blastn_dbest_files/1366792_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  1366792
        (205 letters)

Database:  dbEST
           1,352,941 sequences; 500,351,318 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|1366792 AA661286 MB3D6V5B04T3 5' Lib=953[Brugi...  1025  4.9e-40   1
A cbil|dbest|1084799 AA440502 LD13759.5prime 5' Lib=594[Dro...   717  1.2e-26   1
A cbil|dbest|1031655 AA390305 LD03003.5prime 5' Lib=594[Dro...   717  1.4e-26   1
A cbil|dbest|1185695 AA539195 LD18853.5prime 5' Lib=594[Dro...   717  1.4e-26   1
A cbil|dbest|1085937 AA441643 LD16642.5prime 5' Lib=594[Dro...   717  1.5e-26   1
A cbil|dbest|1186982 AA540934 LD20127.5prime 5' Lib=594[Dro...   717  1.6e-26   1
A cbil|dbest|1031665 AA390297 LD03020.5prime 5' Lib=594[Dro...   716  1.8e-26   1
A cbil|dbest|885852 AA246515 LD05452.5prime 5' Lib=594[Dro...   717  2.1e-26   1
A cbil|dbest|780444 AA141585 CK02035.3prime 3' Lib=559[Dro...   710  2.8e-26   1
A cbil|dbest|1404553 AA697969 HL03544.5prime 5prime Lib=105...   717  2.9e-26   1
A cbil|dbest|1401970 AA695695 GM04310.5prime 5prime Lib=105...   707  5.7e-26   1
A cbil|dbest|905976 AA264460 LD08979.5prime 5' Lib=594[Dro...   661  4.7e-24   1
A cbil|dbest|1186010 AA539962 LD19272.5prime 5' Lib=594[Dro...   661  5.7e-24   1
A cbil|dbest|1185586 AA539015 LD18713.5prime 5' Lib=594[Dro...   656  7.2e-24   1
A cbil|dbest|1084643 AA440091 LD15172.5prime 5' Lib=594[Dro...   661  7.4e-24   1
A cbil|dbest|1186751 AA540703 LD20479.5prime 5' Lib=594[Dro...   654  1.1e-23   1
A cbil|dbest|1077558 AA433264 EST78 5' Lib=874[Drosophila_m...   639  6.5e-23   1
A cbil|dbest|1262367 AA586151 28800 3' Lib=71[Arabidopsis_t...   634  1.5e-22   1
A cbil|dbest|21235 T04420 467  Lib=71[Arabidopsi...   623  5.1e-22   1
A cbil|dbest|1077513 AA433219 EST33 5' Lib=874[Drosophila_m...   616  1.5e-21   1
A cbil|dbest|779885 AA140871 CK01090.5prime 5' Lib=559[Dro...   496  1.6e-16   1
A cbil|dbest|1077481 AA433202 EST1 5' Lib=874[Drosophila_me...   498  3.4e-16   1
A cbil|dbest|1111259 AA466760 vf02e01.r1 5' Lib=875[Mus_mus...   442  1.1e-13   1
A cbil|dbest|1402932 AA696657 GM08077.5prime 5prime Lib=105...   422  5.2e-13   1
A cbil|dbest|1193781 AA547789 EST188698 5' Lib=955[Biomphal...   408  2.6e-12   1
A cbil|dbest|1193775 AA547783 EST188692 5' Lib=955[Biomphal...   403  3.8e-12   1
A cbil|dbest|1330864 C77125 C77125 3' Lib=1021[Mus_musculus...   388  1.0e-11   1
A cbil|dbest|1193753 AA547761 EST188670 5' Lib=954[Biomphal...   397  1.2e-11   1
A cbil|dbest|1331941 C78202 C78202 3' Lib=1021[Mus_musculus...   385  1.4e-11   1
A cbil|dbest|1331635 C77896 C77896 3' Lib=1021[Mus_musculus...   384  1.5e-11   1
A cbil|dbest|1193773 AA547781 EST188690 3' Lib=955[Biomphal...   392  1.8e-11   1
A cbil|dbest|1335309 C81570 C81570 3' Lib=1021[Mus_musculus...   385  1.8e-11   1
A cbil|dbest|1327650 C76371 C76371 3' Lib=1021[Mus_musculus...   379  2.2e-11   1
A cbil|dbest|1334833 C81094 C81094 3' Lib=1021[Mus_musculus...   381  2.3e-11   1
A cbil|dbest|1327724 C76445 C76445 3' Lib=1021[Mus_musculus...   379  2.4e-11   1
A cbil|dbest|1327372 C76093 C76093 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1330744 C77005 C77005 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1333620 C79881 C79881 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1332633 C78894 C78894 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1327226 C75947 C75947 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1333040 C79301 C79301 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1327348 C76069 C76069 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1332114 C78375 C78375 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1332290 C78551 C78551 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1332535 C78796 C78796 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1332779 C79040 C79040 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1331154 C77415 C77415 3' Lib=1021[Mus_musculus...   379  2.5e-11   1
A cbil|dbest|1333964 C80225 C80225 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1327384 C76105 C76105 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331368 C77629 C77629 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331667 C77928 C77928 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1333588 C79849 C79849 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1330513 C76774 C76774 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1330872 C77133 C77133 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1327283 C76004 C76004 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334588 C80849 C80849 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1330599 C76860 C76860 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1335203 C81464 C81464 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1332855 C79116 C79116 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1332181 C78442 C78442 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1332826 C79087 C79087 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1333812 C80073 C80073 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334521 C80782 C80782 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334873 C81134 C81134 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334902 C81163 C81163 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334914 C81175 C81175 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1330411 C76672 C76672 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334307 C80568 C80568 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331879 C78140 C78140 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331539 C77800 C77800 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334603 C80864 C80864 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1335003 C81264 C81264 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331754 C78015 C78015 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331910 C78171 C78171 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1332068 C78329 C78329 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334826 C81087 C81087 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331773 C78034 C78034 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1332955 C79216 C79216 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331670 C77931 C77931 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334724 C80985 C80985 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1330653 C76914 C76914 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1331592 C77853 C77853 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1333474 C79735 C79735 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334910 C81171 C81171 3' Lib=1021[Mus_musculus...   379  2.6e-11   1
A cbil|dbest|1334129 C80390 C80390 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1327523 C76244 C76244 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1335356 C81617 C81617 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1331747 C78008 C78008 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1331708 C77969 C77969 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1327701 C76422 C76422 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1330548 C76809 C76809 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1332125 C78386 C78386 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1334532 C80793 C80793 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1334957 C81218 C81218 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1330287 C76548 C76548 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1333797 C80058 C80058 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1331516 C77777 C77777 3' Lib=1021[Mus_musculus...   379  2.7e-11   1
A cbil|dbest|1330550 C76811 C76811 3' Lib=1021[Mus_musculus...   379  2.8e-11   1
A cbil|dbest|1330816 C77077 C77077 3' Lib=1021[Mus_musculus...   379  2.8e-11   1
A cbil|dbest|1331733 C77994 C77994 3' Lib=1021[Mus_musculus...   379  2.8e-11   1
A cbil|dbest|1333329 C79590 C79590 3' Lib=1021[Mus_musculus...   379  2.8e-11   1
A cbil|dbest|1331468 C77729 C77729 3' Lib=1021[Mus_musculus...   379  2.8e-11   1
A cbil|dbest|1330587 C76848 C76848 3' Lib=1021[Mus_musculus...   379  2.8e-11   1
A cbil|dbest|1333406 C79667 C79667 3' Lib=1021[Mus_musculus...   379  2.8e-11   1
A cbil|dbest|1331499 C77760 C77760 3' Lib=1021[Mus_musculus...   379  2.8e-11   1
A cbil|dbest|1333115 C79376 C79376 3' Lib=1021[Mus_musculus...   379  2.9e-11   1
A cbil|dbest|1331577 C77838 C77838 3' Lib=1021[Mus_musculus...   379  3.0e-11   1
A cbil|dbest|1330678 C76939 C76939 3' Lib=1021[Mus_musculus...   379  3.0e-11   1
A cbil|dbest|1331920 C78181 C78181 3' Lib=1021[Mus_musculus...   379  3.0e-11   1
A cbil|dbest|1330740 C77001 C77001 3' Lib=1021[Mus_musculus...   379  3.0e-11   1
A cbil|dbest|1333500 C79761 C79761 3' Lib=1021[Mus_musculus...   379  3.0e-11   1
A cbil|dbest|1332099 C78360 C78360 3' Lib=1021[Mus_musculus...   379  3.1e-11   1
A cbil|dbest|1330670 C76931 C76931 3' Lib=1021[Mus_musculus...   379  3.2e-11   1
A cbil|dbest|1327316 C76037 C76037 3' Lib=1021[Mus_musculus...   377  3.2e-11   1
A cbil|dbest|1331337 C77598 C77598 3' Lib=1021[Mus_musculus...   379  3.3e-11   1
A cbil|dbest|1332243 C78504 C78504 3' Lib=1021[Mus_musculus...   379  3.3e-11   1
A cbil|dbest|344944 R95515 SMNHADA018026SK 5' Lib=323[Schi...   381  3.3e-11   1
A cbil|dbest|1330286 C76547 C76547 3' Lib=1021[Mus_musculus...   379  3.3e-11   1
A cbil|dbest|1330894 C77155 C77155 3' Lib=1021[Mus_musculus...   379  3.4e-11   1
A cbil|dbest|1331809 C78070 C78070 3' Lib=1021[Mus_musculus...   379  3.4e-11   1
A cbil|dbest|1330888 C77149 C77149 3' Lib=1021[Mus_musculus...   379  3.4e-11   1
A cbil|dbest|1333237 C79498 C79498 3' Lib=1021[Mus_musculus...   379  3.4e-11   1
A cbil|dbest|1327496 C76217 C76217 3' Lib=1021[Mus_musculus...   379  3.5e-11   1
A cbil|dbest|1334195 C80456 C80456 3' Lib=1021[Mus_musculus...   379  3.5e-11   1
A cbil|dbest|1334243 C80504 C80504 3' Lib=1021[Mus_musculus...   376  3.6e-11   1
A cbil|dbest|1333915 C80176 C80176 3' Lib=1021[Mus_musculus...   376  3.6e-11   1
A cbil|dbest|1333105 C79366 C79366 3' Lib=1021[Mus_musculus...   376  3.6e-11   1
A cbil|dbest|1333701 C79962 C79962 3' Lib=1021[Mus_musculus...   379  3.7e-11   1
A cbil|dbest|1330624 C76885 C76885 3' Lib=1021[Mus_musculus...   379  3.8e-11   1
A cbil|dbest|1334066 C80327 C80327 3' Lib=1021[Mus_musculus...   379  4.2e-11   1
A cbil|dbest|1334515 C80776 C80776 3' Lib=1021[Mus_musculus...   379  4.2e-11   1
A cbil|dbest|1053227 AA408192 EST02857 3' Lib=856[Mus_muscu...   379  4.3e-11   1
A cbil|dbest|1334553 C80814 C80814 3' Lib=1021[Mus_musculus...   379  4.3e-11   1
A cbil|dbest|1330364 C76625 C76625 3' Lib=1021[Mus_musculus...   373  4.5e-11   1
A cbil|dbest|1334998 C81259 C81259 3' Lib=1021[Mus_musculus...   379  4.6e-11   1
A cbil|dbest|1335349 C81610 C81610 3' Lib=1021[Mus_musculus...   379  4.9e-11   1
A cbil|dbest|1335357 C81618 C81618 3' Lib=1021[Mus_musculus...   379  4.9e-11   1
A cbil|dbest|1333993 C80254 C80254 3' Lib=1021[Mus_musculus...   373  4.9e-11   1
A cbil|dbest|1331784 C78045 C78045 3' Lib=1021[Mus_musculus...   374  4.9e-11   1
A cbil|dbest|1333667 C79928 C79928 3' Lib=1021[Mus_musculus...   372  5.2e-11   1
A cbil|dbest|1332498 C78759 C78759 3' Lib=1021[Mus_musculus...   372  5.3e-11   1
A cbil|dbest|1330511 C76772 C76772 3' Lib=1021[Mus_musculus...   372  5.3e-11   1
A cbil|dbest|1327678 C76399 C76399 3' Lib=1021[Mus_musculus...   372  5.4e-11   1
A cbil|dbest|1330470 C76731 C76731 3' Lib=1021[Mus_musculus...   372  5.4e-11   1
A cbil|dbest|1334397 C80658 C80658 3' Lib=1021[Mus_musculus...   379  5.4e-11   1
A cbil|dbest|1334085 C80346 C80346 3' Lib=1021[Mus_musculus...   374  5.4e-11   1
A cbil|dbest|1331073 C77334 C77334 3' Lib=1021[Mus_musculus...   372  5.5e-11   1
A cbil|dbest|1334674 C80935 C80935 3' Lib=1021[Mus_musculus...   379  5.7e-11   1
A cbil|dbest|1334319 C80580 C80580 3' Lib=1021[Mus_musculus...   379  5.7e-11   1
A cbil|dbest|1332505 C78766 C78766 3' Lib=1021[Mus_musculus...   372  5.8e-11   1
A cbil|dbest|1331238 C77499 C77499 3' Lib=1021[Mus_musculus...   379  5.8e-11   1
A cbil|dbest|1332608 C78869 C78869 3' Lib=1021[Mus_musculus...   373  5.9e-11   1
A cbil|dbest|1331914 C78175 C78175 3' Lib=1021[Mus_musculus...   379  6.1e-11   1
A cbil|dbest|1333802 C80063 C80063 3' Lib=1021[Mus_musculus...   372  6.4e-11   1
A cbil|dbest|1332483 C78744 C78744 3' Lib=1021[Mus_musculus...   373  6.4e-11   1
A cbil|dbest|1332418 C78679 C78679 3' Lib=1021[Mus_musculus...   372  6.8e-11   1
A cbil|dbest|1331680 C77941 C77941 3' Lib=1021[Mus_musculus...   369  7.1e-11   1
A cbil|dbest|1333679 C79940 C79940 3' Lib=1021[Mus_musculus...   372  7.2e-11   1
A cbil|dbest|1333520 C79781 C79781 3' Lib=1021[Mus_musculus...   369  7.6e-11   1
A cbil|dbest|1335158 C81419 C81419 3' Lib=1021[Mus_musculus...   370  8.0e-11   1
A cbil|dbest|1330588 C76849 C76849 3' Lib=1021[Mus_musculus...   372  8.4e-11   1
A cbil|dbest|1331993 C78254 C78254 3' Lib=1021[Mus_musculus...   367  8.8e-11   1
A cbil|dbest|1389905 AA683770 vr02g05.r1 5' Lib=875[Mus_mus...   370  9.1e-11   1
A cbil|dbest|1331285 C77546 C77546 3' Lib=1021[Mus_musculus...   366  9.2e-11   1
A cbil|dbest|1144519 AA499889 vj40h12.r1 5' Lib=498[Mus_mus...   369  9.6e-11   1
A cbil|dbest|1330512 C76773 C76773 3' Lib=1021[Mus_musculus...   366  9.9e-11   1
A cbil|dbest|1327616 C76337 C76337 3' Lib=1021[Mus_musculus...   370  1.0e-10   1
A cbil|dbest|1327622 C76343 C76343 3' Lib=1021[Mus_musculus...   365  1.1e-10   1
A cbil|dbest|1334824 C81085 C81085 3' Lib=1021[Mus_musculus...   365  1.1e-10   1
A cbil|dbest|1332037 C78298 C78298 3' Lib=1021[Mus_musculus...   369  1.2e-10   1
A cbil|dbest|344870 R95556 SMNHADA007066SK 5' Lib=323[Schi...   370  1.2e-10   1
A cbil|dbest|909536 AA268547 va05g12.r1 5' Lib=567[Mus_mus...   373  1.2e-10   1
A cbil|dbest|1330472 C76733 C76733 3' Lib=1021[Mus_musculus...   365  1.2e-10   1
A cbil|dbest|1175328 AA530688 vj50b02.r1 5' Lib=509[Mus_mus...   364  1.3e-10   1
A cbil|dbest|1327428 C76149 C76149 3' Lib=1021[Mus_musculus...   364  1.3e-10   1
A cbil|dbest|1331590 C77851 C77851 3' Lib=1021[Mus_musculus...   368  1.6e-10   1
A cbil|dbest|1332518 C78779 C78779 3' Lib=1021[Mus_musculus...   367  1.6e-10   1
A cbil|dbest|1327301 C76022 C76022 3' Lib=1021[Mus_musculus...   360  1.9e-10   1
A cbil|dbest|1332887 C79148 C79148 3' Lib=1021[Mus_musculus...   365  1.9e-10   1
A cbil|dbest|1327426 C76147 C76147 3' Lib=1021[Mus_musculus...   358  2.1e-10   1
A cbil|dbest|1205967 AA555599 ZF-E274 5' Lib=356[Danio_reri...   368  2.2e-10   1
A cbil|dbest|1334749 C81010 C81010 3' Lib=1021[Mus_musculus...   363  2.3e-10   1
A cbil|dbest|1327539 C76260 C76260 3' Lib=1021[Mus_musculus...   358  2.6e-10   1
A cbil|dbest|1330535 C76796 C76796 3' Lib=1021[Mus_musculus...   364  3.0e-10   1
A cbil|dbest|1331156 C77417 C77417 3' Lib=1021[Mus_musculus...   359  3.1e-10   1
A cbil|dbest|1050741 F22569 HSPD07403  Lib=852[Hom...   357  3.5e-10   1
A cbil|dbest|724171 AA087873 mn97b10.r1 5' Lib=526[Mus_mus...   364  3.6e-10   1
A cbil|dbest|1334788 C81049 C81049 3' Lib=1021[Mus_musculus...   354  3.8e-10   1
A cbil|dbest|1327449 C76170 C76170 3' Lib=1021[Mus_musculus...   355  3.8e-10   1
A cbil|dbest|1048844 F20672 HSPD05050  Lib=852[Hom...   357  4.4e-10   1
A cbil|dbest|1331436 C77697 C77697 3' Lib=1021[Mus_musculus...   359  4.9e-10   1
A cbil|dbest|1049453 F21281 HSPD05773  Lib=852[Hom...   354  5.5e-10   1
A cbil|dbest|1048630 F20458 HSPD04801  Lib=852[Hom...   351  6.0e-10   1
A cbil|dbest|1332146 C78407 C78407 3' Lib=1021[Mus_musculus...   357  6.2e-10   1
A cbil|dbest|1050786 F22614 HSPD07455  Lib=852[Hom...   350  6.2e-10   1
A cbil|dbest|739190 AA100034 zn37c11.s1 3' Lib=523[Homo_sa...   348  6.8e-10   1
A cbil|dbest|1277555 Z98526 HSZ98526  Lib=1003[Hom...   350  7.4e-10   1
A cbil|dbest|1050840 F22668 HSPD07524  Lib=852[Hom...   348  7.4e-10   1
A cbil|dbest|725193 AA088843 zl90b01.s1 3' Lib=486[Homo_sa...   348  7.5e-10   1
A cbil|dbest|1049957 F21785 HSPD06377  Lib=852[Hom...   351  7.6e-10   1
A cbil|dbest|863246 AA223928 zr13b11.s1 3' Lib=525[Homo_sa...   348  7.6e-10   1
A cbil|dbest|1050331 F22159 HSPD06822  Lib=852[Hom...   351  7.7e-10   1
A cbil|dbest|718439 AA083209 zn31d08.s1 3' Lib=523[Homo_sa...   348  7.7e-10   1
A cbil|dbest|860313 AA220989 zr01e08.r1 5' Lib=536[Homo_sa...   348  7.7e-10   1
A cbil|dbest|1177962 AA533479 nj72b08.s1  Lib=926[...   348  7.9e-10   1
A cbil|dbest|1050633 F22461 HSPD07276  Lib=852[Hom...   351  8.0e-10   1
A cbil|dbest|736746 AA099002 zn45e03.s1 3' Lib=527[Homo_sa...   348  8.0e-10   1
A cbil|dbest|1048713 F20541 HSPD04896  Lib=852[Hom...   348  8.2e-10   1
A cbil|dbest|1048989 F20817 HSPD05223  Lib=852[Hom...   348  8.2e-10   1
A cbil|dbest|1048866 F20694 HSPD05078  Lib=852[Hom...   348  8.3e-10   1
A cbil|dbest|1048995 F20823 HSPD05229  Lib=852[Hom...   348  8.3e-10   1
A cbil|dbest|1112229 AA469432 nc74a02.s1  Lib=574[...   348  8.3e-10   1
A cbil|dbest|1048773 F20601 HSPD04973  Lib=852[Hom...   348  8.5e-10   1
A cbil|dbest|1050755 F22583 HSPD07420  Lib=852[Hom...   348  8.5e-10   1
A cbil|dbest|1050972 F22800 HSPD07710  Lib=852[Hom...   348  8.7e-10   1
A cbil|dbest|1048742 F20570 HSPD04939  Lib=852[Hom...   348  8.7e-10   1
A cbil|dbest|1048859 F20687 HSPD05071  Lib=852[Hom...   348  8.7e-10   1
A cbil|dbest|1048820 F20648 HSPD05023  Lib=852[Hom...   348  8.8e-10   1
A cbil|dbest|1048388 F20216 HSPD04392  Lib=852[Hom...   348  8.8e-10   1
A cbil|dbest|760292 AA121390 zn77g03.s1 3' Lib=536[Homo_sa...   348  9.0e-10   1
A cbil|dbest|1048677 F20505 HSPD04853  Lib=852[Hom...   348  9.0e-10   1
A cbil|dbest|739978 AA101363 zn71f10.s1 3' Lib=536[Homo_sa...   348  9.1e-10   1
A cbil|dbest|1049782 F21610 HSPD06191  Lib=852[Hom...   348  9.1e-10   1
A cbil|dbest|1049029 F20857 HSPD05268  Lib=852[Hom...   350  9.2e-10   1
A cbil|dbest|844511 AA206551 zq57f05.s1 3' Lib=502[Homo_sa...   348  9.3e-10   1
A cbil|dbest|1048641 F20469 HSPD04813  Lib=852[Hom...   348  9.3e-10   1
A cbil|dbest|1050534 F22362 HSPD07077  Lib=852[Hom...   348  9.3e-10   1
A cbil|dbest|1049047 F20875 HSPD05292  Lib=852[Hom...   348  9.4e-10   1
A cbil|dbest|831974 AA192935 zq13c01.s1 3' Lib=530[Homo_sa...   349  9.4e-10   1
A cbil|dbest|1050948 F22776 HSPD07679  Lib=852[Hom...   348  9.4e-10   1
A cbil|dbest|818185 AA179180 zp46a12.r1 5' Lib=527[Homo_sa...   348  9.4e-10   1
A cbil|dbest|1050541 F22369 HSPD07086  Lib=852[Hom...   348  9.4e-10   1
A cbil|dbest|1127837 AA483060 ne71d04.s1  Lib=883[...   350  9.4e-10   1
A cbil|dbest|1050299 F22127 HSPD06790  Lib=852[Hom...   348  9.5e-10   1
A cbil|dbest|1049250 F21078 HSPD05546  Lib=852[Hom...   348  9.5e-10   1
A cbil|dbest|1113921 AA469385 nc68f06.r1  Lib=573[...   348  9.5e-10   1
A cbil|dbest|721958 AA086245 zn60f04.s1 3' Lib=530[Homo_sa...   348  9.5e-10   1
A cbil|dbest|1049568 F21396 HSPD05921  Lib=852[Hom...   348  9.6e-10   1
A cbil|dbest|1049783 F21611 HSPD06192  Lib=852[Hom...   348  9.6e-10   1
A cbil|dbest|1050296 F22124 HSPD06787  Lib=852[Hom...   348  9.8e-10   1
A cbil|dbest|1113814 AA469278 nc68c01.s1  Lib=573[...   348  9.8e-10   1
A cbil|dbest|1048978 F20806 HSPD05212  Lib=852[Hom...   348  9.9e-10   1
A cbil|dbest|1048645 F20473 HSPD04817  Lib=852[Hom...   348  9.9e-10   1
A cbil|dbest|1050062 F21890 HSPD06486  Lib=852[Hom...   348  1.0e-09   1
A cbil|dbest|1049541 F21369 HSPD05887  Lib=852[Hom...   348  1.0e-09   1
A cbil|dbest|1050029 F21857 HSPD06452  Lib=852[Hom...   348  1.0e-09   1
A cbil|dbest|724516 AA088914 zl69b12.s1 3' Lib=486[Homo_sa...   348  1.0e-09   1
A cbil|dbest|1113687 AA469151 nc67e08.s1  Lib=573[...   348  1.0e-09   1
A cbil|dbest|1050025 F21853 HSPD06448  Lib=852[Hom...   348  1.0e-09   1
A cbil|dbest|1049859 F21687 HSPD06273  Lib=852[Hom...   348  1.0e-09   1


WARNING:  Descriptions of 384 database sequences were not reported due to the
          limiting value of parameter V = 250.



>cbil|dbest|1366792 AA661286 MB3D6V5B04T3 5'
            Lib=953[Brugia_malayi|||||third_stage_larvae,_six_days_after_infect
            ion] Length=205
            Length = 205

  Plus Strand HSPs:

 Score = 1025 (153.8 bits), Expect = 4.9e-40, P = 4.9e-40
 Identities = 205/205 (100%), Positives = 205/205 (100%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTATC 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTATC 120

Query:   121 CTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTAAT 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 CTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTAAT 180

Query:   181 AATATGATTAATATTAATATTAGAT 205
             |||||||||||||||||||||||||
Sbjct:   181 AATATGATTAATATTAATATTAGAT 205


>cbil|dbest|1084799 AA440502 LD13759.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=708
            Length = 708

  Minus Strand HSPs:

 Score = 717 (107.6 bits), Expect = 1.2e-26, P = 1.2e-26
 Identities = 171/204 (83%), Positives = 171/204 (83%), Strand = Minus / Plus

Query:   204 TCTAATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGT 145
             T T ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGT
Sbjct:    13 TTTTATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGT 71

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACTA AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTC
Sbjct:    72 ACTAAAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTC 131

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAA 25
             AGATCATGTAAGAATT AAA GTCGAACAGAC TAAA TTT AAC  CTACACC AAAA 
Sbjct:   132 AGATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAAT 191

Query:    24 TAACTCTTAATCCAACATCGAGGT 1
             TA  TCTTAATCCAACATCGAGGT
Sbjct:   192 TATATCTTAATCCAACATCGAGGT 215


>cbil|dbest|1031655 AA390305 LD03003.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=586
            Length = 586

  Minus Strand HSPs:

 Score = 717 (107.6 bits), Expect = 1.4e-26, P = 1.4e-26
 Identities = 171/204 (83%), Positives = 171/204 (83%), Strand = Minus / Plus

Query:   204 TCTAATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGT 145
             T T ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGT
Sbjct:    18 TTTTATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGT 76

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACTA AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTC
Sbjct:    77 ACTAAAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTC 136

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAA 25
             AGATCATGTAAGAATT AAA GTCGAACAGAC TAAA TTT AAC  CTACACC AAAA 
Sbjct:   137 AGATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAAT 196

Query:    24 TAACTCTTAATCCAACATCGAGGT 1
             TA  TCTTAATCCAACATCGAGGT
Sbjct:   197 TATATCTTAATCCAACATCGAGGT 220


>cbil|dbest|1185695 AA539195 LD18853.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=578
            Length = 578

  Minus Strand HSPs:

 Score = 717 (107.6 bits), Expect = 1.4e-26, P = 1.4e-26
 Identities = 171/204 (83%), Positives = 171/204 (83%), Strand = Minus / Plus

Query:   204 TCTAATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGT 145
             T T ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGT
Sbjct:    20 TTTTATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGT 78

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACTA AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTC
Sbjct:    79 ACTAAAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTC 138

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAA 25
             AGATCATGTAAGAATT AAA GTCGAACAGAC TAAA TTT AAC  CTACACC AAAA 
Sbjct:   139 AGATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAAT 198

Query:    24 TAACTCTTAATCCAACATCGAGGT 1
             TA  TCTTAATCCAACATCGAGGT
Sbjct:   199 TATATCTTAATCCAACATCGAGGT 222


>cbil|dbest|1085937 AA441643 LD16642.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=548
            Length = 548

  Minus Strand HSPs:

 Score = 717 (107.6 bits), Expect = 1.5e-26, P = 1.5e-26
 Identities = 171/204 (83%), Positives = 171/204 (83%), Strand = Minus / Plus

Query:   204 TCTAATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGT 145
             T T ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGT
Sbjct:    18 TTTTATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGT 76

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACTA AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTC
Sbjct:    77 ACTAAAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTC 136

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAA 25
             AGATCATGTAAGAATT AAA GTCGAACAGAC TAAA TTT AAC  CTACACC AAAA 
Sbjct:   137 AGATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAAT 196

Query:    24 TAACTCTTAATCCAACATCGAGGT 1
             TA  TCTTAATCCAACATCGAGGT
Sbjct:   197 TATATCTTAATCCAACATCGAGGT 220


>cbil|dbest|1186982 AA540934 LD20127.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=530
            Length = 530

  Minus Strand HSPs:

 Score = 717 (107.6 bits), Expect = 1.6e-26, P = 1.6e-26
 Identities = 171/204 (83%), Positives = 171/204 (83%), Strand = Minus / Plus

Query:   204 TCTAATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGT 145
             T T ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGT
Sbjct:    35 TTTTATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGT 93

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACTA AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTC
Sbjct:    94 ACTAAAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTC 153

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAA 25
             AGATCATGTAAGAATT AAA GTCGAACAGAC TAAA TTT AAC  CTACACC AAAA 
Sbjct:   154 AGATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAAT 213

Query:    24 TAACTCTTAATCCAACATCGAGGT 1
             TA  TCTTAATCCAACATCGAGGT
Sbjct:   214 TATATCTTAATCCAACATCGAGGT 237


>cbil|dbest|1031665 AA390297 LD03020.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=522
            Length = 522

  Minus Strand HSPs:

 Score = 716 (107.4 bits), Expect = 1.8e-26, P = 1.8e-26
 Identities = 170/202 (84%), Positives = 170/202 (84%), Strand = Minus / Plus

Query:   202 TAATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTAC 143
             T ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGTAC
Sbjct:     1 TTATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGTAC 59

Query:   142 TATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAG 83
             TA AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTCAG
Sbjct:    60 TAAAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTCAG 119

Query:    82 ATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAATA 23
             ATCATGTAAGAATT AAA GTCGAACAGAC TAAA TTT AAC  CTACACC AAAA TA
Sbjct:   120 ATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAATTA 179

Query:    22 ACTCTTAATCCAACATCGAGGT 1
               TCTTAATCCAACATCGAGGT
Sbjct:   180 TATCTTAATCCAACATCGAGGT 201


>cbil|dbest|885852 AA246515 LD05452.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=397
            Length = 397

  Minus Strand HSPs:

 Score = 717 (107.6 bits), Expect = 2.1e-26, P = 2.1e-26
 Identities = 171/204 (83%), Positives = 171/204 (83%), Strand = Minus / Plus

Query:   204 TCTAATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGT 145
             T T ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGT
Sbjct:    49 TTTTATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGT 107

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACTA AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTC
Sbjct:   108 ACTAAAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTC 167

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAA 25
             AGATCATGTAAGAATT AAA GTCGAACAGAC TAAA TTT AAC  CTACACC AAAA 
Sbjct:   168 AGATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAAT 227

Query:    24 TAACTCTTAATCCAACATCGAGGT 1
             TA  TCTTAATCCAACATCGAGGT
Sbjct:   228 TATATCTTAATCCAACATCGAGGT 251


>cbil|dbest|780444 AA141585 CK02035.3prime 3'
            Lib=559[Drosophila_melanogaster|embryo||||0_to_24_hours_old_embryo]
            Length=605
            Length = 605

  Minus Strand HSPs:

 Score = 710 (106.5 bits), Expect = 2.8e-26, P = 2.8e-26
 Identities = 168/200 (84%), Positives = 168/200 (84%), Strand = Minus / Plus

Query:   200 ATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTA 141
             ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGTACTA
Sbjct:     1 ATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGTACTA 59

Query:   140 TAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGAT 81
              AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTCAGAT
Sbjct:    60 AAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTCAGAT 119

Query:    80 CATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAATAAC 21
             CATGTAAGAATT AAA  TCGAACAGAC TAAA TTT AAC  CTACACC AAAA TA  
Sbjct:   120 CATGTAAGAATTTAAAANTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAATTATN 179

Query:    20 TCTTAATCCAACATCGAGGT 1
             TCTTAATCCAACATCGAGGT
Sbjct:   180 TCTTAATCCAACATCGAGGT 199


>cbil|dbest|1404553 AA697969 HL03544.5prime 5prime
            Lib=1056[Drosophila_melanogaster|head--brain_&_sensory_organ||||adu
            lt] Length=285 Author_cmt: M37275: Drosophila melanogaster
            mitochondrial DNA with 12 tRNAs and 7 genes.
            Length = 285

  Minus Strand HSPs:

 Score = 717 (107.6 bits), Expect = 2.9e-26, P = 2.9e-26
 Identities = 171/204 (83%), Positives = 171/204 (83%), Strand = Minus / Plus

Query:   204 TCTAATATTAATATTAATCATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGT 145
             T T ATATTAATA TA TC TAT A  AA AT   TATTT T ATATT GGTCCTTTCGT
Sbjct:     8 TTTTATATTAATAATATTCTTATAAAAAATATAATTATTT-TGATATTTGGTCCTTTCGT 66

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACTA AA AT ATAATT  TTAA GATAGAAACCAACCTGGCTTAC CCGGTTTGAACTC
Sbjct:    67 ACTAAAATATCATAATTTTTTAAAGATAGAAACCAACCTGGCTTACACCGGTTTGAACTC 126

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAACTTCTACACCTAAAAA 25
             AGATCATGTAAGAATT AAA GTCGAACAGAC TAAA TTT AAC  CTACACC AAAA 
Sbjct:   127 AGATCATGTAAGAATTTAAAAGTCGAACAGACTTAAAATTTGAACGGCTACACCCAAAAT 186

Query:    24 TAACTCTTAATCCAACATCGAGGT 1
             TA  TCTTAATCCAACATCGAGGT
Sbjct:   187 TATATCTTAATCCAACATCGAGGT 210


>cbil|dbest|1401970 AA695695 GM04310.5prime 5prime
            Lib=1058[Drosophila_melanogaster|ovary||||newly_eclosed_females:_ge
            rmarium-stage_6] Length=408 Author_cmt: M37275: Drosophila
            melanogaster mitochondrial DNA with 12 tRNAs and 7 genes.
            Length = 408

  Plus Strand HSPs:

 Score = 707 (106.1 bits), Expect = 5.7e-26, P = 5.7e-26
 Identities = 169/202 (83%), Positives = 169/202 (83%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ACCTCGATGTTGGATTAAGA  TA TTTT GGTGTAG  GTT AAA TTTA GTCTGTTC
Sbjct:   208 ACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTC 267

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTATC 120
             GAC TTT AATTCTTACATGATCTGAGTTCAAACCGG GTAAGCCAGGTTGGTTTCTATC
Sbjct:   268 GACTTTTAAATTCTTACATGATCTGAGTTCAAACCGGTGTAAGCCAGGTTGGTTTCTATC 327

Query:   121 CTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTAAT 180
              TTAA  AATT T AT TT TAGTACGAAAGGACC AATAT A AAATA   AT TT  T
Sbjct:   328 TTTAAAAAATTGTGATATTTTAGTACGAAAGGACCAAATATTA-AAATAATTATATTTTT 386

Query:   181 AATATGATTAATATTAATATTA 202
              ATA GA TA TATTAATAT A
Sbjct:   387 TATAAGAATATTATTAATATAA 408


>cbil|dbest|905976 AA264460 LD08979.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=589
            Length = 589

  Minus Strand HSPs:

 Score = 661 (99.2 bits), Expect = 4.7e-24, P = 4.7e-24
 Identities = 155/178 (87%), Positives = 155/178 (87%), Strand = Minus / Plus

Query:   177 AAAATCTATATT-TCTT-ATATTAGGTCCTTTCGTACTATAACATAATAATTAATTAAGG 120
             AAAAT TA ATT T TT ATATT GGTCCTTTCGTACTA AA AT ATAATT  TTAA G
Sbjct:     3 AAAATATA-ATTATTTTGATATTTGGTCCTTTCGTACTAAAATATCATAATTTTTTAAAG 61

Query:   119 ATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCG 60
             ATAGAAACCAACCTGGCTTAC CCGGTTTGAACTCAGATCATGTAAGAATT AAA GTCG
Sbjct:    62 ATAGAAACCAACCTGGCTTACACCGGTTTGAACTCAGATCATGTAAGAATTTAAAAGTCG 121

Query:    59 AACAGACCTAAACTTTAAACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             AACAGAC TAAA TTT AAC  CTACACC AAAA TA  TCTTAATCCAACATCGAGGT
Sbjct:   122 AACAGACTTAAAATTTGAACGGCTACACCCAAAATTATATCTTAATCCAACATCGAGGT 180


>cbil|dbest|1186010 AA539962 LD19272.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=490
            Length = 490

  Minus Strand HSPs:

 Score = 661 (99.2 bits), Expect = 5.7e-24, P = 5.7e-24
 Identities = 155/178 (87%), Positives = 155/178 (87%), Strand = Minus / Plus

Query:   177 AAAATCTATATT-TCTT-ATATTAGGTCCTTTCGTACTATAACATAATAATTAATTAAGG 120
             AAAAT TA ATT T TT ATATT GGTCCTTTCGTACTA AA AT ATAATT  TTAA G
Sbjct:     2 AAAATATA-ATTATTTTGATATTTGGTCCTTTCGTACTAAAATATCATAATTTTTTAAAG 60

Query:   119 ATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCG 60
             ATAGAAACCAACCTGGCTTAC CCGGTTTGAACTCAGATCATGTAAGAATT AAA GTCG
Sbjct:    61 ATAGAAACCAACCTGGCTTACACCGGTTTGAACTCAGATCATGTAAGAATTTAAAAGTCG 120

Query:    59 AACAGACCTAAACTTTAAACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             AACAGAC TAAA TTT AAC  CTACACC AAAA TA  TCTTAATCCAACATCGAGGT
Sbjct:   121 AACAGACTTAAAATTTGAACGGCTACACCCAAAATTATATCTTAATCCAACATCGAGGT 179


>cbil|dbest|1185586 AA539015 LD18713.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=650
            Length = 650

  Minus Strand HSPs:

 Score = 656 (98.4 bits), Expect = 7.2e-24, P = 7.2e-24
 Identities = 154/177 (87%), Positives = 154/177 (87%), Strand = Minus / Plus

Query:   176 AAATCTATATT-TCTT-ATATTAGGTCCTTTCGTACTATAACATAATAATTAATTAAGGA 119
             AAAT TA ATT T TT ATATT GGTCCTTTCGTACTA AA AT ATAATT  TTAA GA
Sbjct:     1 AAATATA-ATTATTTTGATATTTGGTCCTTTCGTACTAAAATATCATAATTTTTTAAAGA 59

Query:   118 TAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGA 59
             TAGAAACCAACCTGGCTTAC CCGGTTTGAACTCAGATCATGTAAGAATT AAA GTCGA
Sbjct:    60 TAGAAACCAACCTGGCTTACACCGGTTTGAACTCAGATCATGTAAGAATTTAAAAGTCGA 119

Query:    58 ACAGACCTAAACTTTAAACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             ACAGAC TAAA TTT AAC  CTACACC AAAA TA  TCTTAATCCAACATCGAGGT
Sbjct:   120 ACAGACTTAAAATTTGAACGGCTACACCCAAAATTATATCTTAATCCAACATCGAGGT 177


>cbil|dbest|1084643 AA440091 LD15172.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=378
            Length = 378

  Minus Strand HSPs:

 Score = 661 (99.2 bits), Expect = 7.4e-24, P = 7.4e-24
 Identities = 155/178 (87%), Positives = 155/178 (87%), Strand = Minus / Plus

Query:   177 AAAATCTATATT-TCTT-ATATTAGGTCCTTTCGTACTATAACATAATAATTAATTAAGG 120
             AAAAT TA ATT T TT ATATT GGTCCTTTCGTACTA AA AT ATAATT  TTAA G
Sbjct:     2 AAAATATA-ATTATTTTGATATTTGGTCCTTTCGTACTAAAATATCATAATTTTTTAAAG 60

Query:   119 ATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCG 60
             ATAGAAACCAACCTGGCTTAC CCGGTTTGAACTCAGATCATGTAAGAATT AAA GTCG
Sbjct:    61 ATAGAAACCAACCTGGCTTACACCGGTTTGAACTCAGATCATGTAAGAATTTAAAAGTCG 120

Query:    59 AACAGACCTAAACTTTAAACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             AACAGAC TAAA TTT AAC  CTACACC AAAA TA  TCTTAATCCAACATCGAGGT
Sbjct:   121 AACAGACTTAAAATTTGAACGGCTACACCCAAAATTATATCTTAATCCAACATCGAGGT 179


>cbil|dbest|1186751 AA540703 LD20479.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=532
            Length = 532

  Minus Strand HSPs:

 Score = 654 (98.1 bits), Expect = 1.1e-23, P = 1.1e-23
 Identities = 152/177 (85%), Positives = 152/177 (85%), Strand = Minus / Plus

Query:   177 AAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTAATTAAGGAT 118
             AA AT   TATTT T ATATT GGTCCTTTCGTACTA AA AT ATAATT  TTAA GAT
Sbjct:     1 AATATAATTATTT-TGATATTTGGTCCTTTCGTACTAAAATATCATAATTTTTTAAAGAT 59

Query:   117 AGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAA 58
             AGAAACCAACCTGGCTTAC CCGGTTTGAACTCAGATCATGTAAGAATT AAA GTCGAA
Sbjct:    60 AGAAACCAACCTGGCTTACACCGGTTTGAACTCAGATCATGTAAGAATTTAAAAGTCGAA 119

Query:    57 CAGACCTAAACTTTAAACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             CAGAC TAAA TTT AAC  CTACACC AAAA TA  TCTTAATCCAACATCGAGGT
Sbjct:   120 CAGACTTAAAATTTGAACGGCTACACCCAAAATTATATCTTAATCCAACATCGAGGT 176


>cbil|dbest|1077558 AA433264 EST78 5'
            Lib=874[Drosophila_melanogaster|||||embryonic_2_-_14_hours]
            Length=421
            Length = 421

  Plus Strand HSPs:

 Score = 639 (95.9 bits), Expect = 6.5e-23, P = 6.5e-23
 Identities = 161/200 (80%), Positives = 161/200 (80%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ACCTCGATGTTGGATTAAGA  TA TTTT GGTGTAG  G   AAA TTTA GTCTG  C
Sbjct:   223 ACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGGCGCCCAAATTTTAAGTCTGC-C 281

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTATC 120
             GAC TTT AATTCTTACATGATCTGAGTTCAAACCGG GTAAGCCAGGTTGGTTTCTATC
Sbjct:   282 GACTTTTAAATTCTTACATGATCTGAGTTCAAACCGGTGTAAGCCAGGTTGGTTTCTATC 341

Query:   121 CTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTAAT 180
              TTAA  AATT T AT TT  AGTACGAAAGG CC AATAT A AAATA   AT TT   
Sbjct:   342 TTTAAAAAATTGTGATATTTCAGTACGAAAGGGCCAAATATCA-AAATAATTATATTNCC 400

Query:   181 AATATGATTAATATTAATAT 200
              ATA GA TA TATTAATAT
Sbjct:   401 TATAAGAATATTATTAATAT 420


>cbil|dbest|1262367 AA586151 28800 3' Lib=71[Arabidopsis_thaliana|||||]
            Length=310
            Length = 310

  Plus Strand HSPs:

 Score = 634 (95.1 bits), Expect = 1.5e-22, P = 1.5e-22
 Identities = 170/200 (85%), Positives = 170/200 (85%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGT-TTAGGTCTGTT 59
             ACCTCGATGTTG ATTAAGA TTA T TTAGGTG A AA TTTAA GT TTAGGTCTGTT
Sbjct:   114 ACCTCGATGTTGAATTAAGA-TTAATCTTAGGTGCAAAATTTTAA-GTATTAGGTCTGTT 171

Query:    60 CGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTAT 119
             CGACCTTT AATTCTTACATGAT TGAGTTCAA CCGG GTAAGCCAGGTTGGTTTCTAT
Sbjct:   172 CGACCTTTAAATTCTTACATGATTTGAGTTCAANCCGGTGTAAGCCAGGTTGGTTTCTAT 231

Query:   120 CCTT-AATTAATTA-TTATGTTATAGTACGAAAGGACCTAATATAAGA-AATATAGATTT 176
             C TT AA  AAT A TTAT TT TAGTACGAAAGGA  TAA ATAA   AAT TA ATTT
Sbjct:   232 CTTTTAAAAAATAAATTAT-TT-TAGTACGAAAGGAT-TAA-ATAATTGAAT-TAAATTT 286

Query:   177 TAATAATATGA-TTAATATTAATAT 200
             T AT A ATGA TTAA ATTAAT T
Sbjct:   287 TTATTAAATGAATTAA-ATTAATTT 310


>cbil|dbest|21235 T04420 467  Lib=71[Arabidopsis_thaliana|||||]
            Length=284
            Length = 284

  Plus Strand HSPs:

 Score = 623 (93.5 bits), Expect = 5.1e-22, P = 5.1e-22
 Identities = 167/204 (81%), Positives = 167/204 (81%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGT-TTAGGTCTGTT 59
             ACCTCGATGTTG ATTAAGA TTA T TTAGGTG A AA TTTAA GT TTAGGTCTGTT
Sbjct:    84 ACCTCGATGTTGAATTAAGA-TTAATCTTAGGTGCAAAATTTTAA-GTATTAGGTCTGTT 141

Query:    60 CGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTAT 119
             CGACCTTT AATTCTTACATGAT TGAGTTCAAACCGG GTAAGCCAGGTTGGTTTCTAT
Sbjct:   142 CGACCTTTAAATTCTTACATGATTTGAGTTCAAACCGGTGTAAGCCAGGTTGGTTTCTAT 201

Query:   120 CCTT-AATTAATTA-TTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTT 177
             C TT AA  AAT A TTAT TT TAGTACG AAGG C TAA  TAA   A  TA ATT T
Sbjct:   202 CTTTTAAAAAATAAATTAT-TT-TAGTACGCAAGG-CTTAAN-TAATTGANTTAAATTNT 257

Query:   178 AATAATATGATTAATATTAATATTAGA 204
              AT A ATGA T A ATTAAT TTA A
Sbjct:   258 TATTAAATGANTTAAATTAAT-TTAAA 283


>cbil|dbest|1077513 AA433219 EST33 5'
            Lib=874[Drosophila_melanogaster|||||embryonic_2_-_14_hours]
            Length=197
            Length = 197

  Plus Strand HSPs:

 Score = 616 (92.4 bits), Expect = 1.5e-21, P = 1.5e-21
 Identities = 154/193 (79%), Positives = 154/193 (79%), Strand = Plus / Plus

Query:    12 GGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTCGACCTTTGAAT 71
             |||||||||  || |||| |||||||  ||| |||    | ||||||||||| ||| |||
Sbjct:     1 GGATTAAGATATAATTTTGGGTGTAGCCGTTCAAACCCCAAGTCTGTTCGACTTTTAAAT 60

Query:    72 TCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTATCCTTAATTAATT 131
             |||||||||||||||||||||||||| |||||||||||||||||||||| ||||  ||||
Sbjct:    61 TCTTACATGATCTGAGTTCAAACCGGTGTAAGCCAGGTTGGTTTCTATCTTTAAAAAATT 120

Query:   132 ATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTAATAATATGATTAA 191
              | || || ||| ||||||||||| ||||| |  ||||   || ||  | ||| || || 
Sbjct:   121 GTGATATTTTAGNACGAAAGGACCAAATATTAATAATAATTATATTTTTTATAAGAATAT 180

Query:   192 TATTAATATTAGA 204
             ||||||||| | |
Sbjct:   181 TATTAATATAAAA 193


>cbil|dbest|779885 AA140871 CK01090.5prime 5'
            Lib=559[Drosophila_melanogaster|embryo||||0_to_24_hours_old_embryo]
            Length=500
            Length = 500

  Plus Strand HSPs:

 Score = 496 (74.4 bits), Expect = 1.6e-16, P = 1.6e-16
 Identities = 120/143 (83%), Positives = 120/143 (83%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ACCTCGATGTTGGATTAAGA  TA TTTT GGTGTAG  GTT  AA TTTA GTCTGTTC
Sbjct:   358 ACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCNAATTTTAAGTCTGTTC 417

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGT-AAGCCAGGTTGGTTTCTAT 119
             GAC  TT AATTCTTACATGATCTGAGTTCAAACCGG GT AAGCC GGTTGGTTTCTAT
Sbjct:   418 GACTNTTAAATTCTTACATGATCTGAGTTCAAACCGGTGTTAAGCCNGGTTGGTTTCTAT 477

Query:   120 CCT-TAATTAATTATTATGTTATA 142
             C T TAA  AAT AT AT TT TA
Sbjct:   478 CTTCTAAA-AATNATGATNTTTTA 500


>cbil|dbest|1077481 AA433202 EST1 5'
            Lib=874[Drosophila_melanogaster|||||embryonic_2_-_14_hours]
            Length=190
            Length = 190

  Minus Strand HSPs:

 Score = 498 (74.7 bits), Expect = 3.4e-16, P = 3.4e-16
 Identities = 134/164 (81%), Positives = 134/164 (81%), Strand = Minus / Plus

Query:   197 TTAATATTAATCATATTAT--TAAAATCTATATTTCTT--A-TATTAGG-TCCTTTCGTA 144
             TT ATATTAAT ATATT T  TAAAA  TATA TT TT  A TATT GG TCCTTT GTA
Sbjct:    25 TTTATATTAATAATATTCTNATAAAAAATATAATTATTTAAATATTTGGGTCCTTTGGTA 84

Query:   143 CTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCA 84
             CTA AA AT A AATT  TTAA GATAGAAACCAACC GGCTTAC CCGGTTTGAACTCA
Sbjct:    85 CTAAAATATCACAATTTTTTAAAGATAGAAACCAACC-GGCTTACACCGGTTTGAACTCA 143

Query:    83 GATCAT-GTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAAAC 40
             GATCAT GTAAGAATT AAA G CGAACAGAC TAAA TTT AAC
Sbjct:   144 GATCATNGTAAGAATTTAAAAGACGAACAGACTTAAAATTTGAAC 188


>cbil|dbest|1111259 AA466760 vf02e01.r1 5'
            Lib=875[Mus_musculus|embryo|blastocyst|||embryo_(pre-implantation)]
            Length=202
            Length = 202

  Plus Strand HSPs:

 Score = 442 (66.3 bits), Expect = 1.1e-13, P = 1.1e-13
 Identities = 142/189 (75%), Positives = 142/189 (75%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ACCTCGATGTTGG TTAA AGTT T  TTAG  G A   G T A A    A GTCTGTTC
Sbjct:    17 ACCTCGATGTTGGTTTAAAAGTTCTACTTAGC-GCATN-GCTAAGAAAGAAAGTCTGTTC 74

Query:    61 GACCTTTGAATTCTT-ACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTAT 119
             GAC TTT AATT TT AC TGA CTGAGTTCAAA CGG GTAAGCCAG TTGG TT TAT
Sbjct:    75 GACTTTT-AATTTTTCACTTGAACTGAGTTCAAATCGGTGTAAGCCAGATTGGATTTTAT 133

Query:   120 CCTTAATTAATTATTATGTTA--TAGTACGAAAGGACCTAATATAAGAAATATAGATTTT 177
             C  TA TT AT ATT T T A  TAGTACGAAAGGA  TA T TAA AAATAT G  TTT
Sbjct:   134 CTATAGTTTATAATTTT-TAACTTAGTACGAAAGGAA-TAGT-TAATAAATATTGTATTT 190

Query:   178 AATAATA-TGATT 189
             AA AATA T ATT
Sbjct:   191 AA-AATAATAATT 202


>cbil|dbest|1402932 AA696657 GM08077.5prime 5prime
            Lib=1058[Drosophila_melanogaster|ovary||||newly_eclosed_females:_ge
            rmarium-stage_6] Length=332 Author_cmt: M37275: Drosophila
            melanogaster mitochondrial DNA with 12 tRNAs and 7 genes.
            Length = 332

  Plus Strand HSPs:

 Score = 422 (63.3 bits), Expect = 5.2e-13, P = 5.2e-13
 Identities = 94/106 (88%), Positives = 94/106 (88%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ||||||||||||||||||||  || |||| |||||||  ||| ||| |||| ||||||||
Sbjct:   227 ACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTC 286

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCA 106
             ||| ||| ||||||||||||||||||||||||||||| ||||||||
Sbjct:   287 GACTTTTAAATTCTTACATGATCTGAGTTCAAACCGGTGTAAGCCA 332


>cbil|dbest|1193781 AA547789 EST188698 5'
            Lib=955[Biomphalaria_glabrata|brain|cerebral_ganglia|||] Length=292
            Author_cmt: mitochondrial
            Length = 292

  Minus Strand HSPs:

 Score = 408 (61.2 bits), Expect = 2.6e-12, P = 2.6e-12
 Identities = 132/173 (76%), Positives = 132/173 (76%), Strand = Minus / Plus

Query:   173 TCTATATTTCTTATATTA-GGTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGA 115
             T TATA T    ATATT  GGTCCTTTCGTACTA AA ATA TAA  AAT AA GATAGA
Sbjct:    14 TTTATAGTAAAAATATTCCGGTCCTTTCGTACTAAAA-ATATTAA--AATAAAAGATAGA 70

Query:   114 AACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGA-ATTCAAAGGTCGAACA 56
             AAC  ACCTGGCT ACGCCGGT TGAACTCAGATCATGTA GA A T A  G TCGAACA
Sbjct:    71 AACTGACCTGGCTCACGCCGGTCTGAACTCAGATCATGTAGGATAGT-ATTGTTCGAACA 129

Query:    55 GACCTAAACTTTAA--ACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             GA C AA CTTT    AC  CTA  C TAAA  T  C CT A TCCAACATCGAGGT
Sbjct:   130 GAACAAATCTTTTTTGACGGCTAGCCATAAAGTT--C-CT-AGTCCAACATCGAGGT 182


>cbil|dbest|1193775 AA547783 EST188692 5'
            Lib=955[Biomphalaria_glabrata|brain|cerebral_ganglia|||] Length=329
            Author_cmt: mitochondrial
            Length = 329

  Minus Strand HSPs:

 Score = 403 (60.5 bits), Expect = 3.8e-12, P = 3.8e-12
 Identities = 131/173 (75%), Positives = 131/173 (75%), Strand = Minus / Plus

Query:   173 TCTATATTTCTTATATTA-GGTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGA 115
             T TATA T    ATATT  GGTCCTTTCGTACTA AA ATA TAA  AAT AA GATAGA
Sbjct:    14 TTTATAGTAAAAATATTCCGGTCCTTTCGTACTAAAA-ATATTAA--AATAAAAGATAGA 70

Query:   114 AACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGA-ATTCAAAGGTCGAACA 56
             AAC  ACCTGG T ACGCCGGT TGAACTCAGATCATGTA GA A T A  G TCGAACA
Sbjct:    71 AACTGACCTGGNTCACGCCGGTCTGAACTCAGATCATGTAGGATAGT-ATTGTTCGAACA 129

Query:    55 GACCTAAACTTTA-A-ACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             GA C AA CTTT    AC  CTA  C TAAA  T  C CT A TCCAACATCGAGGT
Sbjct:   130 GAACAAATCTTTTTNGACGGCTAGCCATAAAGTT--C-CT-AGTCCAACATCGAGGT 182


>cbil|dbest|1330864 C77125 C77125 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=582 Author_cmt:
            Mouse mitochondrial genome
            Length = 582

  Minus Strand HSPs:

 Score = 388 (58.2 bits), Expect = 1.0e-11, P = 1.0e-11
 Identities = 134/186 (72%), Positives = 134/186 (72%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACCAACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCAACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1193753 AA547761 EST188670 5'
            Lib=954[Biomphalaria_glabrata|whole_body|whole_body|||] Length=198
            Author_cmt: mitochondrial
            Length = 198

  Minus Strand HSPs:

 Score = 397 (59.6 bits), Expect = 1.2e-11, P = 1.2e-11
 Identities = 125/160 (78%), Positives = 125/160 (78%), Strand = Minus / Plus

Query:   161 ATATTA-GGTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGC 103
             ATATT  GGTCCTTTCGTACTA AA ATA TAA  AAT AA GATAGAAAC  ACCTGGC
Sbjct:    10 ATATTCCGGTCCTTTCGTACTAAAA-ATATTAA--AATAAAAGATAGAAACTGACCTGGC 66

Query:   102 TTACGCCGGTTTGAACTCAGATCATGTAAGA-ATTCAAAGGTCGAACAGACCTAAACTTT 44
             T ACGCCGGT TGAACTCAGATCATGTA GA A T A  G TCGAACAGA C AA CTTT
Sbjct:    67 TCACGCCGGTCTGAACTCAGATCATGTAGGATAGT-ATTGTTCGAACAGAACAAATCTTT 125

Query:    43 AA--ACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGG 2
                 AC  CTA  C TAAA  T  C CT A TCCAACATCGAGG
Sbjct:   126 TTTGACGGCTAGCCATAAAGTT--C-CT-AGTCCAACATCGAGG 165


>cbil|dbest|1331941 C78202 C78202 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=582 Author_cmt:
            Mouse mitochondrial genome
            Length = 582

  Minus Strand HSPs:

 Score = 385 (57.8 bits), Expect = 1.4e-11, P = 1.4e-11
 Identities = 143/202 (70%), Positives = 143/202 (70%), Strand = Minus / Plus

Query:   202 TAATATTAATATTA-ATCATATTATTAA-AATCTATATTTCTTATATTAGGTCCTTTCGT 145
             TAA ATTAA  T A A C   TTATT A AA  T   T T TT T T   GTCCTTTCGT
Sbjct:    54 TAA-ATTAAGTTGAGAGCGC-TTATTTATAAGGTGGCTCTATT-TCTCTTGTCCTTTCGT 110

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTC
Sbjct:   111 ACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTC 166

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAA 27
             AGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTCTACACC A  
Sbjct:   167 AGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATT 224

Query:    26 AATAACTCTTAATCCAACATCGAGGT 1
                A  TC T ATCCAACATCGAGGT
Sbjct:   225 GGGATGTCCTGATCCAACATCGAGGT 250


>cbil|dbest|1331635 C77896 C77896 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=587 Author_cmt:
            Mouse mitochondrial genome
            Length = 587

  Minus Strand HSPs:

 Score = 384 (57.6 bits), Expect = 1.5e-11, P = 1.5e-11
 Identities = 134/186 (72%), Positives = 134/186 (72%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    77 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 132

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   133 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 189

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACC-TAAAAATAACTCTTAATCCAA 10
             A  GT GAACA AC  AA C TTAA A CTTCTACACC T    AT  C CT A TCCAA
Sbjct:   190 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACCATTGGGATGTCCCTGATTCCAA 248

Query:     9 CATCGAGGT 1
             CATCGAGGT
Sbjct:   249 CATCGAGGT 257


>cbil|dbest|1193773 AA547781 EST188690 3'
            Lib=955[Biomphalaria_glabrata|brain|cerebral_ganglia|||] Length=215
            Author_cmt: mitochondrial, rRNA
            Length = 215

  Minus Strand HSPs:

 Score = 392 (58.8 bits), Expect = 1.8e-11, P = 1.8e-11
 Identities = 124/161 (77%), Positives = 124/161 (77%), Strand = Minus / Plus

Query:   161 ATATTA-GGTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGC 103
             ATATT  GGTCCTTTCGTACTA AA ATA TAA  AAT AA GATAGAAAC  ACCTGGC
Sbjct:    10 ATATTCCGGTCCTTTCGTACTAAAA-ATATTAA--AATAAAAGATAGAAACTGACCTGGC 66

Query:   102 TTACGCCGGTTTGAACTCAGATCATGTAAGA-ATTCAAAGGTCGAACAGACCTAAACTTT 44
             T ACGCCGGT TGA CTCAGATCATGTA GA A T A  G  CGAACAGA C AA CTTT
Sbjct:    67 TCACGCCGGTCTGANCTCAGATCATGTAGGATAGT-ATTGTNCGAACAGAACAAATCTTT 125

Query:    43 A-A-ACTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
                 AC  CTA  C TAAA  T  C CT A TCCAACATCGAGGT
Sbjct:   126 TTNGACGGCTAGCCATAAAG-TN-C-CT-AGTCCAACATCGAGGT 166


>cbil|dbest|1335309 C81570 C81570 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=445 Author_cmt:
            Mouse mitochondrial genome
            Length = 445

  Minus Strand HSPs:

 Score = 385 (57.8 bits), Expect = 1.8e-11, P = 1.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    48 CTTATTTGTAANGTNGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 103

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   104 AT--AG-ATAGAAACCGACCTGGATTNCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 160

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   161 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 218

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   219 ATCGAGGT 226


>cbil|dbest|1327650 C76371 C76371 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=696 Author_cmt:
            Mouse mitochondrial genome
            Length = 696

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.2e-11, P = 2.2e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334833 C81094 C81094 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=531 Author_cmt:
            Mouse mitochondrial genome
            Length = 531

  Minus Strand HSPs:

 Score = 381 (57.2 bits), Expect = 2.3e-11, P = 2.3e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGA ACC ACCTGG TT C CCGGT TGAACTCAGATCA GTAAGA TT A
Sbjct:   125 AT--AG-ATAGANACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAAGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327724 C76445 C76445 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=637 Author_cmt:
            Mouse mitochondrial genome
            Length = 637

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.4e-11, P = 2.4e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    67 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 122

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   123 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 179

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   180 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 237

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   238 ATCGAGGT 245


>cbil|dbest|1327372 C76093 C76093 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=614 Author_cmt:
            Mouse mitochondrial genome
            Length = 614

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330744 C77005 C77005 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=607 Author_cmt:
            Mouse mitochondrial genome
            Length = 607

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1333620 C79881 C79881 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=607 Author_cmt:
            Mouse mitochondrial genome
            Length = 607

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    71 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 126

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   127 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 183

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   184 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 241

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   242 ATCGAGGT 249


>cbil|dbest|1332633 C78894 C78894 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=605 Author_cmt:
            Mouse mitochondrial genome
            Length = 605

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327226 C75947 C75947 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=603 Author_cmt:
            Mouse mitochondrial genome
            Length = 603

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    77 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 132

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   133 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 189

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   190 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 247

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   248 ATCGAGGT 255


>cbil|dbest|1333040 C79301 C79301 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=602 Author_cmt:
            Mouse mitochondrial genome
            Length = 602

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327348 C76069 C76069 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=601 Author_cmt:
            Mouse mitochondrial genome
            Length = 601

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1332114 C78375 C78375 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=599 Author_cmt:
            Mouse mitochondrial genome
            Length = 599

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1332290 C78551 C78551 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=599 Author_cmt:
            Mouse mitochondrial genome
            Length = 599

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1332535 C78796 C78796 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=599 Author_cmt:
            Mouse mitochondrial genome
            Length = 599

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1332779 C79040 C79040 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=599 Author_cmt:
            Mouse mitochondrial genome
            Length = 599

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    77 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 132

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   133 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 189

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   190 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 247

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   248 ATCGAGGT 255


>cbil|dbest|1331154 C77415 C77415 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=598 Author_cmt:
            Mouse mitochondrial genome
            Length = 598

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1333964 C80225 C80225 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=594 Author_cmt:
            Mouse mitochondrial genome
            Length = 594

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327384 C76105 C76105 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=592 Author_cmt:
            Mouse mitochondrial genome
            Length = 592

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1331368 C77629 C77629 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=591 Author_cmt:
            Mouse mitochondrial genome
            Length = 591

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331667 C77928 C77928 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=590 Author_cmt:
            Mouse mitochondrial genome
            Length = 590

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1333588 C79849 C79849 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=589 Author_cmt:
            Mouse mitochondrial genome
            Length = 589

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1330513 C76774 C76774 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=587 Author_cmt:
            Mouse mitochondrial genome
            Length = 587

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1330872 C77133 C77133 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=587 Author_cmt:
            Mouse mitochondrial genome
            Length = 587

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1327283 C76004 C76004 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=586 Author_cmt:
            Mouse mitochondrial genome
            Length = 586

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    78 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 133

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   134 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 190

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   191 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 248

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   249 ATCGAGGT 256


>cbil|dbest|1334588 C80849 C80849 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=586 Author_cmt:
            Mouse mitochondrial genome
            Length = 586

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1330599 C76860 C76860 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=585 Author_cmt:
            Mouse mitochondrial genome
            Length = 585

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1335203 C81464 C81464 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=585 Author_cmt:
            Mouse mitochondrial genome
            Length = 585

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1332855 C79116 C79116 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=585 Author_cmt:
            Mouse mitochondrial genome
            Length = 585

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    50 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 105

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   106 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 162

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   163 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 220

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   221 ATCGAGGT 228


>cbil|dbest|1332181 C78442 C78442 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=584 Author_cmt:
            Mouse mitochondrial genome
            Length = 584

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1332826 C79087 C79087 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=584 Author_cmt:
            Mouse mitochondrial genome
            Length = 584

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1333812 C80073 C80073 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=584 Author_cmt:
            Mouse mitochondrial genome
            Length = 584

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334521 C80782 C80782 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=583 Author_cmt:
            Mouse mitochondrial genome
            Length = 583

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    56 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 111

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   112 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 168

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   169 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 226

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   227 ATCGAGGT 234


>cbil|dbest|1334873 C81134 C81134 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=583 Author_cmt:
            Mouse mitochondrial genome
            Length = 583

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334902 C81163 C81163 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=583 Author_cmt:
            Mouse mitochondrial genome
            Length = 583

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1334914 C81175 C81175 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=583 Author_cmt:
            Mouse mitochondrial genome
            Length = 583

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330411 C76672 C76672 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=582 Author_cmt:
            Mouse mitochondrial genome
            Length = 582

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334307 C80568 C80568 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=582 Author_cmt:
            Mouse mitochondrial genome
            Length = 582

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTATGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331879 C78140 C78140 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=581 Author_cmt:
            Mouse mitochondrial genes coding for three transfer RNAs
            Length = 581

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331539 C77800 C77800 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=580 Author_cmt:
            Mouse mitochondrial genome
            Length = 580

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334603 C80864 C80864 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=580 Author_cmt:
            Mouse mitochondrial genome
            Length = 580

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    66 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 121

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   122 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 178

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   179 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 236

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   237 ATCGAGGT 244


>cbil|dbest|1335003 C81264 C81264 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=580 Author_cmt:
            Mouse mitochondrial genome
            Length = 580

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331754 C78015 C78015 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=579 Author_cmt:
            Mouse mitochondrial genome
            Length = 579

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331910 C78171 C78171 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=579 Author_cmt:
            Mouse mitochondrial genome
            Length = 579

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    71 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 126

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   127 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 183

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   184 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 241

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   242 ATCGAGGT 249


>cbil|dbest|1332068 C78329 C78329 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=579 Author_cmt:
            Mouse mitochondrial genome
            Length = 579

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334826 C81087 C81087 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=579 Author_cmt:
            Mouse mitochondrial genome
            Length = 579

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1331773 C78034 C78034 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=578 Author_cmt:
            Mouse mitochondrial genome
            Length = 578

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1332955 C79216 C79216 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=578 Author_cmt:
            Mouse mitochondrial genome
            Length = 578

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331670 C77931 C77931 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=577 Author_cmt:
            Mouse mitochondrial genome
            Length = 577

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    20 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 75

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:    76 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 132

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   133 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 190

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   191 ATCGAGGT 198


>cbil|dbest|1334724 C80985 C80985 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=577 Author_cmt:
            Mouse mitochondrial genome
            Length = 577

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330653 C76914 C76914 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=576 Author_cmt:
            Mouse mitochondrial genome
            Length = 576

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331592 C77853 C77853 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=576 Author_cmt:
            Mouse mitochondrial genome
            Length = 576

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1333474 C79735 C79735 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=576 Author_cmt:
            Mouse mitochondrial genome
            Length = 576

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1334910 C81171 C81171 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=576 Author_cmt:
            Mouse mitochondrial genome
            Length = 576

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.6e-11, P = 2.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334129 C80390 C80390 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=575 Author_cmt:
            Mouse mitochondrial genome
            Length = 575

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327523 C76244 C76244 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=573 Author_cmt:
            Mouse mitochondrial genome
            Length = 573

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1335356 C81617 C81617 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=573 Author_cmt:
            Mouse mitochondrial genome
            Length = 573

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    48 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 103

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   104 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 160

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   161 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 218

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   219 ATCGAGGT 226


>cbil|dbest|1331747 C78008 C78008 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=571 Author_cmt:
            Mouse mitochondrial genome
            Length = 571

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1331708 C77969 C77969 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=568 Author_cmt:
            Mouse mitochondrial genome
            Length = 568

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327701 C76422 C76422 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=566 Author_cmt:
            Mouse mitochondrial genome
            Length = 566

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    74 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 129

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   130 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 186

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   187 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 244

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   245 ATCGAGGT 252


>cbil|dbest|1330548 C76809 C76809 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=565 Author_cmt:
            Mouse mitochondrial genome
            Length = 565

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    56 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 111

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   112 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 168

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   169 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 226

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   227 ATCGAGGT 234


>cbil|dbest|1332125 C78386 C78386 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=565 Author_cmt:
            Mouse mitochondrial genome
            Length = 565

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334532 C80793 C80793 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=565 Author_cmt:
            Mouse mitochondrial genome
            Length = 565

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334957 C81218 C81218 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=562 Author_cmt:
            Mouse mitochondrial genome
            Length = 562

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    44 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 99

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   100 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 156

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   157 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 214

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   215 ATCGAGGT 222


>cbil|dbest|1330287 C76548 C76548 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=561 Author_cmt:
            Mouse mitochondrial genome
            Length = 561

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1333797 C80058 C80058 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=559 Author_cmt:
            Mouse mitochondrial genome
            Length = 559

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1331516 C77777 C77777 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=555 Author_cmt:
            Mouse mitochondrial genome
            Length = 555

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.7e-11, P = 2.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330550 C76811 C76811 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=554 Author_cmt:
            Mouse mitochondrial genome
            Length = 554

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.8e-11, P = 2.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    48 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 103

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   104 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 160

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   161 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 218

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   219 ATCGAGGT 226


>cbil|dbest|1330816 C77077 C77077 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=553 Author_cmt:
            Mouse mitochondrial genome
            Length = 553

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.8e-11, P = 2.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331733 C77994 C77994 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=553 Author_cmt:
            Mouse mitochondrial genome
            Length = 553

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.8e-11, P = 2.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    20 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 75

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:    76 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 132

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   133 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 190

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   191 ATCGAGGT 198


>cbil|dbest|1333329 C79590 C79590 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=550 Author_cmt:
            Mouse mitochondrial genome
            Length = 550

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.8e-11, P = 2.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331468 C77729 C77729 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=547 Author_cmt:
            Mouse mitochondrial genome
            Length = 547

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.8e-11, P = 2.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330587 C76848 C76848 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=542 Author_cmt:
            Mouse mitochondrial genome
            Length = 542

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.8e-11, P = 2.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1333406 C79667 C79667 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=542 Author_cmt:
            Mouse mitochondrial genome
            Length = 542

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.8e-11, P = 2.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    78 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 133

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   134 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 190

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   191 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 248

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   249 ATCGAGGT 256


>cbil|dbest|1331499 C77760 C77760 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=539 Author_cmt:
            Mouse mitochondrial genome
            Length = 539

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.8e-11, P = 2.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    77 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 132

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   133 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 189

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   190 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 247

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   248 ATCGAGGT 255


>cbil|dbest|1333115 C79376 C79376 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=530 Author_cmt:
            Mouse mitochondrial genome
            Length = 530

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 2.9e-11, P = 2.9e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    56 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 111

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   112 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 168

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   169 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 226

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   227 ATCGAGGT 234


>cbil|dbest|1331577 C77838 C77838 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=516 Author_cmt:
            Mouse mitochondrial genome
            Length = 516

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.0e-11, P = 3.0e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330678 C76939 C76939 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=513 Author_cmt:
            Mouse mitochondrial genome
            Length = 513

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.0e-11, P = 3.0e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331920 C78181 C78181 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=511 Author_cmt:
            Mouse mitochondrial genome
            Length = 511

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.0e-11, P = 3.0e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330740 C77001 C77001 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=506 Author_cmt:
            Mouse mitochondrial genome
            Length = 506

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.0e-11, P = 3.0e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1333500 C79761 C79761 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=506 Author_cmt:
            Mouse mitochondrial genome
            Length = 506

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.0e-11, P = 3.0e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1332099 C78360 C78360 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=485 Author_cmt:
            Mouse mitochondrial genome
            Length = 485

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.1e-11, P = 3.1e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330670 C76931 C76931 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=484 Author_cmt:
            Mouse mitochondrial genome
            Length = 484

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.2e-11, P = 3.2e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327316 C76037 C76037 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=595 Author_cmt:
            Mouse mitochondrial genome
            Length = 595

  Minus Strand HSPs:

 Score = 377 (56.6 bits), Expect = 3.2e-11, P = 3.2e-11
 Identities = 145/202 (71%), Positives = 145/202 (71%), Strand = Minus / Plus

Query:   202 TAATATTAATATTA-ATCA-T-ATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCG 146
             TAA ATTAA  TTA A C  T ATT  TAA  T   T T T TT T TT  GTCCTTTCG
Sbjct:    60 TAA-ATTAAGTTTAGAGCGCTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCG 115

Query:   145 T-ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAAC 87
             T ACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCGGT TGAAC
Sbjct:   116 TGACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAAC 171

Query:    86 TCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTA 29
             TCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTCTACACC A
Sbjct:   172 TCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-A 229

Query:    28 AAAATAACTCTTAATCCAACATCGAGGT 1
                  A  TC T ATCCAACATCGAGGT
Sbjct:   230 TTGGGATGTCCTGATCCAACATCGAGGT 257


>cbil|dbest|1331337 C77598 C77598 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=469 Author_cmt:
            Mouse mitochondrial genome
            Length = 469

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.3e-11, P = 3.3e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    70 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 125

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   126 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 182

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   183 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 240

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   241 ATCGAGGT 248


>cbil|dbest|1332243 C78504 C78504 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=466 Author_cmt:
            Mouse mitochondrial genome
            Length = 466

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.3e-11, P = 3.3e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|344944 R95515 SMNHADA018026SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=372
            Length = 372

  Plus Strand HSPs:

 Score = 381 (57.2 bits), Expect = 3.3e-11, P = 3.3e-11
 Identities = 145/202 (71%), Positives = 145/202 (71%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ACCTCGATGTTGG TT    G    TTTT GGTGTAGA G T  AA    A GTCTGTTC
Sbjct:   180 ACCTCGATGTTGGCTTGTT-GAACCTTTTCGGTGTAGAGGCTGGAAAAGGAAGTCTGTTC 238

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCT-AT 119
             GAC TTT AAT CTT CATGA   GAGTT A ACCGG GTAAGCCAGGTTGG TTCT AT
Sbjct:   239 GACTTTTAAAT-CTT-CATGAGTNGAGTTAAGACCGGTGTAAGCCAGGTTGGGTTCTTAT 296

Query:   120 CCTTAATTAATTA-TTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTA 178
             C  TA T AATT  TT TG T TAGTACGAAAGGA  TA T TA GA A A  G TT T 
Sbjct:   297 C--TA-T-AATTGGTTCTGAT-TAGTACGAAAGGAT-TA-T-TAGGATACAGTGTTTCTG 348

Query:   179 ATAA-TATGATTAATATTAA-TATTA 202
              TA  TAT A  AATA  AA TATTA
Sbjct:   349 -TACGTAT-AGGAATAGGAAGTATTA 372

 Score = 372 (55.8 bits), Expect = 8.5e-11, P = 8.5e-11
 Identities = 144/202 (71%), Positives = 144/202 (71%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ACCTCGATGTTGG TT    G    TTTT GGTGTAGA G T  AA    A GTCTGTTC
Sbjct:   180 ACCTCGATGTTGGCTTGTT-GAACCTTTTCGGTGTAGAGGCTGGAAAAGGAAGTCTGTTC 238

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCT-AT 119
             GAC TTT AAT CTT CATGA   GAGTT A ACCGG GTAAGCCAGGTTGG TTCT AT
Sbjct:   239 GACTTTTAAAT-CTT-CATGAGTNGAGTTAAGACCGGTGTAAGCCAGGTTGGGTTCTTAT 296

Query:   120 CCTTAATTAATTA-TTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATT-T- 176
             C T  AT AATT  TT TG T TAGTACGAAAGGA  TA T TA GA A A  G TT T 
Sbjct:   297 C-T--AT-AATTGGTTCTGAT-TAGTACGAAAGGAT-TA-T-TAGGATACAGTGTTTCTG 348

Query:   177 TAATAATATGATTAATATTAATATTA 202
             TA   ATA GA TA  A  A TATTA
Sbjct:   349 TACGTATAGGAATAGGA--AGTATTA 372


>cbil|dbest|1330286 C76547 C76547 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=456 Author_cmt:
            Mouse mitochondrial genome
            Length = 456

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.3e-11, P = 3.3e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1330894 C77155 C77155 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=451 Author_cmt:
            Mouse mitochondrial genome
            Length = 451

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.4e-11, P = 3.4e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331809 C78070 C78070 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=451 Author_cmt:
            Mouse mitochondrial genome
            Length = 451

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.4e-11, P = 3.4e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330888 C77149 C77149 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=450 Author_cmt:
            Mouse mitochondrial genome
            Length = 450

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.4e-11, P = 3.4e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1333237 C79498 C79498 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=445 Author_cmt:
            Mouse mitochondrial genome
            Length = 445

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.4e-11, P = 3.4e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    20 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 75

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:    76 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 132

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   133 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 190

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   191 ATCGAGGT 198


>cbil|dbest|1327496 C76217 C76217 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=438 Author_cmt:
            Mouse mitochondrial genome
            Length = 438

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.5e-11, P = 3.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334195 C80456 C80456 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=435 Author_cmt:
            Mouse mitochondrial genome
            Length = 435

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.5e-11, P = 3.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334243 C80504 C80504 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=585 Author_cmt:
            Mouse mitochondrial genome
            Length = 585

  Minus Strand HSPs:

 Score = 376 (56.4 bits), Expect = 3.6e-11, P = 3.6e-11
 Identities = 142/202 (70%), Positives = 142/202 (70%), Strand = Minus / Plus

Query:   202 TAATATTAATATTA-ATCATATTATTAA-AATCTATATTTCTTATATTAGGTCCTTTCGT 145
             TAA ATTAA  T A A C   TTATT   AA  T   T T TT T T   GTCCTTTCGT
Sbjct:    52 TAA-ATTAAGTTGAGAGCGC-TTATTTGTAAGGTGGCTCTATT-TCTCTCGTCCTTTCGT 108

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTC
Sbjct:   109 ACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTC 164

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAA 27
             AGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTCTACACC A  
Sbjct:   165 AGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATT 222

Query:    26 AATAACTCTTAATCCAACATCGAGGT 1
                A  TC T ATCCAACATCGAGGT
Sbjct:   223 GGGATGTCCTGATCCAACATCGAGGT 248


>cbil|dbest|1333915 C80176 C80176 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=578 Author_cmt:
            Mouse mitochondrial genome
            Length = 578

  Minus Strand HSPs:

 Score = 376 (56.4 bits), Expect = 3.6e-11, P = 3.6e-11
 Identities = 142/202 (70%), Positives = 142/202 (70%), Strand = Minus / Plus

Query:   202 TAATATTAATATTA-ATCATATTATTAA-AATCTATATTTCTTATATTAGGTCCTTTCGT 145
             TAA ATTAA  T A A C   TTATT   AA  T   T T TT T T   GTCCTTTCGT
Sbjct:    52 TAA-ATTAAGTTGAGAGCGC-TTATTTGTAAGGTGGCTCTATT-TCTCTCGTCCTTTCGT 108

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTC
Sbjct:   109 ACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTC 164

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAA 27
             AGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTCTACACC A  
Sbjct:   165 AGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATT 222

Query:    26 AATAACTCTTAATCCAACATCGAGGT 1
                A  TC T ATCCAACATCGAGGT
Sbjct:   223 GGGATGTCCTGATCCAACATCGAGGT 248


>cbil|dbest|1333105 C79366 C79366 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=575 Author_cmt:
            Mouse mitochondrial genome
            Length = 575

  Minus Strand HSPs:

 Score = 376 (56.4 bits), Expect = 3.6e-11, P = 3.6e-11
 Identities = 142/202 (70%), Positives = 142/202 (70%), Strand = Minus / Plus

Query:   202 TAATATTAATATTA-ATCATATTATTAA-AATCTATATTTCTTATATTAGGTCCTTTCGT 145
             TAA ATTAA  T A A C   TTATT   AA  T   T T TT T T   GTCCTTTCGT
Sbjct:    54 TAA-ATTAAGTTGAGAGCGC-TTATTTGCAAGGTGGCTCTATT-TCTCTTGTCCTTTCGT 110

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTC
Sbjct:   111 ACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTC 166

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAA 27
             AGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTCTACACC A  
Sbjct:   167 AGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATT 224

Query:    26 AATAACTCTTAATCCAACATCGAGGT 1
                A  TC T ATCCAACATCGAGGT
Sbjct:   225 GGGATGTCCTGATCCAACATCGAGGT 250


>cbil|dbest|1333701 C79962 C79962 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=410 Author_cmt:
            Mouse mitochondrial genome
            Length = 410

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.7e-11, P = 3.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330624 C76885 C76885 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=404 Author_cmt:
            Mouse mitochondrial genome
            Length = 404

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.8e-11, P = 3.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1334066 C80327 C80327 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=367 Author_cmt:
            Mouse mitochondrial genome
            Length = 367

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 4.2e-11, P = 4.2e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1334515 C80776 C80776 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=359 Author_cmt:
            Mouse mitochondrial genome
            Length = 359

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 4.2e-11, P = 4.2e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1053227 AA408192 EST02857 3'
            Lib=856[Mus_musculus|embryo|ectoplacental_cone|||embryonic_day_7.5_
            postconception] Length=354 Author_cmt: Mouse mitochondrial genome.
            >gb, score = 1760
            Length = 354

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 4.3e-11, P = 4.3e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1334553 C80814 C80814 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=352 Author_cmt:
            Mouse mitochondrial genome
            Length = 352

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 4.3e-11, P = 4.3e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1330364 C76625 C76625 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=637 Author_cmt:
            Mouse mitochondrial genome
            Length = 637

  Minus Strand HSPs:

 Score = 373 (56.0 bits), Expect = 4.5e-11, P = 4.5e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTA-GACTTTA 180

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   181 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 238

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   239 ATCGAGGT 246


>cbil|dbest|1334998 C81259 C81259 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=335 Author_cmt:
            Mouse mitochondrial genome
            Length = 335

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 4.6e-11, P = 4.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1335349 C81610 C81610 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=314 Author_cmt:
            Mouse mitochondrial genome
            Length = 314

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 4.9e-11, P = 4.9e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1335357 C81618 C81618 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=314 Author_cmt:
            Mouse mitochondrial genome
            Length = 314

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 4.9e-11, P = 4.9e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1333993 C80254 C80254 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=584 Author_cmt:
            Mouse mitochondrial genes coding for three transfer RNAs
            Length = 584

  Minus Strand HSPs:

 Score = 373 (56.0 bits), Expect = 4.9e-11, P = 4.9e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTA-GACTTTA 180

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   181 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 238

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   239 ATCGAGGT 246


>cbil|dbest|1331784 C78045 C78045 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=519 Author_cmt:
            Mouse mitochondrial genome
            Length = 519

  Minus Strand HSPs:

 Score = 374 (56.1 bits), Expect = 4.9e-11, P = 4.9e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   101 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCNCCG 156

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   157 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 215

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   216 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 250


>cbil|dbest|1333667 C79928 C79928 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=602 Author_cmt:
            Mouse mitochondrial genome
            Length = 602

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 5.2e-11, P = 5.2e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   103 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 158

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   159 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 217

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   218 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 252


>cbil|dbest|1332498 C78759 C78759 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=601 Author_cmt:
            Mouse mitochondrial genome
            Length = 601

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 5.3e-11, P = 5.3e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   104 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 159

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   160 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 218

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   219 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 253


>cbil|dbest|1330511 C76772 C76772 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=594 Author_cmt:
            Mouse mitochondrial genome
            Length = 594

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 5.3e-11, P = 5.3e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   101 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 156

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   157 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 215

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   216 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 250


>cbil|dbest|1327678 C76399 C76399 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=589 Author_cmt:
            Mouse mitochondrial genome
            Length = 589

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 5.4e-11, P = 5.4e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   107 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 162

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   163 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 221

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   222 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 256


>cbil|dbest|1330470 C76731 C76731 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=589 Author_cmt:
            Mouse mitochondrial genome
            Length = 589

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 5.4e-11, P = 5.4e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   101 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 156

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   157 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 215

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   216 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 250


>cbil|dbest|1334397 C80658 C80658 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=284 Author_cmt:
            Mouse mitochondrial genome
            Length = 284

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 5.4e-11, P = 5.4e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    66 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 121

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   122 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 178

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   179 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 236

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   237 ATCGAGGT 244


>cbil|dbest|1334085 C80346 C80346 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=472 Author_cmt:
            Mus domesticus hydrophobic protein mRNA sequence
            Length = 472

  Minus Strand HSPs:

 Score = 374 (56.1 bits), Expect = 5.4e-11, P = 5.4e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   106 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCNCCG 161

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   162 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 220

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   221 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 255


>cbil|dbest|1331073 C77334 C77334 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=569 Author_cmt:
            Mouse mitochondrial genome
            Length = 569

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 5.5e-11, P = 5.5e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:    64 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 119

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   120 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 178

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   179 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 213


>cbil|dbest|1334674 C80935 C80935 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=269 Author_cmt:
            Mouse mitochondrial genome
            Length = 269

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 5.7e-11, P = 5.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    74 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 129

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   130 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 186

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   187 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 244

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   245 ATCGAGGT 252


>cbil|dbest|1334319 C80580 C80580 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=267 Author_cmt:
            Mouse mitochondrial genome
            Length = 267

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 5.7e-11, P = 5.7e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1332505 C78766 C78766 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=549 Author_cmt:
            Mouse mitochondrial genome
            Length = 549

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 5.8e-11, P = 5.8e-11
 Identities = 132/186 (70%), Positives = 132/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTANGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC   ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCGGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1331238 C77499 C77499 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=264 Author_cmt:
            Mouse mitochondrial genome
            Length = 264

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 5.8e-11, P = 5.8e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1332608 C78869 C78869 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=479 Author_cmt:
            Mouse mitochondrial genome
            Length = 479

  Minus Strand HSPs:

 Score = 373 (56.0 bits), Expect = 5.9e-11, P = 5.9e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTA-GACTTTA 180

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   181 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 238

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   239 ATCGAGGT 246


>cbil|dbest|1331914 C78175 C78175 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=248 Author_cmt:
            Mouse mitochondrial genome
            Length = 248

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 6.1e-11, P = 6.1e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    56 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 111

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   112 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 168

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   169 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 226

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   227 ATCGAGGT 234


>cbil|dbest|1333802 C80063 C80063 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=495 Author_cmt:
            Mouse mitochondrial genome
            Length = 495

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 6.4e-11, P = 6.4e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:    98 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 153

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   154 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 212

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   213 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 247


>cbil|dbest|1332483 C78744 C78744 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=444 Author_cmt:
            Mouse mitochondrial genome
            Length = 444

  Minus Strand HSPs:

 Score = 373 (56.0 bits), Expect = 6.4e-11, P = 6.4e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTA-GACTTTA 186

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   187 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 244

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   245 ATCGAGGT 252


>cbil|dbest|1332418 C78679 C78679 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=462 Author_cmt:
            Mouse mitochondrial genome
            Length = 462

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 6.8e-11, P = 6.8e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   104 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 159

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   160 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 218

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   219 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 253


>cbil|dbest|1331680 C77941 C77941 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=604 Author_cmt:
            Mouse mitochondrial genome
            Length = 604

  Minus Strand HSPs:

 Score = 369 (55.4 bits), Expect = 7.1e-11, P = 7.1e-11
 Identities = 131/184 (71%), Positives = 131/184 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAG 3
             ATCGAG
Sbjct:   246 ATCGAG 251


>cbil|dbest|1333679 C79940 C79940 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=440 Author_cmt:
            Mouse mitochondrial genome
            Length = 440

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.2e-11, P = 7.2e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   101 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 156

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   157 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 215

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   216 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 250


>cbil|dbest|1333520 C79781 C79781 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=568 Author_cmt:
            Mouse mitochondrial genome
            Length = 568

  Minus Strand HSPs:

 Score = 369 (55.4 bits), Expect = 7.6e-11, P = 7.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    78 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 133

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   134 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 190

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAA- 10
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAA 
Sbjct:   191 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAA 248

Query:     9 CATCGAGGT 1
             CATCGAGGT
Sbjct:   249 CATCGAGGT 257


>cbil|dbest|1335158 C81419 C81419 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=486 Author_cmt:
            Mouse mitochondrial genome
            Length = 486

  Minus Strand HSPs:

 Score = 370 (55.5 bits), Expect = 8.0e-11, P = 8.0e-11
 Identities = 132/186 (70%), Positives = 132/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGA ACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGACACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1330588 C76849 C76849 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=376 Author_cmt:
            Mouse mitochondrial genome
            Length = 376

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 8.4e-11, P = 8.4e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:    98 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 153

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   154 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 212

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   213 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 247


>cbil|dbest|1331993 C78254 C78254 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=601 Author_cmt:
            Mouse mitochondrial genome
            Length = 601

  Minus Strand HSPs:

 Score = 367 (55.1 bits), Expect = 8.8e-11, P = 8.8e-11
 Identities = 141/202 (69%), Positives = 141/202 (69%), Strand = Minus / Plus

Query:   202 TAATATTAATATTA-ATCATATTATTAA-AATCTATATTTCTTATATTAGGTCCTTTCGT 145
             TAA ATTAA  T A A C   TTATT   AA  T   T T TT  A T G TCCTTT GT
Sbjct:    51 TAA-ATTAAGTTGAGAGCGC-TTATTTGTAAGGTGGCTCTATTTCACTTG-TCCTTTTGT 107

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTC
Sbjct:   108 ACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTC 163

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAA 27
             AGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTCTACACC A  
Sbjct:   164 AGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATT 221

Query:    26 AATAACTCTTAATCCAACATCGAGGT 1
                A  TC T ATCCAACATCGAGGT
Sbjct:   222 GGGATGTCCTGATCCAACATCGAGGT 247


>cbil|dbest|1389905 AA683770 vr02g05.r1 5'
            Lib=875[Mus_musculus|embryo|blastocyst|||embryo_(pre-implantation)]
            Length=426
            Length = 426

  Plus Strand HSPs:

 Score = 370 (55.5 bits), Expect = 9.1e-11, P = 9.1e-11
 Identities = 132/186 (70%), Positives = 132/186 (70%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTGTAGAAG T TTAA G TT G T TGT
Sbjct:   183 ACCTCGATGTTGGATCAGGACATCCCAAT-GGTGTAGAAGCTATTAATGGTTCGTT-TGT 240

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT  A TC TAC TGATCTGAGTTCA ACCGG G AA CCAGGT GGTTTCTA
Sbjct:   241 TCAACGATTAGAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTA 300

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTA 178
             TC T A TTA   ATT T T   AGTACGAAAGGAC  AA A A GA A A   A  TTA
Sbjct:   301 TC-T-ATTTACG-ATT-TCTCCCAGTACGAAAGGAC--AAGAGA-GATAGAGCCACCTTA 353

Query:   179 ATAATATG 186
               AATA G
Sbjct:   354 CAAATAAG 361


>cbil|dbest|1331285 C77546 C77546 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=638 Author_cmt:
            Mouse mitochondrial genes coding for three transfer RNAs
            Length = 638

  Minus Strand HSPs:

 Score = 366 (54.9 bits), Expect = 9.2e-11, P = 9.2e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   101 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 156

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   157 GTCTGAACTCAGATCACGTA-GACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 214

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   215 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 249


>cbil|dbest|1144519 AA499889 vj40h12.r1 5'
            Lib=498[Mus_musculus|skin|whole_skin|||11_weeks_old] Length=451
            Length = 451

  Plus Strand HSPs:

 Score = 369 (55.4 bits), Expect = 9.6e-11, P = 9.6e-11
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTGTAGAAG T TTAA G TT G T TGT
Sbjct:   250 ACCTCGATGTTGGATCAGGACATCCCAAT-GGTGTAGAAGCTATTAATGGTTCGTT-TGT 307

Query:    59 TCGACCT-TTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCT 117
             TC AC   TT AA TC TAC TGATCTGAGTTCA ACCGG G AA CCAGGT GGTTTCT
Sbjct:   308 TCAACGGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCT 367

Query:   118 ATCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTT 177
             ATC T A TTA   ATT T T   AGTACGAAAGGAC  AA A AA A A A   A  TT
Sbjct:   368 ATC-T-ATTTACG-ATT-TCTCCCAGTACGAAAGGAC--AAGAGAA-ATAGAGCCACCTT 420

Query:   178 AATAATATG 186
             A  AATA G
Sbjct:   421 ACAAATAAG 429


>cbil|dbest|1330512 C76773 C76773 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=594 Author_cmt:
            Mouse mitochondrial genome
            Length = 594

  Minus Strand HSPs:

 Score = 366 (54.9 bits), Expect = 9.9e-11, P = 9.9e-11
 Identities = 116/154 (75%), Positives = 116/154 (75%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   101 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 156

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   157 GTCTGAACTCAGATCACGTA-GACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 214

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   215 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 249


>cbil|dbest|1327616 C76337 C76337 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=389 Author_cmt:
            Mouse mitochondrial genome
            Length = 389

  Minus Strand HSPs:

 Score = 370 (55.5 bits), Expect = 1.0e-10, P = 1.0e-10
 Identities = 132/186 (70%), Positives = 132/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATC  GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCGCGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327622 C76343 C76343 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=587 Author_cmt:
            Mouse mitochondrial genome
            Length = 587

  Minus Strand HSPs:

 Score = 365 (54.8 bits), Expect = 1.1e-10, P = 1.1e-10
 Identities = 115/154 (74%), Positives = 115/154 (74%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCG ACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:    98 GTCCTTTCGNACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 153

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   154 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 212

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   213 TACACC-ATTGGGATGTCCTGATCCAACATCGAGGT 247


>cbil|dbest|1334824 C81085 C81085 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=580 Author_cmt:
            Mouse mitochondrial genome
            Length = 580

  Minus Strand HSPs:

 Score = 365 (54.8 bits), Expect = 1.1e-10, P = 1.1e-10
 Identities = 131/186 (70%), Positives = 131/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGA ACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT  
Sbjct:   131 AT--AG-ATAGANACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTN 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   246 ATCGAGGT 253


>cbil|dbest|1332037 C78298 C78298 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=368 Author_cmt:
            Mouse mitochondrial genome
            Length = 368

  Minus Strand HSPs:

 Score = 369 (55.4 bits), Expect = 1.2e-10, P = 1.2e-10
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTA-CACCTAAAAATAACTCTTAATCCAA 10
             A  GT GAACA AC  AA C TTAA A CTTCTA CACC A     A  TC T ATCCAA
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTAACACC-ATTGGGATGTCCTGATCCAA 239

Query:     9 CATCGAGGT 1
             CATCGAGGT
Sbjct:   240 CATCGAGGT 248


>cbil|dbest|344870 R95556 SMNHADA007066SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=320
            Length = 320

  Plus Strand HSPs:

 Score = 370 (55.5 bits), Expect = 1.2e-10, P = 1.2e-10
 Identities = 142/201 (70%), Positives = 142/201 (70%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ACCTCGATGTTGG TT    G    TTTT GGTGTAGA G T  AA    A GTCTGTTC
Sbjct:   127 ACCTCGATGTTGGCTTGTT-GAACCTTTTCGGTGTAGAGGCTGGAAAAGGAAGTCTGTTC 185

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTATC 120
             GAC TTT AAT CTT CATGA  TGAGTT A ACCGG GTAAGCCAGGTTGGTT  TATC
Sbjct:   186 GACTTTTAAAT-CTT-CATGAGTTGAGTTAAGACCGGTGTAAGCCAGGTTGGTTCTTATC 243

Query:   121 CTTAATTAATTA-TTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTAA 179
              T A  TAATT   T TG T TAGTACGAAAGGA  TA T TA GA A A  G TT T  
Sbjct:   244 -T-A--TAATTGGNTCTGAT-TAGTACGAAAGGAT-TA-T-TAGGATACAGTGTTTCTG- 294

Query:   180 TAA-TATGATTAATATTAA-TATT 201
             TA  T T A  AATA  AA TATT
Sbjct:   295 TACGTNT-AGGAATAGGAAGTATT 317

 Score = 360 (54.0 bits), Expect = 3.4e-10, P = 3.4e-10
 Identities = 118/160 (73%), Positives = 118/160 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAGTTTAAAGTTTAGGTCTGTTC 60
             ACCTCGATGTTGG TT    G    TTTT GGTGTAGA G T  AA    A GTCTGTTC
Sbjct:   127 ACCTCGATGTTGGCTTGTT-GAACCTTTTCGGTGTAGAGGCTGGAAAAGGAAGTCTGTTC 185

Query:    61 GACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTATC 120
             GAC TTT AAT CTT CATGA  TGAGTT A ACCGG GTAAGCCAGGTTGGTT  TATC
Sbjct:   186 GACTTTTAAAT-CTT-CATGAGTTGAGTTAAGACCGGTGTAAGCCAGGTTGGTTCTTATC 243

Query:   121 CTTAATTAATTA-TTATGTTATAGTACGAAAGGACCTAATA 160
               TA  TAATT   T TG T TAGTACGAAAGGA  TA TA
Sbjct:   244 --TA--TAATTGGNTCTGAT-TAGTACGAAAGGAT-TATTA 278


>cbil|dbest|909536 AA268547 va05g12.r1 5'
            Lib=567[Mus_musculus|lymph_node|lymph_node|||4_weeks] Length=234
            Length = 234

  Plus Strand HSPs:

 Score = 373 (56.0 bits), Expect = 1.2e-10, P = 1.2e-10
 Identities = 133/186 (71%), Positives = 133/186 (71%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T    T  GGTGTAGAAG T TTAA G TT G T TGT
Sbjct:     4 ACCTCGATGTTGGATCAGGACATCCAAT--GGTGTAGAAGCTATTAATGGTTCGTT-TGT 60

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG G AA CCAGGT GGTTTCTA
Sbjct:    61 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTA 120

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTA 178
             TC T A TTA   ATT T T   AGTACGAAAGGAC  AA A AA A A A   A  TTA
Sbjct:   121 TC-T-ATTTACG-ATT-TCTCCCAGTACGAAAGGAC--AAGAGAA-ATAGAGCCACCTTA 173

Query:   179 ATAATATG 186
               AATA G
Sbjct:   174 CAAATAAG 181


>cbil|dbest|1330472 C76733 C76733 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=533 Author_cmt:
            Mouse mitochondrial genome
            Length = 533

  Minus Strand HSPs:

 Score = 365 (54.8 bits), Expect = 1.2e-10, P = 1.2e-10
 Identities = 131/186 (70%), Positives = 131/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAG T A GTA GA TT A
Sbjct:   128 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGNTNACGTAGGACTTTA 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1175328 AA530688 vj50b02.r1 5'
            Lib=509[Mus_musculus|heart|heart|||13_day_embryos] Length=574
            Length = 574

  Plus Strand HSPs:

 Score = 364 (54.6 bits), Expect = 1.3e-10, P = 1.3e-10
 Identities = 132/186 (70%), Positives = 132/186 (70%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGT GGAT A GA  T     T GGTGTAGAAG T TTAA G TT G T TGT
Sbjct:   306 ACCTCGATGT-GGATCAGGACATCCCAAT-GGTGTAGAAGCTATTAATGGTTCGTT-TGT 362

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG G AA CCAGGT GGTTTCTA
Sbjct:   363 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTA 422

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTA 178
             TC T A TTA   ATT T T   AGTACGAAAGGAC  AA A AA A A A   A  TTA
Sbjct:   423 TC-T-ATTTACG-ATT-TCTCCCAGTACGAAAGGAC--AAGAGAA-ATAGAGCCACCTTA 475

Query:   179 ATAATATG 186
               AATA G
Sbjct:   476 CAAATAAG 483


>cbil|dbest|1327428 C76149 C76149 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=549 Author_cmt:
            Mouse mitochondrial genome
            Length = 549

  Minus Strand HSPs:

 Score = 364 (54.6 bits), Expect = 1.3e-10, P = 1.3e-10
 Identities = 132/186 (70%), Positives = 132/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A  AT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA--ATCGTAA 123

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   124 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 180

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   181 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 238

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   239 ATCGAGGT 246


>cbil|dbest|1331590 C77851 C77851 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=296 Author_cmt:
            Mouse mitochondrial genes coding for three transfer RNAs
            Length = 296

  Minus Strand HSPs:

 Score = 368 (55.2 bits), Expect = 1.6e-10, P = 1.6e-10
 Identities = 134/186 (72%), Positives = 134/186 (72%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATA-ACATAATAATT 128
             C TATT  TAA  T   T T T TT T TT  G CCTTTCGTACT    ACA AAT  T 
Sbjct:    53 CNTATTTGTAAGGTGGCTCTAT-TTCTCTT--GNCCTTTCGTACTGGGCACA-AATCGTA 108

Query:   127 AATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTC 68
             AAT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT 
Sbjct:   109 AAT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTT 165

Query:    67 AAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACC-TAAAAATAACTCTTAATCCA 11
             AA  GT GAACA AC  AA C TTAA A CTTCTACACC T    AT  C CT A TCCA
Sbjct:   166 AATCGTTGAACAAACG-AACCATTAATAGCTTCTACACCATTGGGATGNC-CTGA-TCCA 222

Query:    10 ACATCGAGGT 1
             ACATCGAGGT
Sbjct:   223 ACATCGAGGT 232


>cbil|dbest|1332518 C78779 C78779 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=323 Author_cmt:
            Mouse mitochondrial genome
            Length = 323

  Minus Strand HSPs:

 Score = 367 (55.1 bits), Expect = 1.6e-10, P = 1.6e-10
 Identities = 131/185 (70%), Positives = 131/185 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTC ACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCNACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGG 2
             ATCGAGG
Sbjct:   240 ATCGAGG 246


>cbil|dbest|1327301 C76022 C76022 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=576 Author_cmt:
            Mouse mitochondrial genome
            Length = 576

  Minus Strand HSPs:

 Score = 360 (54.0 bits), Expect = 1.9e-10, P = 1.9e-10
 Identities = 132/186 (70%), Positives = 132/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATA-ACATAATAATT 128
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT    A A AAT  T 
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGGAGA-AATCGTA 124

Query:   127 AATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTC 68
             AAT  AG ATAGAAACC ACCTGG TT C CCGGT T AACTCAGATCA GTA GA TT 
Sbjct:   125 AAT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTAAACTCAGATCACGTAGGACTTT 181

Query:    67 AAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAA 10
             AA  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAA
Sbjct:   182 AATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAA 239

Query:     9 CATCGAGGT 1
             CATCGAGGT
Sbjct:   240 CATCGAGGT 248


>cbil|dbest|1332887 C79148 C79148 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=342 Author_cmt:
            Mouse mitochondrial genome
            Length = 342

  Minus Strand HSPs:

 Score = 365 (54.8 bits), Expect = 1.9e-10, P = 1.9e-10
 Identities = 115/154 (74%), Positives = 115/154 (74%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:   106 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 161

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   162 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 220

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TACACC A     A  TC T ATCCAACATCG GGT
Sbjct:   221 TACACC-ATTGGGATGTCCTGATCCAACATCGNGGT 255


>cbil|dbest|1327426 C76147 C76147 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=632 Author_cmt:
            Mouse mitochondrial genome
            Length = 632

  Minus Strand HSPs:

 Score = 358 (53.7 bits), Expect = 2.1e-10, P = 2.1e-10
 Identities = 132/186 (70%), Positives = 132/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A  AT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA--ATCGTAA 123

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   124 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTA-GACTTTA 179

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   180 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 237

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   238 ATCGAGGT 245

 Score = 355 (53.3 bits), Expect = 2.9e-10, P = 2.9e-10
 Identities = 141/202 (69%), Positives = 141/202 (69%), Strand = Minus / Plus

Query:   202 TAATATTAATATTA-ATCATATTATTAA-AATCTATATTTCTTATATTAGGTCCTTTCGT 145
             TAA ATTAA  T A A C   TTATT   AA  T   T T TT T T   GTCCTTTCGT
Sbjct:    51 TAA-ATTAAGTTGAGAGCGC-TTATTTGTAAGGTGGCTCTATT-TCTCTTGTCCTTTCGT 107

Query:   144 ACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTC 85
             ACT   A A  AT  T AAT A  GATAGAAACC ACCTGG TT C CCGGT TGAACTC
Sbjct:   108 ACTGGGAGA--ATCGTAAAT-A--GATAGAAACCGACCTGGATTGCTCCGGTCTGAACTC 162

Query:    84 AGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAA 27
             AGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTCTACACC A  
Sbjct:   163 AGATCACGTA-GACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATT 219

Query:    26 AATAACTCTTAATCCAACATCGAGGT 1
                A  TC T ATCCAACATCGAGGT
Sbjct:   220 GGGATGTCCTGATCCAACATCGAGGT 245


>cbil|dbest|1205967 AA555599 ZF-E274 5' Lib=356[Danio_rerio|||||] Length=218
            Length = 218

  Plus Strand HSPs:

 Score = 368 (55.2 bits), Expect = 2.2e-10, P = 2.2e-10
 Identities = 118/160 (73%), Positives = 118/160 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T  T  T GGTG AG  G T TTAA G TT G T TGT
Sbjct:     3 ACCTCGATGTTGGATCAGGACATCCTAAT-GGTGCAGCCGCTATTAAGGGTTCGTT-TGT 60

Query:    59 TCGACCTTTGA-ATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCT 117
             TC AC  TT A A TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT  GTTTCT
Sbjct:    61 TCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCAGTTTCT 120

Query:   118 ATCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATA 160
             ATC  TAA  A  TATT T T  TAGTACGAAAGGA C AA A
Sbjct:   121 ATCTGTAA--AGCTATTTTTTCCTAGTACGAAAGGATCGAAAA 161


>cbil|dbest|1334749 C81010 C81010 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=352 Author_cmt:
            Mouse mitochondrial genome
            Length = 352

  Minus Strand HSPs:

 Score = 363 (54.5 bits), Expect = 2.3e-10, P = 2.3e-10
 Identities = 131/186 (70%), Positives = 131/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    72 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 127

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGA ACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT  
Sbjct:   128 AT--AG-ATAGACACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTN 184

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   185 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 242

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   243 ATCGAGGT 250


>cbil|dbest|1327539 C76260 C76260 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=518 Author_cmt:
            Mouse mitochondrial genome
            Length = 518

  Minus Strand HSPs:

 Score = 358 (53.7 bits), Expect = 2.6e-10, P = 2.6e-10
 Identities = 128/182 (70%), Positives = 128/182 (70%), Strand = Minus / Plus

Query:   182 TTATTAA-AATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTAATT 124
             TTATT   AA  T   T TC T T T   GTCCTTTCGTACT     A AAT  T AAT 
Sbjct:    72 TTATTTGTAAGGTGGCTCTCATTTCTCTTGTCCTTTCGTACTGGGCGA-AATCGTAAAT- 129

Query:   123 AAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAG 64
              AG ATAGAAACC ACCTGG TT   CCGGT TGAACTCAGATCA GTA GA TT AA  
Sbjct:   130 -AG-ATAGAAACCGACCTGGATTGGTCCGGTCTGAACTCAGATCACGTAGGACTTTAATC 187

Query:    63 GTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATC 6
             GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAACATC
Sbjct:   188 GTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAACATC 245

Query:     5 GAGGT 1
             GAGGT
Sbjct:   246 GAGGT 250


>cbil|dbest|1330535 C76796 C76796 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=244 Author_cmt:
            Mouse mitochondrial genome
            Length = 244

  Minus Strand HSPs:

 Score = 364 (54.6 bits), Expect = 3.0e-10, P = 3.0e-10
 Identities = 130/183 (71%), Positives = 130/183 (71%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   125 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGA 4
             ATCGA
Sbjct:   240 ATCGA 244


>cbil|dbest|1331156 C77417 C77417 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=388 Author_cmt:
            Mouse mitochondrial genome
            Length = 388

  Minus Strand HSPs:

 Score = 359 (53.9 bits), Expect = 3.1e-10, P = 3.1e-10
 Identities = 141/202 (69%), Positives = 141/202 (69%), Strand = Minus / Plus

Query:   202 TAATATTAATATTA-A-T-CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCG 146
             TAA ATTAA  T A A   C TATT  TAA      T T T TT T TT  GTCCTTTCG
Sbjct:    57 TAA-ATTAAGTTGAGAGNGCTTATTTGTAAGGNGGCTCTAT-TTCTCTT--GTCCTTTCG 112

Query:   145 TACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACT 86
             TACT   A A AAT  T AAT  AG ATAGA ACC ACCTGG TT C CCGGT TGAACT
Sbjct:   113 TACTGGGAGA-AATCGTAAAT--AG-ATAGANACCGACCTGGATTGCTCCGGTCTGAACT 168

Query:    85 CAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAA 28
             CAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTCTACACC A 
Sbjct:   169 CAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-AT 226

Query:    27 AAATAACTCTTAATCCAACATCGAGGT 1
                 A  TC T ATC AACATCGAGGT
Sbjct:   227 TGGGATGTCCTGATCNAACATCGAGGT 253


>cbil|dbest|1050741 F22569 HSPD07403 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=426
            Length = 426

  Plus Strand HSPs:

 Score = 357 (53.6 bits), Expect = 3.5e-10, P = 3.5e-10
 Identities = 121/164 (73%), Positives = 121/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   178 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 235

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   236 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 295

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT   T  T GTACGAAAGGAC   A A ATAAG
Sbjct:   296 TC-T-ACTTCAA-ATTCC-TCCTTGTACGAAAGGACAAGAGAAATAAG 339


>cbil|dbest|724171 AA087873 mn97b10.r1 5'
            Lib=526[Mus_musculus|lung|lung|||6-8_month_old] Length=200
            Length = 200

  Plus Strand HSPs:

 Score = 364 (54.6 bits), Expect = 3.6e-10, P = 3.6e-10
 Identities = 130/183 (71%), Positives = 130/183 (71%), Strand = Plus / Plus

Query:     4 TCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGTTCG 61
             TCGATGTTGGAT A GA  T     T GGTGTAGAAG T TTAA G TT G T TGTTC 
Sbjct:     1 TCGATGTTGGATCAGGACATCCCAAT-GGTGTAGAAGCTATTAATGGTTCGTT-TGTTCA 58

Query:    62 ACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTATCC 121
             AC  TT AA TC TAC TGATCTGAGTTCA ACCGG G AA CCAGGT GGTTTCTATC 
Sbjct:    59 ACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATC- 117

Query:   122 TTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTAATA 181
             T A TTA   ATT T T   AGTACGAAAGGAC  AA A AA A A A   A  TTA  A
Sbjct:   118 T-ATTTACG-ATT-TCTCCCAGTACGAAAGGAC--AAGAGAA-ATAGAGCCACCTTACAA 171

Query:   182 ATATG 186
             ATA G
Sbjct:   172 ATAAG 176


>cbil|dbest|1334788 C81049 C81049 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=541 Author_cmt:
            Mouse mitochondrial genome
            Length = 541

  Minus Strand HSPs:

 Score = 354 (53.1 bits), Expect = 3.8e-10, P = 3.8e-10
 Identities = 130/186 (69%), Positives = 130/186 (69%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A A T  T A
Sbjct:    69 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGANA-TCGTAA 124

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGA ACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT  
Sbjct:   125 AT--AG-ATAGACACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTC 181

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   182 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 239

Query:     8 ATCGAGGT 1
             ATCGAGGT
Sbjct:   240 ATCGAGGT 247


>cbil|dbest|1327449 C76170 C76170 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=484 Author_cmt:
            Mouse mitochondrial genes coding for three transfer RNAs
            Length = 484

  Minus Strand HSPs:

 Score = 355 (53.3 bits), Expect = 3.8e-10, P = 3.8e-10
 Identities = 131/186 (70%), Positives = 131/186 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    73 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 128

Query:   126 ATTAAGGATAGAAACCAACCTGGC-TTACGCCGGTTTGAACTCAGATCATGTAAGAATTC 68
             AT  AG ATAGAAACC ACCTGG  TT C CCGGT TGAACTCAGATCA GTA GA TT 
Sbjct:   129 AT--AG-ATAGAAACCGACCTGGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTT 185

Query:    67 AAAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAA 10
             AA  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAA
Sbjct:   186 AATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAA 243

Query:     9 CATCGAGGT 1
              ATCG GGT
Sbjct:   244 NATCGNGGT 252


>cbil|dbest|1048844 F20672 HSPD05050 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=343
            Length = 343

  Plus Strand HSPs:

 Score = 357 (53.6 bits), Expect = 4.4e-10, P = 4.4e-10
 Identities = 121/164 (73%), Positives = 121/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGATTA GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   134 ACCTCGATGTTGGATTAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 191

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   192 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 251

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   252 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 295


>cbil|dbest|1331436 C77697 C77697 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=249 Author_cmt:
            Mouse mitochondrial genome
            Length = 249

  Minus Strand HSPs:

 Score = 359 (53.9 bits), Expect = 4.9e-10, P = 4.9e-10
 Identities = 129/182 (70%), Positives = 129/182 (70%), Strand = Minus / Plus

Query:   186 CATATTATTAAAATCTATATTTCTTATATTAGGTCCTTTCGTACTATAACATAATAATTA 127
             C TATT  TAA  T   T T T TT T TT  GTCCTTTCGTACT   A A AAT  T A
Sbjct:    75 CTTATTTGTAAGGTGGCTCTAT-TTCTCTT--GTCCTTTCGTACTGGGAGA-AATCGTAA 130

Query:   126 ATTAAGGATAGAAACCAACCTGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCA 67
             AT  AG ATAGAAACC ACCTGG TT C CCGGT TGAACTCAGATCA GTA GA TT A
Sbjct:   131 AT--AG-ATAGAAACCGACCTGGATTGCTCCGGTCTGAACTCAGATCACGTAGGACTTTA 187

Query:    66 AAGGTCGAACAGACCTAAACTTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAAC 9
             A  GT GAACA AC  AA C TTAA A CTTCTACACC A     A  TC T ATCCAAC
Sbjct:   188 ATCGTTGAACAAACG-AACCATTAATAGCTTCTACACC-ATTGGGATGTCCTGATCCAAC 245

Query:     8 ATCG 5
             ATCG
Sbjct:   246 ATCG 249


>cbil|dbest|1049453 F21281 HSPD05773 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=374
            Length = 374

  Plus Strand HSPs:

 Score = 354 (53.1 bits), Expect = 5.5e-10, P = 5.5e-10
 Identities = 114/154 (74%), Positives = 114/154 (74%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T  T  T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   221 ACCTCGATGTTGGATCAGGACATCCTGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 278

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   279 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 338

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGAC 154
             TC T A TT A  ATT      T GTACGAAAGGAC
Sbjct:   339 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGAC 370


>cbil|dbest|1048630 F20458 HSPD04801 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=464
            Length = 464

  Plus Strand HSPs:

 Score = 351 (52.7 bits), Expect = 6.0e-10, P = 6.0e-10
 Identities = 121/164 (73%), Positives = 121/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   270 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 327

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   328 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 387

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT T    T GTACGAAAGGAC   A A ATAAG
Sbjct:   388 TC-T-ACTTCAA-ATTCTCCC-T-GTACGAAAGGACAAGAGAAATAAG 430


>cbil|dbest|1332146 C78407 C78407 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=244 Author_cmt:
            Mouse mitochondrial genome
            Length = 244

  Minus Strand HSPs:

 Score = 357 (53.6 bits), Expect = 6.2e-10, P = 6.2e-10
 Identities = 113/151 (74%), Positives = 113/151 (74%), Strand = Minus / Plus

Query:   154 GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACCTGGCTTACGCCG 95
             GTCCTTTCGTACT   A A AAT  T AAT  AG ATAGAAACC ACCTGG TT C CCG
Sbjct:    98 GTCCTTTCGTACTGGGAGA-AATCGTAAAT--AG-ATAGAAACCGACCTGGATTGCTCCG 153

Query:    94 GTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAACTTTAA-A-CTTC 37
             GT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C TTAA A CTTC
Sbjct:   154 GTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACCATTAATAGCTTC 212

Query:    36 TACACCTAAAAATAACTCTTAATCCAACATCGA 4
             TACACC A     A  TC T ATCCAACATCGA
Sbjct:   213 TACACC-ATTGGGATGTCCTGATCCAACATCGA 244


>cbil|dbest|1050786 F22614 HSPD07455 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=499
            Length = 499

  Plus Strand HSPs:

 Score = 350 (52.5 bits), Expect = 6.2e-10, P = 6.2e-10
 Identities = 124/172 (72%), Positives = 124/172 (72%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   324 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 381

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   382 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 441

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAG 172
             TC T A TT A  ATT      T GTACGAAAGGAC  AA A   GAAATA AG
Sbjct:   442 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGAC--AANAG--GAAATAAAG 487


>cbil|dbest|739190 AA100034 zn37c11.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=567
            Length = 567

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 6.8e-10, P = 6.8e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    97 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 152

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   153 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 211

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   212 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 258


>cbil|dbest|1277555 Z98526 HSZ98526 
            Lib=1003[Homo_sapiens||subthalamic_nucleus|||adult] Length=421
            Length = 421

  Plus Strand HSPs:

 Score = 350 (52.5 bits), Expect = 7.4e-10, P = 7.4e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   249 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 306

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   307 TCAACNATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 366

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   367 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 410


>cbil|dbest|1050840 F22668 HSPD07524 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=515
            Length = 515

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 7.4e-10, P = 7.4e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   259 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 316

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   317 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 376

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   377 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 420


>cbil|dbest|725193 AA088843 zl90b01.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=509
            Length = 509

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 7.5e-10, P = 7.5e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    84 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 139

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   140 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 198

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   199 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 245


>cbil|dbest|1049957 F21785 HSPD06377 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=370
            Length = 370

  Plus Strand HSPs:

 Score = 351 (52.7 bits), Expect = 7.6e-10, P = 7.6e-10
 Identities = 123/169 (72%), Positives = 123/169 (72%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   149 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 206

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   207 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 266

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATA 169
             TC T A TT A  ATT      T GTACGAAAGGAC  AA A  AGAAATA
Sbjct:   267 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGAC--AAGA--AGAAATA 309


>cbil|dbest|863246 AA223928 zr13b11.s1 3' Lib=525[Homo_sapiens|||||hNT_neurons]
            Length=504
            Length = 504

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 7.6e-10, P = 7.6e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    90 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 145

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   146 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 204

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   205 TTTAATAGCGGCTGCACC-ATTGGGATGTCCTGATCCAACATCGAGGT 251


>cbil|dbest|1050331 F22159 HSPD06822 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=366
            Length = 366

  Plus Strand HSPs:

 Score = 351 (52.7 bits), Expect = 7.7e-10, P = 7.7e-10
 Identities = 123/169 (72%), Positives = 123/169 (72%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   156 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 213

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   214 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 273

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATA 169
             TC T A TT A  ATT      T GTACGAAAGGAC  AA A  AGAAATA
Sbjct:   274 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGAC--AAGA--AGAAATA 316


>cbil|dbest|718439 AA083209 zn31d08.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=498
            Length = 498

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 7.7e-10, P = 7.7e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    85 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 140

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   141 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 199

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   200 TTTAATAGCGGCTGCACC-ATTGGGATGTCCTGATCCAACATCGAGGT 246


>cbil|dbest|860313 AA220989 zr01e08.r1 5'
            Lib=536[Homo_sapiens|brain|neuroepithelial_cells|||Ntera-2_neuroepi
            thelial_cells] Length=496
            Length = 496

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 7.7e-10, P = 7.7e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    93 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 148

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   149 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 207

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   208 TTTAATAGCGGCTGCACC-ATTGGGATGTCCTGATCCAACATCGAGGT 254


>cbil|dbest|1177962 AA533479 nj72b08.s1 
            Lib=926[Homo_sapiens|prostate|invasive_prostate_tumor|||]
            Length=485
            Length = 485

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 7.9e-10, P = 7.9e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:   110 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 165

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   166 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 224

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   225 TTTAATAGCGGCTGCACC-ATTGGGATGTCCTGATCCAACATCGAGGT 271


>cbil|dbest|1050633 F22461 HSPD07276 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=349
            Length = 349

  Plus Strand HSPs:

 Score = 351 (52.7 bits), Expect = 8.0e-10, P = 8.0e-10
 Identities = 127/182 (69%), Positives = 127/182 (69%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   116 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 173

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   174 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 233

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATATAGATTTTA 178
             TC T A TT A  ATT      T GTACGAAAGGAC  AA A AA    T T   TTTT 
Sbjct:   234 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGAC--AAGAGAAATTTTNTTTTTTTTC 287

Query:   179 ATAA 182
             A AA
Sbjct:   288 ANAA 291


>cbil|dbest|736746 AA099002 zn45e03.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=476
            Length = 476

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.0e-10, P = 8.0e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    98 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 153

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   154 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 212

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   213 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 259


>cbil|dbest|1048713 F20541 HSPD04896 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=469
            Length = 469

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.2e-10, P = 8.2e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   221 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 278

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   279 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 338

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   339 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 382


>cbil|dbest|1048989 F20817 HSPD05223 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=469
            Length = 469

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.2e-10, P = 8.2e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   224 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 281

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   282 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 341

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   342 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 385


>cbil|dbest|1048866 F20694 HSPD05078 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=461
            Length = 461

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.3e-10, P = 8.3e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   213 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 270

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   271 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 330

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   331 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 374


>cbil|dbest|1048995 F20823 HSPD05229 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=461
            Length = 461

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.3e-10, P = 8.3e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   214 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 271

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   272 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 331

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   332 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 375


>cbil|dbest|1112229 AA469432 nc74a02.s1 
            Lib=574[Homo_sapiens|||||45_years_old] Length=459
            Length = 459

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.3e-10, P = 8.3e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    38 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 93

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:    94 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 152

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   153 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 199


>cbil|dbest|1048773 F20601 HSPD04973 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=451
            Length = 451

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.5e-10, P = 8.5e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   205 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 262

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   263 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 322

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   323 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 366


>cbil|dbest|1050755 F22583 HSPD07420 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=451
            Length = 451

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.5e-10, P = 8.5e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   206 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 263

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   264 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 323

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   324 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 367


>cbil|dbest|1050972 F22800 HSPD07710 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=442
            Length = 442

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.7e-10, P = 8.7e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   204 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 261

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   262 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 321

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   322 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 365


>cbil|dbest|1048742 F20570 HSPD04939 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=441
            Length = 441

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.7e-10, P = 8.7e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   197 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 254

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   255 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 314

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   315 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 358


>cbil|dbest|1048859 F20687 HSPD05071 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=438
            Length = 438

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.7e-10, P = 8.7e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   193 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 250

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   251 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 310

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   311 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 354


>cbil|dbest|1048820 F20648 HSPD05023 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=437
            Length = 437

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.8e-10, P = 8.8e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   194 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 251

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   252 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 311

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   312 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 355


>cbil|dbest|1048388 F20216 HSPD04392 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=435
            Length = 435

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.8e-10, P = 8.8e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   273 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 330

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   331 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 390

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   391 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 434


>cbil|dbest|760292 AA121390 zn77g03.s1 3'
            Lib=536[Homo_sapiens|brain|neuroepithelial_cells|||Ntera-2_neuroepi
            thelial_cells] Length=427
            Length = 427

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.0e-10, P = 9.0e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:   113 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 168

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   169 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 227

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   228 TTTAATAGCGGCTGCACC-ATTGGGATGTCCTGATCCAACATCGAGGT 274


>cbil|dbest|1048677 F20505 HSPD04853 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=426
            Length = 426

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.0e-10, P = 9.0e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   179 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 236

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   237 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 296

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   297 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 340


>cbil|dbest|739978 AA101363 zn71f10.s1 3'
            Lib=536[Homo_sapiens|brain|neuroepithelial_cells|||Ntera-2_neuroepi
            thelial_cells] Length=422
            Length = 422

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.1e-10, P = 9.1e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    29 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 84

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:    85 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 143

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   144 TTTAATAGCGGCTGCACC-ATTGGGATGTCCTGATCCAACATCGAGGT 190


>cbil|dbest|1049782 F21610 HSPD06191 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=419
            Length = 419

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.1e-10, P = 9.1e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   178 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 235

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   236 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 295

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   296 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 339


>cbil|dbest|1049029 F20857 HSPD05268 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=337
            Length = 337

  Plus Strand HSPs:

 Score = 350 (52.5 bits), Expect = 9.2e-10, P = 9.2e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   110 ACCTCGATGTTGGATCANGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 167

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   168 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 227

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   228 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 271


>cbil|dbest|844511 AA206551 zq57f05.s1 3'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=414
            Length = 414

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.3e-10, P = 9.3e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    83 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 138

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   139 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 197

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   198 TTTAATAGCGGCTGCACC-ATTGGGATGTCCTGATCCAACATCGAGGT 244


>cbil|dbest|1048641 F20469 HSPD04813 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=411
            Length = 411

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.3e-10, P = 9.3e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   163 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 220

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   221 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 280

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   281 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 324


>cbil|dbest|1050534 F22362 HSPD07077 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=411
            Length = 411

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.3e-10, P = 9.3e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   221 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 278

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   279 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 338

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   339 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 382


>cbil|dbest|1049047 F20875 HSPD05292 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=409
            Length = 409

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.4e-10, P = 9.4e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   160 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 217

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   218 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 277

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   278 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 321


>cbil|dbest|831974 AA192935 zq13c01.s1 3'
            Lib=530[Homo_sapiens|skeletal_muscle|muscle|||adult] Length=368
            Length = 368

  Minus Strand HSPs:

 Score = 349 (52.4 bits), Expect = 9.4e-10, P = 9.4e-10
 Identities = 119/163 (73%), Positives = 119/163 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    87 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 142

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA ACC AA C
Sbjct:   143 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACCGAACC 202

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGG 2
             TTTAA A C  CT  ACC A     A  TC T ATCCAACATCGAGG
Sbjct:   203 TTTAATAGCGGCTGAACC-ATCGGGATGTCCTGATCCAACATCGAGG 248


>cbil|dbest|1050948 F22776 HSPD07679 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=408
            Length = 408

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.4e-10, P = 9.4e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   163 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 220

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   221 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 280

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   281 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 324


>cbil|dbest|818185 AA179180 zp46a12.r1 5'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=407
            Length = 407

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.4e-10, P = 9.4e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:   102 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 157

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   158 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 216

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   217 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 263


>cbil|dbest|1050541 F22369 HSPD07086 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=407
            Length = 407

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.4e-10, P = 9.4e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   198 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 255

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   256 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 315

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   316 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 359


>cbil|dbest|1127837 AA483060 ne71d04.s1 
            Lib=883[Homo_sapiens||Ewing's_sarcoma|||] Length=330
            Length = 330

  Plus Strand HSPs:

 Score = 350 (52.5 bits), Expect = 9.4e-10, P = 9.4e-10
 Identities = 120/167 (71%), Positives = 120/167 (71%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   102 ACCTCGATGTTGGATCAGGACATCCCAAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 159

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   160 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 219

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAA 167
             TC T A TT A  ATT      T GTACGAAAGGAC  A T TAA  AA
Sbjct:   220 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACA-AGTGTAAATAA 263


>cbil|dbest|1050299 F22127 HSPD06790 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=405
            Length = 405

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.5e-10, P = 9.5e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   155 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 212

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   213 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 272

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   273 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 316


>cbil|dbest|1049250 F21078 HSPD05546 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=403
            Length = 403

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.5e-10, P = 9.5e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   240 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 297

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   298 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 357

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   358 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 401


>cbil|dbest|1113921 AA469385 nc68f06.r1 
            Lib=573[Homo_sapiens|||||45_years_old] Length=403
            Length = 403

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.5e-10, P = 9.5e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    85 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 140

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   141 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 199

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   200 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 246


>cbil|dbest|721958 AA086245 zn60f04.s1 3'
            Lib=530[Homo_sapiens|skeletal_muscle|muscle|||adult] Length=402
            Length = 402

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.5e-10, P = 9.5e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    76 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 131

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   132 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 190

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   191 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 237


>cbil|dbest|1049568 F21396 HSPD05921 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=401
            Length = 401

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.6e-10, P = 9.6e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   223 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 280

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   281 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 340

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   341 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 384


>cbil|dbest|1049783 F21611 HSPD06192 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=401
            Length = 401

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.6e-10, P = 9.6e-10
 Identities = 122/169 (72%), Positives = 122/169 (72%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   190 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 247

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   248 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 307

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCTAATATAAGAAATA 169
             TC T A TT A  ATT      T GTACGAAAGG  C AA A AA AAATA
Sbjct:   308 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGGAC-AAGA-AA-AAATA 351


>cbil|dbest|1050296 F22124 HSPD06787 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=392
            Length = 392

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.8e-10, P = 9.8e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   146 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 203

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   204 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 263

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   264 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 307


>cbil|dbest|1113814 AA469278 nc68c01.s1 
            Lib=573[Homo_sapiens|||||45_years_old] Length=390
            Length = 390

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.8e-10, P = 9.8e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:   107 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 162

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   163 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 221

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   222 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 268


>cbil|dbest|1048978 F20806 HSPD05212 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=387
            Length = 387

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.9e-10, P = 9.9e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   160 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 217

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   218 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 277

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   278 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 321


>cbil|dbest|1048645 F20473 HSPD04817 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=386
            Length = 386

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 9.9e-10, P = 9.9e-10
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   183 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 240

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   241 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 300

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   301 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 344


>cbil|dbest|1050062 F21890 HSPD06486 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=385
            Length = 385

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 1.0e-09, P = 1.0e-09
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   141 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 198

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   199 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 258

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   259 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 302


>cbil|dbest|1049541 F21369 HSPD05887 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=384
            Length = 384

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 1.0e-09, P = 1.0e-09
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   165 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 222

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   223 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 282

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   283 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 326


>cbil|dbest|1050029 F21857 HSPD06452 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=384
            Length = 384

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 1.0e-09, P = 1.0e-09
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   136 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 193

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   194 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 253

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   254 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 297


>cbil|dbest|724516 AA088914 zl69b12.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=383
            Length = 383

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 1.0e-09, P = 1.0e-09
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    88 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 143

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:   144 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 202

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   203 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 249


>cbil|dbest|1113687 AA469151 nc67e08.s1 
            Lib=573[Homo_sapiens|||||45_years_old] Length=383
            Length = 383

  Minus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 1.0e-09, P = 1.0e-09
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Minus / Plus

Query:   164 CTTATAT-TAG-GTCCTTTCGTACTATAACATAATAATTAATTAAGGATAGAAACCAACC 107
             CTTAT T T   GTCCTTTCGTAC    A   AAT  T AA TA  GATAGAAACC ACC
Sbjct:    15 CTTATTTCTCTTGTCCTTTCGTACAGGGAGG-AATT-TGAAGTA--GATAGAAACCGACC 70

Query:   106 TGGCTTACGCCGGTTTGAACTCAGATCATGTAAGAATTCAAAGGTCGAACAGACCTAAAC 47
             TGG TTAC CCGGT TGAACTCAGATCA GTA GA TT AA  GT GAACA AC  AA C
Sbjct:    71 TGGATTACTCCGGTCTGAACTCAGATCACGTAGGACTTTAATCGTTGAACAAACG-AACC 129

Query:    46 TTTAA-A-CTTCTACACCTAAAAATAACTCTTAATCCAACATCGAGGT 1
             TTTAA A C  CT CACC A     A  TC T ATCCAACATCGAGGT
Sbjct:   130 TTTAATAGCGGCTGCACC-ATCGGGATGTCCTGATCCAACATCGAGGT 176


>cbil|dbest|1050025 F21853 HSPD06448 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=374
            Length = 374

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 1.0e-09, P = 1.0e-09
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   138 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 195

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   196 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 255

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   256 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 299


>cbil|dbest|1049859 F21687 HSPD06273 
            Lib=852[Homo_sapiens||pectoral_muscle_(after_mastectomy)|||]
            Length=372
            Length = 372

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 1.0e-09, P = 1.0e-09
 Identities = 120/164 (73%), Positives = 120/164 (73%), Strand = Plus / Plus

Query:     1 ACCTCGATGTTGGATTAAGAGTTATTTTTAGGTGTAGAAG-T-TTAAAGTTTAGGTCTGT 58
             ACCTCGATGTTGGAT A GA  T     T GGTG AG  G T TTAAAG TT G T TGT
Sbjct:   164 ACCTCGATGTTGGATCAGGACATCCCGAT-GGTGCAGCCGCTATTAAAGGTTCGTT-TGT 221

Query:    59 TCGACCTTTGAATTCTTACATGATCTGAGTTCAAACCGGCGTAAGCCAGGTTGGTTTCTA 118
             TC AC  TT AA TC TAC TGATCTGAGTTCA ACCGG GTAA CCAGGT GGTTTCTA
Sbjct:   222 TCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTA 281

Query:   119 TCCTTAATTAATTATTATGTTATAGTACGAAAGGACCT-A-ATATAAG 164
             TC T A TT A  ATT      T GTACGAAAGGAC   A A ATAAG
Sbjct:   282 TC-T-ACTTCAA-ATTCCTCCCT-GTACGAAAGGACAAGAGAAATAAG 325


WARNING:  HSPs involving 384 database sequences were not reported due to the
          limiting value of parameter B = 250.


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      205       205      10. 113 11 N/A 73   0.023 73
                                                  78   0.022 96
   -1      0      205       205      10. 113 11 N/A 73   0.023 73
                                                  78   0.022 96


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  dbEST
    Release date:  unknown
    Posted date:  9:10 AM EST Dec 21, 1997
    Format:  BLAST
  # of letters in database:  500,351,318
  # of sequences in database:  1,352,941
  # of database sequences satisfying E:  634
  No. of states in DFA:  158 (158 KB)
  Total size of DFA:  163 KB (192 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  24.48u 0.89s 25.37t  Elapsed: 00:00:06
  Total cpu time:  24.82u 0.99s 25.81t  Elapsed: 00:00:06
  Start:  Thu Feb  5 22:44:24 1998   End:  Thu Feb  5 22:44:30 1998

WARNINGS ISSUED:  2

Date: 16:20:45 on Sun 17 Dec 117.