATCGTGTTGGTGGCCTGTGATATTCTTCTTTCCTTGTTTATT 300

Query:   301 GTGGTCATTTTGTATGTCGTATCTGTTTTTATTTATCTG 339
             |||||||||||||||||||||||||||||||||||||||
Sbjct:   301 GTGGTCATTTTGTATGTCGTATCTGTTTTTATTTATCTG 339


>cbil|dbest|642933 Z78319 HSZ78319 5' Lib=477[Homo_sapiens||brain|||fetus]
            Length=903
            Length = 903

  Plus Strand HSPs:

 Score = 691 (103.7 bits), Expect = 1.9e-25, P = 1.9e-25
 Identities = 209/282 (74%), Positives = 209/282 (74%), Strand = Plus / Plus

Query:     6 TCGGCACGAGGCTACATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAAT 65
             TCGGCAC A  C  CATGTC AA  T TC TTTAA ATCAC CT AC TC GA CC    
Sbjct:     2 TCGGCACCA--C--CATGTCGAAGGTTTCCTTTAAGATCACGCTGACGTCGGACCCACGG 57

Query:    66 TTGCCTTTCAAAGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTT 125
              TGCC T CAAAGTACT A  GT CCTGAAA T CACC TT AC GC GTCTT AAGTTT
Sbjct:    58 CTGCCGTACAAAGTACTCAGTGTTCCTGAAAGTACACCTTTCACAGCAGTCTTAAAGTTT 117

Query:   126 GCTGCTGAAGAATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATC 185
             GC GC GAAGAATT A  GT CC GC GC ACAAG GC ATTAT AC  ATGATGG AT 
Sbjct:   118 GCAGCAGAAGAATTTAAAGTTCCTGCTGCAACAAGTGCAATTATTACCAATGATGGAATA 177

Query:   186 GGTATAAATCCTCAACAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACTTGCG- 244
             GG ATAAATCCT  ACA AC GC GG  A GT TTTCT AAACATGG TCAGA  TGCG 
Sbjct:   178 GGAATAAATCCTGCACAGACTGCTGGAAATGTTTTTCTAAAACATGGTTCAGAACTGCGG 237

Query:   245 ATTAATTCCTAGGGATCGTGTTGGTGGCCTGTGATAT-TCTTCT 287
             ATTA TTCCTAG GATCGTGTTGG  G  TGT A AT TCT CT
Sbjct:   238 ATTA-TTCCTAGAGATCGTGTTGGAAGT-TGTTA-ATATCTGCT 278


>cbil|dbest|718050 AA082820 zn25d04.r1 5'
            Lib=524[Homo_sapiens|||||Ntera-2/RA+MI_neuroepithelial_cells]
            Length=548 Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 548

  Plus Strand HSPs:

 Score = 685 (102.8 bits), Expect = 5.7e-25, P = 5.7e-25
 Identities = 199/267 (74%), Positives = 199/267 (74%), Strand = Plus / Plus

Query:    21 ATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTA 80
             ATGTC AA  T TC TTTAA ATCAC CT AC TC GA CC     TGCC T CAAAGTA
Sbjct:     1 ATGTCGAAGGTTTCCTTTAAGATCACGCTGACGTCGGACCCACGGCTGCCGTACAAAGTA 60

Query:    81 CTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTC 140
             CT A  GT CCTGAAA T CACC TT AC GC GTCTT AAGTTTGC GC GAAGAATT 
Sbjct:    61 CTCAGTGTTCCTGAAAGTACACCTTTCACAGCAGTCTTAAAGTTTGCAGCAGAAGAATTT 120

Query:   141 AGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAA 200
             A  GT CC GC GC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  A
Sbjct:   121 AAAGTTCCTGCTGCAACAAGTGCAATTATTACCAATGATGGAATAGGAATAAATCCTGCA 180

Query:   201 CAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACTTGCG-ATTAATTCCTAGGGA 259
             CA AC GC GG  A GT TTTCT AAACATGG TCAGA  TGCG ATTA TTCCTAG GA
Sbjct:   181 CAGACTGCTGGAAATGTTTTTCTAAAACATGGTTCAGAACTGCGGATTA-TTCCTAGAGA 239

Query:   260 TCGTGTTGGTGGCCTGTGATAT-TCTTCT 287
             TCGTGTTGG  G  TGT A AT TCT CT
Sbjct:   240 TCGTGTTGGAAGT-TGTTA-ATATCTGCT 266


>cbil|dbest|962901 AA321522 EST24093 5'-end Lib=803[Homo_sapiens||lymphoid|||]
            Length=308 Author_cmt: hypothetical protien (GB:Z70222)
            Length = 308

  Plus Strand HSPs:

 Score = 690 (103.5 bits), Expect = 6.0e-25, P = 6.0e-25
 Identities = 200/268 (74%), Positives = 200/268 (74%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAA ATCAC CT AC TC GA CC     TGCC T CAAAGT
Sbjct:     9 CATGTCGAAGGTTTCCTTTAAGATCACGCTGACGTCGGACCCACGGCTGCCGTACAAAGT 68

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
             ACT A  GT CCTGAAA T CACC TT AC GC GTCTT AAGTTTGC GC GAAGAATT
Sbjct:    69 ACTCAGTGTTCCTGAAAGTACACCTTTCACAGCAGTCTTAAAGTTTGCAGCAGAAGAATT 128

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              A  GT CC GC GC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   129 TAAAGTTCCTGCTGCAACAAGTGCAATTATTACCAATGATGGAATAGGAATAAATCCTGC 188

Query:   200 ACAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACTTGCG-ATTAATTCCTAGGG 258
             ACA AC GC GG  A GT TTTCT AAACATGG TCAGA  TGCG ATTA TTCCTAG G
Sbjct:   189 ACAGACTGCTGGAAATGTTTTTCTAAAACATGGTTCAGAACTGCGGATTA-TTCCTAGAG 247

Query:   259 ATCGTGTTGGTGGCCTGTGATAT-TCTTCT 287
             ATCGTGTTGG  G  TGT A AT TCT CT
Sbjct:   248 ATCGTGTTGGAAGT-TGTTA-ATATCTGCT 275


>cbil|dbest|957099 AA315780 EST187542 5'-end
            Lib=842[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=442 Author_cmt: hypothetical
            protien (GB:Z70222)
            Length = 442

  Plus Strand HSPs:

 Score = 664 (99.6 bits), Expect = 6.3e-24, P = 6.3e-24
 Identities = 194/261 (74%), Positives = 194/261 (74%), Strand = Plus / Plus

Query:    27 AAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTACTAAAG 86
             AA  T TC TTTAA ATCAC CT AC TC GA CC     TGCC T CAAAGTACT A  
Sbjct:     2 AAGGTTTCCTTTAAGATCACGCTGACGTCGGACCCACGGCTGCCGTACAAAGTACTCAGT 61

Query:    87 GTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTCAGCGTA 146
             GT CCTGAAA T CACC TT AC GC GTCTT AAGTTTGC GC GAAGAATT A  GT 
Sbjct:    62 GTTCCTGAAAGTACACCTTTCACAGCAGTCTTAAAGTTTGCAGCAGAAGAATTTAAAGTT 121

Query:   147 CCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAACAAACA 206
             CC GC GC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  ACA AC 
Sbjct:   122 CCTGCTGCAACAAGTGCAATTATTACCAATGATGGAATAGGAATAAATCCTGCACAGACT 181

Query:   207 GCAGGTGAAGTGTTTCTTAAACATGGATCAGACTTGCG-ATTAATTCCTAGGGATCGTGT 265
             GC GG  A GT TTTCT AAACATGG TCAGA  TGCG ATTA TTCCTAG GATCGTGT
Sbjct:   182 GCTGGAAATGTTTTTCTAAAACATGGTTCAGAACTGCGGATTA-TTCCTAGAGATCGTGT 240

Query:   266 TGGTGGCCTGTGATAT-TCTTCT 287
             TGG  G  TGT A AT TCT CT
Sbjct:   241 TGGAAGT-TGTTA-ATATCTGCT 261


>cbil|dbest|1857278 AI098888 ue33g09.y1 5'
            Lib=1299[Mus_musculus|liver||||adult] Length=507 Author_cmt:
            WP:ZK652.3 CE00449 ;
            Length = 507

  Plus Strand HSPs:

 Score = 636 (95.4 bits), Expect = 1.0e-22, P = 1.0e-22
 Identities = 196/271 (72%), Positives = 196/271 (72%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    48 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 107

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:   108 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 167

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              AG GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   168 TAGAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGC 227

Query:   200 ACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGG 258
             ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG G
Sbjct:   228 ACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAG 286

Query:   259 ATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             A CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   287 ACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 318


>cbil|dbest|1425271 AA718558 vt85f02.r1 5'
            Lib=868[Mus_musculus|mammary_gland|mammary_gland|||4_weeks]
            Length=348 Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 348

  Plus Strand HSPs:

 Score = 633 (95.0 bits), Expect = 2.0e-22, P = 2.0e-22
 Identities = 197/274 (71%), Positives = 197/274 (71%), Strand = Plus / Plus

Query:    17 CTACATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAA 76
             C ACATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAA
Sbjct:     7 CCACATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAA 66

Query:    77 AGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGA 136
             AGT CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGA
Sbjct:    67 AGTTCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGA 126

Query:   137 ATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCC 196
             ATT A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCC
Sbjct:   127 ATTTAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCC 186

Query:   197 TCAACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTA 255
             T  ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTA
Sbjct:   187 TGCACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTA 245

Query:   256 GGGATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             G GA CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   246 GAGACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 280


>cbil|dbest|1116597 AA471827 vg96f03.r1 5'
            Lib=609[Mus_musculus|pooled|pooled_organs|||7_day] Length=404
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 404

  Plus Strand HSPs:

 Score = 627 (94.1 bits), Expect = 3.2e-22, P = 3.2e-22
 Identities = 195/271 (71%), Positives = 195/271 (71%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    63 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 122

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:   123 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 182

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   183 TAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGC 242

Query:   200 ACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGG 258
             ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG G
Sbjct:   243 ACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAG 301

Query:   259 ATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             A CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   302 ACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 333


>cbil|dbest|520057 W12951 ma88a08.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=400
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 400

  Plus Strand HSPs:

 Score = 627 (94.1 bits), Expect = 3.3e-22, P = 3.3e-22
 Identities = 195/271 (71%), Positives = 195/271 (71%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    27 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 86

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:    87 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 146

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   147 TAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGC 206

Query:   200 ACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGG 258
             ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG G
Sbjct:   207 ACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAG 265

Query:   259 ATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             A CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   266 ACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 297


>cbil|dbest|543720 W35907 ma81d12.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=354
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 354

  Plus Strand HSPs:

 Score = 628 (94.2 bits), Expect = 3.3e-22, P = 3.3e-22
 Identities = 210/294 (71%), Positives = 210/294 (71%), Strand = Plus / Plus

Query:     4 ATTCGGCAC-GAGGC--T---AC-ATGTCAAAAATATCGTTTAAAATCACTCTAACTTCA 56
             ATTCGGCAC G GGC  T   AC ATGTC AA  T TC TTTAAAATCAC  T AC TC 
Sbjct:     1 ATTCGGCACAGGGGCGGTTCCACCATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCG 60

Query:    57 GATCCTAATTTGCCTTTCAAAGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTC 116
             GA CC     TGCC T CAAAGT CT A  GT CCTGAAA T C CC TT AC GC GT 
Sbjct:    61 GACCCGCGGCTGCCGTACAAAGTTCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTG 120

Query:   117 TTGAAGTTTGCTGCTGAAGAATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGAT 176
              T AAGTTTGC GC GAAGAATT A  GT CC GCAGC ACAAG GC ATTAT AC  AT
Sbjct:   121 CTAAAGTTTGCAGCAGAAGAATTTAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAAT 180

Query:   177 GATGGGATCGGTATAAATCCTCAACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATC 235
             GATGG AT GG ATAAATCCT  ACA AC GC GG GAA GT TT CT AA CA GG TC
Sbjct:   181 GATGGAATAGGAATAAATCCTGCACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTC 239

Query:   236 AGACTTGCGATTAATTCCTAGGGATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             AGA  TG GA T ATTCCTAG GA CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   240 AGAACTGAGAATCATTCCTAGAGACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 294


>cbil|dbest|1166713 AA522061 vi08h03.r1 5' Lib=916[Mus_musculus||||C2C12|]
            Length=379 Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 379

  Plus Strand HSPs:

 Score = 627 (94.1 bits), Expect = 3.4e-22, P = 3.4e-22
 Identities = 195/271 (71%), Positives = 195/271 (71%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    39 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 98

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:    99 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 158

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   159 TAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGC 218

Query:   200 ACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGG 258
             ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG G
Sbjct:   219 ACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAG 277

Query:   259 ATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             A CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   278 ACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 309


>cbil|dbest|667230 AA051552 mj53g11.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=356
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 356

  Plus Strand HSPs:

 Score = 627 (94.1 bits), Expect = 3.7e-22, P = 3.7e-22
 Identities = 195/271 (71%), Positives = 195/271 (71%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    18 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 77

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:    78 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 137

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   138 TAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGC 197

Query:   200 ACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGG 258
             ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG G
Sbjct:   198 ACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAG 256

Query:   259 ATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             A CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   257 ACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 288


>cbil|dbest|1758255 AI019098 ub19b10.r1 5'
            Lib=544[Mus_musculus||Thymus|||4_weeks] Length=356 Author_cmt:
            WP:ZK652.3 CE00449 ;
            Length = 356

  Plus Strand HSPs:

 Score = 627 (94.1 bits), Expect = 3.7e-22, P = 3.7e-22
 Identities = 195/271 (71%), Positives = 195/271 (71%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    18 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 77

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:    78 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 137

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   138 TAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGC 197

Query:   200 ACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGG 258
             ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG G
Sbjct:   198 ACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAG 256

Query:   259 ATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             A CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   257 ACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 288


>cbil|dbest|609154 AA000900 mg24g03.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=331
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 331

  Plus Strand HSPs:

 Score = 627 (94.1 bits), Expect = 3.9e-22, P = 3.9e-22
 Identities = 195/271 (71%), Positives = 195/271 (71%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    27 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 86

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:    87 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 146

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   147 TAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGC 206

Query:   200 ACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGG 258
             ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG G
Sbjct:   207 ACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAG 265

Query:   259 ATCGTGTTGGTGGCCTG-T-G-ATATTCTTCTT 288
             A CG GTTGG  GC TG T G ATAT CTT TT
Sbjct:   266 ACCGAGTTGGAAGC-TGCTAGTATATGCTTGTT 297


>cbil|dbest|1661403 AA929519 vt40d01.r1 5'
            Lib=918[Mus_musculus|||||7_day_juvenile] Length=372 Author_cmt:
            WP:ZK652.3 CE00449 ;
            Length = 372

  Plus Strand HSPs:

 Score = 614 (92.1 bits), Expect = 1.4e-21, P = 1.4e-21
 Identities = 196/275 (71%), Positives = 196/275 (71%), Strand = Plus / Plus

Query:    17 CTACA-TGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCA 75
             C ACA T TC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CA
Sbjct:    46 CAACAATTTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACA 105

Query:    76 AAGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAG 135
             AAGT CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAG
Sbjct:   106 AAGTTCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAG 165

Query:   136 AATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATC 195
             AATT A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATC
Sbjct:   166 AATTTAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATC 225

Query:   196 CTCAACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCT 254
             CT  ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCT
Sbjct:   226 CTGCACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCT 284

Query:   255 AGGGATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             AG GA CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   285 AGAGACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 320


>cbil|dbest|677879 AA052239 mb91d05.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=374
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 374

  Plus Strand HSPs:

 Score = 612 (91.8 bits), Expect = 1.7e-21, P = 1.7e-21
 Identities = 192/268 (71%), Positives = 192/268 (71%), Strand = Plus / Plus

Query:    23 GTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTACT 82
             GTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT CT
Sbjct:     1 GTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGTTCT 60

Query:    83 AAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTCAG 142
              A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT A 
Sbjct:    61 CAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATTTAA 120

Query:   143 CGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAACA 202
              GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  ACA
Sbjct:   121 AGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGCACA 180

Query:   203 AACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGGATC 261
              AC GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG GA C
Sbjct:   181 GACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAGACC 239

Query:   262 GTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             G GTTGG  GC TG T ATAT T CTT TT
Sbjct:   240 GAGTTGGAAGC-TGCTAATATATGCTTGTT 268


>cbil|dbest|1139373 AA494696 fa10f04.r1 5'
            Lib=899[Danio_rerio||pooled_26-somite_embryos|||] Length=340
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 340

  Plus Strand HSPs:

 Score = 610 (91.5 bits), Expect = 2.2e-21, P = 2.2e-21
 Identities = 182/253 (71%), Positives = 182/253 (71%), Strand = Plus / Plus

Query:    19 ACATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAG 78
             A ATGTC AAA TA CGTTTAAAATCAC CT AC TC GA CC    TT CC T  AAAG
Sbjct:    17 AAATGTCGAAAGTAACGTTTAAAATCACGCTGACGTCGGACCCGCGGTTACCATATAAAG 76

Query:    79 TACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAAT 138
             TA TAA  GT C TGA A   CACCATT AC GC GT TTGAA TTTGC GC GAAGA T
Sbjct:    77 TATTAAGTGTTCATGAGAGCACACCATTCACAGCGGTTTTGAAATTTGCAGCAGAAGAGT 136

Query:   139 TCAGCGTACCAGCAGCGACA-AGCGCTATTATCACAGATGATGGGATCGGTATAAATCCT 197
             T A  GT CC GCAGC AC  AG G  AT AT ACA ATGATGG AT GG AT AATCC 
Sbjct:   137 TTAAAGTGCCTGCAGCTACCGAGTGTCATCATTACAAATGATGGCATTGGAATCAATCCG 196

Query:   198 CAACAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGG 257
             C  CA ACAGCAGG  A GTGTTT T AAACA GG TCAGA  T CGA T ATTCC AG 
Sbjct:   197 CG-CAGACAGCAGGAAATGTGTTTTTGAAACACGGCTCAGAACTACGAATCATTCCCAGA 255

Query:   258 GATCGTGTTGGTGG 271
             GATCG GTTGG GG
Sbjct:   256 GATCGGGTTGGAGG 269


>cbil|dbest|471067 N65065 20105  Lib=71[Arabidopsis_thaliana|||||]
            Length=452
            Length = 452

  Plus Strand HSPs:

 Score = 607 (91.1 bits), Expect = 2.3e-21, P = 2.3e-21
 Identities = 199/289 (68%), Positives = 199/289 (68%), Strand = Plus / Plus

Query:    15 GGCTACATGTCAAAAA-TATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTT 73
             GGC AC  GT  AAAA T TC TT AAA TCACTCT ACTTC GATCCTAA  T CCTTT
Sbjct:    63 GGCCACTGGTGGAAAAGTCTCCTTCAAAGTCACTCTGACTTCGGATCCTAAGCTTCCTTT 122

Query:    74 CAAAGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGA 133
             CAAAGT  T A  GT CC GAA   GC CC TT AC GC GT  TGAA TT GC GC GA
Sbjct:   123 CAAAGTTTTCAGCGTACCAGAAGGAGCTCCGTTCACGGCGGTTCTGAAATTCGCAGCAGA 182

Query:   134 AGAATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAA 193
             AGA TTCA  GT CC  CA   AC AGCGC AT ATCAC  ATGATGGGATCGG AT AA
Sbjct:   183 AGAGTTCAAGGTTCCTCCACAAACCAGCGCCATCATCACTAATGATGGGATCGGGATCAA 242

Query:   194 TCCTCAACAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCC 253
             TCCTCAACA A  GCAGG  A GT TTTCT AA CA GGATC GA  T  GATT AT C 
Sbjct:   243 TCCTCAACAGAGTGCAGGAAACGTTTTTCTGAAGCACGGATCTGAACTAAGATTGATCCG 302

Query:   254 TAGGGATCGTGTTGGTGGCCTGTGATATTCTTCTTTCCTTGTTTATTGTG 303
               G GAT G GTTGG G C TGTG T  T  T  T C T G T AT GTG
Sbjct:   303 GCGTGATAGAGTTGGAG-C-TGTGTTTGTGATGGTCCATAGATGAT-GTG 349


>cbil|dbest|685975 AA060235 mj72f08.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=262
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 262

  Plus Strand HSPs:

 Score = 611 (91.7 bits), Expect = 2.6e-21, P = 2.6e-21
 Identities = 185/258 (71%), Positives = 185/258 (71%), Strand = Plus / Plus

Query:    12 CGAGGCTAC-ATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCC 70
             CG G C AC ATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC
Sbjct:     4 CGGGTCCACCATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCC 63

Query:    71 TTTCAAAGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGC 130
              T CAAAGT CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGT TGC GC
Sbjct:    64 GTACAAAGTTCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTGTGCAGC 123

Query:   131 TGAAGAATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTAT 190
              GAAGAATT A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG AT
Sbjct:   124 AGAAGAATTGAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAAT 183

Query:   191 AAATCCTCAACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAA 249
             AAATCCT  ACA AC GC GG GAA GTGTT CT AA CA GG TCAGA  TG GA T A
Sbjct:   184 AAATCCTGCACAGACTGCTGG-GAATGTGTTCCTGAAGCACGGCTCAGAACTGAGAATCA 242

Query:   250 TTCCTAGGGATCGTGTTGG 268
             TTCCTAG GA CG GTTGG
Sbjct:   243 TTCCTAGAGACCGAGTTGG 261


>cbil|dbest|1436173 N38443 19670 3' Lib=71[Arabidopsis_thaliana|||||]
            Length=492
            Length = 492

  Plus Strand HSPs:

 Score = 604 (90.6 bits), Expect = 2.9e-21, P = 2.9e-21
 Identities = 188/267 (70%), Positives = 188/267 (70%), Strand = Plus / Plus

Query:    15 GGCTACATGTCAAAAA-TATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTT 73
             GGC AC  GT  AAAA T TC TT AAA TCACTCT ACTTC GATCCTAA  T CCTTT
Sbjct:    62 GGCCACTGGTGGAAAAGTCTCCTTCAAAGTCACTCTGACTTCGGATCCTAAGCTTCCTTT 121

Query:    74 CAAAGTACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGA 133
             CAAAGT  T A  GT CC GAA   GC CC TT AC GC GT  TGAA TT GC GC GA
Sbjct:   122 CAAAGTTTTCAGCGTACCAGAAGGAGCTCCGTTCACGGCGGTTCTGAAATTCGCAGCAGA 181

Query:   134 AGAATTCAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAA 193
             AGA TTCA  GT CC  CA   AC AGCGC AT ATCAC  ATGATGGGATCGG AT AA
Sbjct:   182 AGAGTTCAAGGTTCCTCCACAAACCAGCGCCATCATCACTAATGATGGGATCGGGATCAA 241

Query:   194 TCCTCAACAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCC 253
             TCCTCAACA A  GCAGG  A GT TTT T AA CA GGATC GA  T  GATT AT CC
Sbjct:   242 TCCTCAACAGAGTGCAGGAAACGTTTTTNTGAAGCACGGATCTGAACTAAGATTGATCCC 301

Query:   254 TAGGGATCGTGTTGGTGGCCTGTGATAT 281
               G GAT G GTTGG G C TGTG T T
Sbjct:   302 GCGTGATAGAGTTGGAG-C-TGTGTTTT 327


>cbil|dbest|814215 AA175235 ms83b01.r1 5'
            Lib=553[Mus_musculus||Spleen|||4_weeks] Length=332 Author_cmt:
            TR:E229320 E229320 ORF ;
            Length = 332

  Plus Strand HSPs:

 Score = 591 (88.7 bits), Expect = 1.7e-20, P = 1.7e-20
 Identities = 191/271 (70%), Positives = 191/271 (70%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    27 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 86

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:    87 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 146

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCA 199
              A  GT CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  
Sbjct:   147 TAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTGC 206

Query:   200 ACAAACAGCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGG 258
             ACA AC GC GG GAA GT TT CT AA CA GG TCAGA  TG G  T  TTC TA  G
Sbjct:   207 ACAGACTGCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGGATCTTTCTTATAG 265

Query:   259 ATCGTGTTGGTGGCCTG-TGATAT-T-CTTCTT 288
             A CG GTTGG  GC TG T ATAT T CTT TT
Sbjct:   266 ACCGAGTTGGAAGC-TGCTAATATATGCTTGTT 297


>cbil|dbest|1744959 AI006291 ua68d10.r1 5'
            Lib=544[Mus_musculus||Thymus|||4_weeks] Length=244 Author_cmt:
            WP:ZK652.3 CE00449 ;
            Length = 244

  Plus Strand HSPs:

 Score = 582 (87.3 bits), Expect = 5.8e-20, P = 5.8e-20
 Identities = 174/242 (71%), Positives = 174/242 (71%), Strand = Plus / Plus

Query:    27 AAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTACTAAAG 86
             AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT CT A  
Sbjct:     2 AAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGTTCTCAGT 61

Query:    87 GTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTCAGCGTA 146
             GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT A  GT 
Sbjct:    62 GTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATTTAAAGTT 121

Query:   147 CCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAACAAACA 206
             CC GCAGC ACAAG GC ATTAT AC  ATGATGG AT GG ATAAATCCT  ACA AC 
Sbjct:   122 CCTGCAGCTACAAGTGCGATTATTACTAATGATGGAATAGGAATAAATCCTTCACAGACT 181

Query:   207 GCAGGTGAA-GTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGGATCGTGT 265
             GC GG GAA GT TT CT AA CA GG TCAGA  TG GA T ATTCCTAG GA CG GT
Sbjct:   182 GCTGG-GAATGTTTTCCTGAAGCACGGCTCAGAACTGAGAATCATTCCTAGAGACCGAGT 240

Query:   266 TGG 268
             TGG
Sbjct:   241 TGG 243


>cbil|dbest|1716174 AA979720 MEST1-A2.EK1.Seq 5'
            Lib=1305[Zea_mays|green_seedlings|above_ground_tissues|||two-week-o
            ld_green_seedling] Length=585
            Length = 585

  Plus Strand HSPs:

 Score = 523 (78.5 bits), Expect = 1.1e-17, P = 1.1e-17
 Identities = 179/260 (68%), Positives = 179/260 (68%), Strand = Plus / Plus

Query:    27 AAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTACTAAAG 86
             AA  TATC TT AA ATCA  CT AC TC GA CC AA  T CCTTTCAAAGT  T A  
Sbjct:   116 AAGGTATCCTTCAAGATCATCCTCACCTCCGACCCCAAGCTCCCTTTCAAAGTGTTCAGC 175

Query:    87 GTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTCAGCGTA 146
             GT CC GA    GC CC TTTAC GC GT  T AAGT  GC GC GA GA TTCA  GT 
Sbjct:   176 GTGCCCGAGGCGGCGCCCTTTACCGCGGTGCTCAAGTACGCCGCGGAGGAGTTCAAGGTC 235

Query:   147 CCAGCAGC-GACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAACAAAC 205
             CC GC  C GAC AGCGC AT ATCAC  A GATGG AT GG AT AA CC CA CAAA 
Sbjct:   236 CC-GCCCCAGACCAGCGCCATCATCACCAACGATGGAATTGGCATCAACCCCCAGCAAAG 294

Query:   206 AGCAGGTGAAGTGTTTCTTAAACATGGATCAGACTTGCGATTAATTCCTAGGGATCGTGT 265
              GCAGG  A GTGTTTCT AAACATGG TC GA  TGCG  T AT CCT G GAT G GT
Sbjct:   295 TGCAGGCAACGTGTTTCTGAAACATGGTTCGGAGCTGCGTCTCATCCCTCGCGATAGAGT 354

Query:   266 TGGTGGCCTGTGAT-AT-TCTTC 286
             TGG G C TGT  T AT TCTTC
Sbjct:   355 TGGAG-C-TGTAGTCATGTCTTC 375


>cbil|dbest|1255222 C47815 C47815 5' Lib=162[Caenorhabditis_elegans|||||]
            Length=374
            Length = 374

  Plus Strand HSPs:

 Score = 461 (69.2 bits), Expect = 1.1e-14, P = 1.1e-14
 Identities = 195/308 (63%), Positives = 195/308 (63%), Strand = Plus / Plus

Query:    24 TCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTACTA 83
             TC AA  T  C TT AAAATCACTCTAAC    GATCC AA  T CC TTCAA GT CT 
Sbjct:    43 TCCAAGGTGACCTTCAAAATCACTCTAACAAGTGATCCGAAGCTCCCATTCAAGGTCCTC 102

Query:    84 AAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTCAGC 143
                GT CC GAAA T C CCATT AC GC GT  T AAGTTTGC GCTGAAGAATTCA  
Sbjct:   103 TCCGTGCCGGAAAGTACCCCATTCACCGCCGTTCTCAAGTTTGCCGCTGAAGAATTCAAG 162

Query:   144 GTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAACAA 203
             GT CC GC GC ACA   GC AT AT AC  A GA GG  T GG  T AATCC    CAA
Sbjct:   163 GTCCCTGCGGCTACATCAGCAATCATTACGAACGACGGAGTTGGCGTCAATCCAGCTCAA 222

Query:   204 ACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGA-CTTGCGATTAATTCCTAGGGATCG 262
              C GC GG  A  T TTT T AA CA GGA   GA CTT CG  T ATTCC  G GATCG
Sbjct:   223 CCTGCCGGAAACATTTTTTTGAAGCACGGAAGTGAACTT-CGTCTGATTCCACGTGATCG 281

Query:   263 TGTTGGTGGCCTGTG-ATATTCTTCTTTCCTTGTTTATTGTGGTCATTTTGTATGTCGTA 321
              GT GG     TG G ATA  C   TT   TTGT TA   T  TC T T  TATG C TA
Sbjct:   282 CGTCGGCCAT-TGAGCATAAGCCAATTG--TTGTCTACA-T--TCCTGTATTATGACATA 335

Query:   322 TCTGTTTTTA 331
               T TTTTTA
Sbjct:   336 ATTATTTTTA 345


>cbil|dbest|1252795 C45388 C45388 5' Lib=162[Caenorhabditis_elegans|||||]
            Length=360
            Length = 360

  Plus Strand HSPs:

 Score = 460 (69.0 bits), Expect = 1.3e-14, P = 1.3e-14
 Identities = 196/308 (63%), Positives = 196/308 (63%), Strand = Plus / Plus

Query:    24 TCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTACTA 83
             TC AA  T  C TT AAAATCACTCTAAC    GATCC AA  T CC TTCAA GT CT 
Sbjct:    15 TCCAAGGTGACCTTCAAAATCACTCTAACAAGTGATCCGAAGCTCCCATTCAAGGTCCTC 74

Query:    84 AAGGTCCCTGAAAA-TGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTCAG 142
                GT CC GAAAA T C CCATT AC GC GT  T AAGTTTGC GCTGAAGAATTCA 
Sbjct:    75 TCCGTGCCGGAAAAGTACCCCATTCACCGCCGTTCTCAAGTTTGCCGCTGAAGAATTCAA 134

Query:   143 CGTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAACA 202
              GT CC GC GC ACA   GC AT AT AC  A GA GG  T GG  T AATCC    CA
Sbjct:   135 GGTCCCTGCGGCTACATCAGCAATCATTACGAACGACGGAGTTGGCGTCAATCCAGCTCA 194

Query:   203 AACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGA-CTTGCGATTAATTCCTAGGGATC 261
             A C GC GG  A  T TTT T AA CA GGA   GA CTT CG  T ATTCC  G GATC
Sbjct:   195 ACCTGCCGGAAACATTTTTTTGAAGCACGGAAGTGAACTT-CGTCTGATTCCACGTGATC 253

Query:   262 GTGTTGGTGGCCTGTG-ATATTCTTCTTTCCTTGTTTATTGTGGTCATTTTGTATGTCGT 320
             G GT GG     TG G ATA  C   TT   TTGT TA   T  TC T T  TATG C T
Sbjct:   254 GCGTCGGCCAT-TGAGCATAAGCCAATTG--TTGTCTACA-T--TCCTGTATTATGACAT 307

Query:   321 ATCTGTTTTTA 331
             A  T TTTTTA
Sbjct:   308 AATTATTTTTA 318


>cbil|dbest|670134 C09652 C09652 5' Lib=162[Caenorhabditis_elegans|||||]
            Length=360
            Length = 360

  Plus Strand HSPs:

 Score = 458 (68.7 bits), Expect = 1.6e-14, P = 1.6e-14
 Identities = 194/308 (62%), Positives = 194/308 (62%), Strand = Plus / Plus

Query:    24 TCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTACTA 83
             TC AA  T  C TT AAAATCACTCTAAC    GATCC AA  T CC TTCAA GT CT 
Sbjct:    13 TCCAAGGTGACCTTCAAAATCACTCTAACAAGTGATCCGAAGCTCCCATTCAAGGTCCTC 72

Query:    84 AAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTCAGC 143
                GT CC GAAA T C CCATT AC GC GT  T AAGTTTG  GCTGAAGAATTCA  
Sbjct:    73 TCCGTGCCGGAAAGTACCCCATTCACCGCCGTTCTCAAGTTTGNCGCTGAAGAATTCAAG 132

Query:   144 GTACCAGCAGCGACAAGCGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAACAA 203
             GT CC GC GC ACA   GC AT AT AC  A GA GG  T GG  T AATCC    CAA
Sbjct:   133 GTCCCTGCGGCTACATCAGCAATCATTACGAACGACGGAGTTGGCGTCAATCCAGCTCAA 192

Query:   204 ACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGA-CTTGCGATTAATTCCTAGGGATCG 262
              C GC GG  A  T TTT T AA CA GGA   GA CTT CG  T ATTCC  G GATCG
Sbjct:   193 CCTGCCGGAAACATTTTTNTGAAGCACGGAAGTGAACTT-CGTCTGATTCCACGTGATCG 251

Query:   263 TGTTGGTGGCCTGTGA-TATTCTTCTTTCCTTGTTTATTGTGGTCATTTTGTATGTCGTA 321
              GT GG   C T TGA  AT    C  T  TTGT TA   T  TC T T  TATG C TA
Sbjct:   252 CGTCGGC--CAT-TGAGNATAAGCCAATTGTTGTCTACA-T--TCCTGTATTATGACATA 305

Query:   322 TCTGTTTTTA 331
               T TTTTTA
Sbjct:   306 ATTATTTTTA 315


>cbil|dbest|1148353 AA503723 ne50f09.s1 3' Lib=882[Homo_sapiens||colon|||]
            Length=228 Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 228

  Minus Strand HSPs:

 Score = 456 (68.4 bits), Expect = 3.0e-14, P = 3.0e-14
 Identities = 134/174 (77%), Positives = 134/174 (77%), Strand = Minus / Plus

Query:   287 AGAAGAATATCA-CAGGCCACCAACACGATCCCTAGGAATTAATC-GCAAGTCTGATCCA 230
             AG AGA TAT A CA  C  CCAACACGATC CTAGGAAT AATC GCA  TCTGA CCA
Sbjct:    55 AGCAGA-TATTAACAA-CTTCCAACACGATCTCTAGGAAT-AATCCGCAGTTCTGAACCA 111

Query:   229 TGTTTAAGAAACACTTCACCTGCTGTTTGTTGAGGATTTATACCGATCCCATCATCTGTG 170
             TGTTT AGAAA AC T  CC GC GT TGT  AGGATTTAT CC A  CCATCAT TG G
Sbjct:   112 TGTTTTAGAAAAACATTTCCAGCAGTCTGTGCAGGATTTATTCCTAATCCATCAT-TGGG 170

Query:   169 A-TAATAGCGCTTGTCGCTGCTGGTACGCTGAATTCTTCAGCAGCAAACTTCAAGAC 114
             A TAAT GC CTTGT GC GC GG AC  T AATTCTTC GC GCAAACTT AAGAC
Sbjct:   171 AATAATTGCACTTGTTGCAGCAGGAACTTTAAATTCTTCTGCTGCAAACTTTAAGAC 227


>cbil|dbest|654386 AA038729 mi93b11.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=304
            Author_cmt: WP:ZK652.3 CE00449 ;
            Length = 304

  Plus Strand HSPs:

 Score = 403 (60.5 bits), Expect = 5.6e-12, P = 5.6e-12
 Identities = 179/271 (66%), Positives = 179/271 (66%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             CATGTC AA  T TC TTTAAAATCAC  T AC TC GA CC     TGCC T CAAAGT
Sbjct:    25 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 84

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              CT A  GT CCTGAAA T C CC TT AC GC GT  T AAGTTTGC GC GAAGAATT
Sbjct:    85 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 144

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTATCACAGATGATG-GGA-TCGGTATAAATCCT 197
              A  GT CC GCAGC ACAAG GC ATTAT AC  ATG T  GGA TC    TAAA CCT
Sbjct:   145 TAAAGTTCCTGCAGCTACAAGTGCGATTATTACTAATGGTAAGGAGTCACCTTAAA-CCT 203

Query:   198 CAACAAACAGCAGGTGAAGTGTTTC--TTAAA-CATGGATCAGACT--TGCGATTAATT- 251
              AA  A   G AG   A G  TT    TTAAA C TG A CAGACT  TG GA T  TT 
Sbjct:   204 TAAGCACTTG-AGACCATGGATTAGGATTAAATCCTGCA-CAGACTGCTGGGAATGTTTT 261

Query:   252 CCT-AGGGATCGTGTTGGTGGCCTGTGATATTCTTCTT 288
             CCT A G A CG G T   G  CTG GA AT  TTC T
Sbjct:   262 CCTGAAGCA-CG-GCTCA-GAACTGAGA-ATCATTCCT 295


>cbil|dbest|811306 AA173018 mt02f11.r1 5'
            Lib=553[Mus_musculus||Spleen|||4_weeks] Length=177 Author_cmt:
            WP:ZK652.3 CE00449 ;
            Length = 177

  Plus Strand HSPs:

 Score = 354 (53.1 bits), Expect = 1.6e-09, P = 1.6e-09
 Identities = 106/150 (70%), Positives = 106/150 (70%), Strand = Plus / Plus

Query:    20 CATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGT 79
             |||||| ||  | || |||||||||||  | || || || ||     |||| | ||||||
Sbjct:    27 CATGTCGAAGGTGTCCTTTAAAATCACGTTGACGTCGGACCCGCGGCTGCCGTACAAAGT 86

Query:    80 ACTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATT 139
              || |  || ||||||| | | || || || || ||  | |||||||| || ||||||||
Sbjct:    87 TCTCAGTGTTCCTGAAAGTACGCCGTTCACAGCAGTGCTAAAGTTTGCAGCAGAAGAATT 146

Query:   140 CAGCGTACCAGCAGCGACAAGCGCTATTAT 169
              |  || || ||||| ||||| || || ||
Sbjct:   147 TAAAGTTCCTGCAGCTACAAGTGCGATAAT 176


>cbil|dbest|1243372 C35965 C35965 3' Lib=162[Caenorhabditis_elegans|||||]
            Length=300
            Length = 300

  Minus Strand HSPs:

 Score = 334 (50.1 bits), Expect = 7.4e-09, P = 7.4e-09
 Identities = 124/194 (63%), Positives = 124/194 (63%), Strand = Minus / Plus

Query:   268 CCAACACGATCCCTAGGAATTAATCGCAAGT-CTGATCCATGTTTAAGAAACACTTCACC 210
             CC AC CGATC C  GGAAT A  CG AAGT C   TCC TG TT A AAA A  T  CC
Sbjct:   107 CCGACNCGATCACGTGGAATCAGACG-AAGTTCACTTCCGTGCTTCAAAAAAATGTTTCC 165

Query:   209 TGCTGTTTGTTGAGGATTTATACCGATCCCATCATCTGTGATAATAGCGCTTGTCGCTGC 150
              GC G TTG    GGATT A  CC A  CC TC T  GT AT AT GC   TGT  C GC
Sbjct:   166 GGCAGGTTGAGCTGGATTGACGCCAACTCCGTCGTTCGTAATGATTGCTGATGTNNCCGC 225

Query:   149 TGGTACGCTGAATTCTTCAGCAGCAAACTTCAAGACAGCAGTAAATGGTGCATTTTCAGG 90
              GG AC  TGAATTCTTCA C GCAAACTT A  AC GC GT AATGG G A TTTC GG
Sbjct:   226 AGGGACCTTGAATTCTTCANCGGCAAACTTGANAACGGCGGTGAATGGGGTACTTTCCGG 285

Query:    89 GACCTTTAGTACTTT 75
              AC    AG AC TT
Sbjct:   286 CACGGAGAGGACCTT 300


>cbil|dbest|1240883 C34186 C34186 3' Lib=162[Caenorhabditis_elegans|||||]
            Length=300
            Length = 300

  Minus Strand HSPs:

 Score = 333 (50.0 bits), Expect = 8.3e-09, P = 8.3e-09
 Identities = 151/241 (62%), Positives = 151/241 (62%), Strand = Minus / Plus

Query:   331 TAAAAACAGATACGACATACAAAATGACCACAATAAACAAGGAAAGAAGAATA-TCACAG 273
             TAAAAA A  TA G CATA  A A GA  A   TA ACAA  A  G    AT  TCA  G
Sbjct:    65 TAAAAATAATTATGTCATAATACAGGA--ATG-TAGACAACAATTGGCTTATGCTCAATG 121

Query:   272 GCCACCAACACGATCCCTAGGAATTAATCGCAAGT-CTGATCCATGTTTAAGAAACACTT 214
             GCC    AC CGATC C  GGAAT A  CG AAGT C   TCC TG TT A AAA A  T
Sbjct:   122 GCCG---ACGCGATCACGTGGAATCAGACG-AAGTTCACTTCCGTGCTTCAAAAAAATGT 177

Query:   213 CACCTGCTGTTTGTTGAGGATTTATACCGATCCCATCATCTGTGATAATAGCGCTTGTCG 154
               CC GC G TTG    GGATT A  CC A  CC TC T  GT AT AT GC   TGT G
Sbjct:   178 TTCCGGCAGGTTGAGCTGGATTGACGCCAACTCCGTCGTTCGTAATGATTGCTGATGTAG 237

Query:   153 CTGCTGGTACGCTGAATTCTTCAGCAGCAAACTTCAAGACAGCAGTAAATGGTGCATTTT 94
             C GC GG AC  TGAATTCTTCAGC GCAAACTT A  AC GC GT AATGG G A TTT
Sbjct:   238 CCGCAGGGACCTTGAATTCTTCAGCGGCAAACTTGAGAACGGCGGTGAATGGGGTACTTT 297

Query:    93 CAG 91
             C G
Sbjct:   298 CCG 300


>cbil|dbest|168146 T97990 ye56b04.s1 3'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=259
            Length = 259

  Minus Strand HSPs:

 Score = 152 (22.8 bits), Expect = 1.6, P = 0.80
 Identities = 64/96 (66%), Positives = 64/96 (66%), Strand = Minus / Plus

Query:   108 TAAATGGTG-CATTTTCA--GGGACCTTTAGTACTTTGAAAGGCAAATTAGGATCTGAAG 52
             TAAATGG G CAT TTCA  GGGAC T  A  A TTTG   GG AAA T GG T   A G
Sbjct:   161 TAAATGGGGACATATTCAAGGGGACTTCAAAAAGTTTGTG-GGAAAAATGGGNTAAAAGG 219

Query:    51 TTAGAGTGATTTTAAACGATATTTTTGACATGTAGCCTC 13
              TA A   AT T AA C ATATTTTTGAC   TAGCC C
Sbjct:   220 ATAAAAA-ATAT-AANCTATATTTTTGACCNTTAGCCNC 256


>cbil|dbest|339925 D62701 HUM316G01B 5' Lib=313[Homo_sapiens|||||] Length=236
            Length = 236

  Plus Strand HSPs:

 Score = 149 (22.4 bits), Expect = 2.6, P = 0.93
 Identities = 67/99 (67%), Positives = 67/99 (67%), Strand = Plus / Plus

Query:     1 GGAATTCGGCACGAGGCTACATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATC 60
             GGAATTCGGCACGAGG TA AT TC  AAA AT  TTTA   TC CT TAA T  A AT 
Sbjct:     7 GGAATTCGGCACGAGGATAAATATCTGAAA-AT--TTTA---TC-CT-TAAGTATATATA 58

Query:    61 CTAATTTGCCTTTCAAA-GTACTAAAGGTCCCTGAAAATG 99
              T ATTTGCCT T A A GT  TAAAG T   T AA A G
Sbjct:    59 ATTATTTGCCTCTTATATGTCTTAAAGCTATTTAAACAAG 98


>cbil|dbest|443072 N41618 yw67d02.r1 5'
            Lib=368[Homo_sapiens|placenta||||two_placentae:_one_from_8_weeks_an
            d_another_from_9_weeks_post_conception] Length=432
            Length = 432

  Plus Strand HSPs:

 Score = 176 (26.4 bits), Expect = 4.4, P = 0.99
 Identities = 78/114 (68%), Positives = 78/114 (68%), Strand = Plus / Plus

Query:   223 TTAAACATGGATCAGACTTGCG-ATTAATTCCTAGGGATCGTGTTGGTGGCCTGTGATAT 281
             T AAACATGG TCAGA  TGCG ATTA TTCCTAG GATCGTGTTGG  G  TGT A AT
Sbjct:     1 TAAAACATGGTTCAGAACTGCGGATTA-TTCCTAGAGATCGTGTTGGAAGT-TGTTA-AT 57

Query:   282 -TCTTCTTTCCTTGTTTATT-G-TGGTCATTTTGTATGTCGTATCTGTTTTTATTTAT 336
              TCT CT  C T G   AT  G T G C TT  G AT    TAT  GT TTT TTT T
Sbjct:    58 ATCTGCTA-CTTGGAACATACGATTGCCTTTCAGAATAAA-TATTGGTATTTTTTTGT 113


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      339       339      10. 118 11 N/A 73   0.024 76
                                                  83   0.025 108
   -1      0      339       339      10. 118 11 N/A 73   0.024 76
                                                  83   0.025 108


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  /usr/local/db/others/blast/dbEST
    Release date:  unknown
    Posted date:  10:29 AM EDT Sep 6, 1998
    Format:  BLAST
  # of letters in database:  680,019,941
  # of sequences in database:  1,803,623
  # of database sequences satisfying E:  34
  No. of states in DFA:  224 (224 KB)
  Total size of DFA:  233 KB (256 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  19.51u 2.15s 21.66t  Elapsed: 00:00:04
  Total cpu time:  19.59u 10.91s 30.50t  Elapsed: 00:00:13
  Start:  Sat Sep 26 12:05:22 1998   End:  Sat Sep 26 12:05:35 1998

Date: 14:53:13 on Sun 17 Dec 117.