blastn_dbest_files/1736972_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  1736972
        (290 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|1736972 AA999337 MCCE3160.M1F 3'-end Lib=565[S...  1450  3.0e-59   1
A cbil|dbest|636709 AA022663 ze71e02.s1 3' Lib=424[Homo_sa...   206  0.0034    1
A cbil|dbest|1728839 AA991204 os24g06.s1 3' Lib=1046[Homo_s...   206  0.0052    1
A cbil|dbest|1842655 AI084275 oy40h07.s1 3' Lib=417[Homo_sa...   195  0.012     1
A cbil|dbest|1790781 AI051788 ow31a02.s1 3' Lib=417[Homo_sa...   200  0.014     1
A cbil|dbest|1200138 AA550128 1230m3  Lib=9[Plasmo...   200  0.019     1
A cbil|dbest|854628 AA215315 zr94c09.r1 5' Lib=595[Homo_sa...   194  0.019     1
A cbil|dbest|1200490 AA550480 1634m3  Lib=9[Plasmo...   195  0.022     1
A cbil|dbest|1133714 AA489044 aa56d07.s1 3' Lib=595[Homo_sa...   187  0.049     1
A cbil|dbest|828256 AA189650 mt63e09.r1 5' Lib=544[Mus_mus...   184  0.065     1
A cbil|dbest|828267 AA189661 mt63h09.r1 5' Lib=544[Mus_mus...   184  0.068     1
A cbil|dbest|362070 H60651 yr13c01.r1 5' Lib=262[Homo_sapi...   174  0.11      1
A cbil|dbest|828263 AA189657 mt63g09.r1 5' Lib=544[Mus_mus...   184  0.11      1
A cbil|dbest|1469405 AA441084 LD15867.5prime 5prime Lib=106...   175  0.12      1
A cbil|dbest|1741373 AI003389 am78f08.s1 3' Lib=629[Homo_sa...   169  0.22      1
A cbil|dbest|1200608 AA550598 1765m3  Lib=9[Plasmo...   174  0.24      1
A cbil|dbest|1235146 AA584632 no12e12.s1 3' Lib=993[Homo_sa...   166  0.55      1
A cbil|dbest|499891 N93103 zb59f10.s1 3' Lib=415[Homo_sapi...   159  0.70      1
A cbil|dbest|151062 F10974 HSC3MF012 3' Lib=186[Homo_sapie...   152  0.75      1
A cbil|dbest|239963 R63208 yi07b04.s1 3' Lib=271[Homo_sapi...   150  0.90      1
A cbil|dbest|27315 T08261 EST06152 5'-end Lib=21[Homo_sap...   162  0.99      1
A cbil|dbest|1146216 AA501586 ne97h07.s1  Lib=890[...   143  0.995     1
A cbil|dbest|824830 AA185765 MAAD0173.M2R 5'-end Lib=583[S...   158  0.997     1
A cbil|dbest|1591165 AA865828 oh03h03.s1 3' Lib=1045[Homo_s...   159  0.9995    1



>cbil|dbest|1736972 AA999337 MCCE3160.M1F 3'-end
            Lib=565[Schistosoma_mansoni|||||Larvae] Length=290 Author_cmt:
            human uncoupling protein homolog (UCPH)
            Length = 290

  Plus Strand HSPs:

 Score = 1450 (217.6 bits), Expect = 3.0e-59, P = 3.0e-59
 Identities = 290/290 (100%), Positives = 290/290 (100%), Strand = Plus / Plus

Query:     1 ATACGTTTGAACATCCAAAATATTATTAAAAGTATGATAGAACAAGCACAATATAGCTAG 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 ATACGTTTGAACATCCAAAATATTATTAAAAGTATGATAGAACAAGCACAATATAGCTAG 60

Query:    61 AGTCAGGAGATTAAGTACCTGAATACAACAGTAATGTAAAGGAAACAAAACAGTTCTAAT 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AGTCAGGAGATTAAGTACCTGAATACAACAGTAATGTAAAGGAAACAAAACAGTTCTAAT 120

Query:   121 ATCTAACATATAGTTGGAGACAAATACCAAGAGAATGAATGGTCCTTTAAAATAGAATTA 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 ATCTAACATATAGTTGGAGACAAATACCAAGAGAATGAATGGTCCTTTAAAATAGAATTA 180

Query:   181 AGTAGAAACACAACTAAATCTTTTATATACTCCTGAAAGAGACTAGAAGACTACCAACCA 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 AGTAGAAACACAACTAAATCTTTTATATACTCCTGAAAGAGACTAGAAGACTACCAACCA 240

Query:   241 AAGCGCGTTTCTGAAAATAATGAACATGACGGATTCAGGTGAAAACTTTC 290
             ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 AAGCGCGTTTCTGAAAATAATGAACATGACGGATTCAGGTGAAAACTTTC 290


>cbil|dbest|636709 AA022663 ze71e02.s1 3'
            Lib=424[Homo_sapiens|heart||||19_weeks] Length=429 Author_cmt:
            gb:M65131 METHYLMALONYL-COA MUTASE PRECURSOR (HUMAN);
            Length = 429

  Minus Strand HSPs:

 Score = 206 (30.9 bits), Expect = 0.0034, P = 0.0034
 Identities = 166/279 (59%), Positives = 166/279 (59%), Strand = Minus / Plus

Query:   290 GAAAGTTTTCACCTGAATCCGTCATGTTCATTATTTTCAGA-AACGCGCTTTGGTTGGTA 232
             GAAA  TT  A  T AAT C TCA   T ATT TTT  A A AA  C C TTG    G A
Sbjct:    45 GAAACATTCTAA-TAAATACATCACCATGATT-TTTAAAAATAATAC-CATTGTCCAG-A 100

Query:   231 GT-CTTC-TA--GTCTCTTTC-AG-GAGTATATAAAAGATTTAGTTGTGTTTCTACTTAA 178
             GT CTT  TA  GT T  TT  AG GAGTATA A A   TTTAG   T TTT T  TTA 
Sbjct:   101 GTTCTTGATAAAGTATTGTTATAGAGAGTATAGAGAGTTTTTAGGGATTTTTTTT-TTAT 159

Query:   177 TTCT-ATTTTAAAG-GACCATTCATTCTCTTGGTATTTGTCTCCAA-C-TATATGTTAGA 122
             TT T A  T AAA  G    T CAT CT  T G AT  G C CCA  C TATA GT AG 
Sbjct:   160 TTTTGAAGTGAAACTGTATGTACATACTTATAGCAT--GACACCAGGCCTATAAGTAAGG 217

Query:   121 TATTAGAACTGTTTTG-TTTCCTTTACATTACTGTTGTATTCAGGTACTTAATCTCCTGA 63
             TATT  AA  GT   G TTTC    A A TAC   T    T   G A TTAA  T   GA
Sbjct:   218 TATTTTAAA-GTAAAGCTTTCAAGGAAAGTACAAATCAGGTATTGAAATTAAATTGAAGA 276

Query:    62 CTCTAGCTATATTGTGCTTGTTCTATCATACTTTTAATAATATTTTGGA 14
             C  TAGCT TA T T CTT TT  ATCATA  T  AATAATATTTT GA
Sbjct:   277 CA-TAGCTTTACTCT-CTTCTTTGATCATAACTAAAATAATATTTTAGA 323


>cbil|dbest|1728839 AA991204 os24g06.s1 3'
            Lib=1046[Homo_sapiens|kidney|2_pooled_tumors_(clear_cell_type)|||]
            Length=482 Author_cmt: gb:M65131 METHYLMALONYL-COA MUTASE PRECURSOR
            (HUMAN);
            Length = 482

  Minus Strand HSPs:

 Score = 206 (30.9 bits), Expect = 0.0052, P = 0.0052
 Identities = 166/279 (59%), Positives = 166/279 (59%), Strand = Minus / Plus

Query:   290 GAAAGTTTTCACCTGAATCCGTCATGTTCATTATTTTCAGA-AACGCGCTTTGGTTGGTA 232
             GAAA  TT  A  T AAT C TCA   T ATT TTT  A A AA  C C TTG    G A
Sbjct:    49 GAAACATTCTAA-TAAATACATCACCATGATT-TTTAAAAATAATAC-CATTGTCCAG-A 104

Query:   231 GT-CTTC-TA--GTCTCTTTC-AG-GAGTATATAAAAGATTTAGTTGTGTTTCTACTTAA 178
             GT CTT  TA  GT T  TT  AG GAGTATA A A   TTTAG   T TTT T  TTA 
Sbjct:   105 GTTCTTGATAAAGTATTGTTATAGAGAGTATAGAGAGTTTTTAGGGATTTTTTTT-TTAT 163

Query:   177 TTCT-ATTTTAAAG-GACCATTCATTCTCTTGGTATTTGTCTCCAA-C-TATATGTTAGA 122
             TT T A  T AAA  G    T CAT CT  T G AT  G C CCA  C TATA GT AG 
Sbjct:   164 TTTTGAAGTGAAACTGTATGTACATACTTATAGCAT--GACACCAGGCCTATAAGTAAGG 221

Query:   121 TATTAGAACTGTTTTG-TTTCCTTTACATTACTGTTGTATTCAGGTACTTAATCTCCTGA 63
             TATT  AA  GT   G TTTC    A A TAC   T    T   G A TTAA  T   GA
Sbjct:   222 TATTTTAAA-GTAAAGCTTTCAAGGAAAGTACAAATCAGGTATTGAAATTAAATTGAAGA 280

Query:    62 CTCTAGCTATATTGTGCTTGTTCTATCATACTTTTAATAATATTTTGGA 14
             C  TAGCT TA T T CTT TT  ATCATA  T  AATAATATTTT GA
Sbjct:   281 CA-TAGCTTTACTCT-CTTCTTTGATCATAACTAAAATAATATTTTAGA 327


>cbil|dbest|1842655 AI084275 oy40h07.s1 3'
            Lib=417[Homo_sapiens|parathyroid_gland|parathyroid_tumor|||adult]
            Length=415 Author_cmt: gb:M65131 METHYLMALONYL-COA MUTASE PRECURSOR
            (HUMAN);
            Length = 415

  Minus Strand HSPs:

 Score = 195 (29.3 bits), Expect = 0.012, P = 0.012
 Identities = 165/277 (59%), Positives = 165/277 (59%), Strand = Minus / Plus

Query:   290 GAAAGTTTTCACCTGAATCCGTCATGTTCATTATTTTCAGA-AACGCGCTTTGGTTGGTA 232
             GAAA  TT  A  T AAT C TCA   T ATT TTT  A A AA  C C TTG    G A
Sbjct:    53 GAAACATTCTAA-TAAATACATCACCATGATT-TTTAAAAATAATAC-CATTGTCCAG-A 108

Query:   231 GT-CTTC-TA--GTCTCTTTC-AG-GAGTATATAAAAGATTTAGTTGTGTTTCTACTTAA 178
             GT CTT  TA  GT T  TT  AG GAGTATA A A   TTTAG   T TTT T  TTA 
Sbjct:   109 GTTCTTGATAAAGTATTGTTATAGAGAGTATAGAGAGTTTTTAGGGATTTTTTT--TTAT 166

Query:   177 TTCT-ATTTTAAAGGACCATTCATTCTCTTGGTATTTGTCTCCAA--CTATATGTTAGAT 121
             TT T A  T AA  G    T CAT CT  T G AT  G C CCA   CTATA GT AG T
Sbjct:   167 TTTTGAAGTGAACTGTATGTACATACTTATAGCAT--GACACCAGGCCTATAAGTAAGGT 224

Query:   120 ATTAGAACTGTTTTG-TTTCCTTTACATTACTGTTGTATTCAGGTACTTAATCTCCTGAC 62
             ATT  AA  GT   G TTTC    A A TAC   T    T   G A T AAT T   GAC
Sbjct:   225 ATTTTAAA-GTAAAGCTTTCAAGGAAAGTACAAATCAGGTATTGAAATAAAT-TGAAGAC 282

Query:    61 TCTAGCTATATTGTGCTTGTTCTATCATACTTTTAATAATATTTTGGA 14
               TAGCT TA T T CTT TT  ATCATA  T  AATAATATTTT GA
Sbjct:   283 A-TAGCTTTACTCT-CTTCTTTGATCATAACTAAAATAATATTTTAGA 328


>cbil|dbest|1790781 AI051788 ow31a02.s1 3'
            Lib=417[Homo_sapiens|parathyroid_gland|parathyroid_tumor|||adult]
            Length=563 Author_cmt: gb:M65131 METHYLMALONYL-COA MUTASE PRECURSOR
            (HUMAN);
            Length = 563

  Minus Strand HSPs:

 Score = 200 (30.0 bits), Expect = 0.015, P = 0.014
 Identities = 166/278 (59%), Positives = 166/278 (59%), Strand = Minus / Plus

Query:   290 GAAAGTTTTCACCTGAATCCGTCATGTTCATTATTTTCAGA-AACGCGCTTTGGTTGGTA 232
             GAAA  TT  A  T AAT C TCA   T ATT TTT  A A AA  C C TTG    G A
Sbjct:    51 GAAACATTCTAA-TAAATACATCACCATGATT-TTTAAAAATAATAC-CATTGTCCAG-A 106

Query:   231 GT-CTTC-TA--GTCTCTTTC-AG-GAGTATATAAAAGATTTAGTTGTGTTTCTACTTAA 178
             GT CTT  TA  GT T  TT  AG GAGTATA A A   TTTAG   T TTT T  TTA 
Sbjct:   107 GTTCTTGATAAAGTATTGTTATAGAGAGTATAGAGAGTTTTTAGGGATTTTTTT--TTAT 164

Query:   177 TTCT-ATTTTAAAG-GACCATTCATTCTCTTGGTATTTGTCTCCAA-C-TATATGTTAGA 122
             TT T A  T AAA  G    T CAT CT  T G AT  G C CCA  C TATA GT AG 
Sbjct:   165 TTTTGAAGTGAAACTGTATGTACATACTTATAGCAT--GACACCAGGCCTATAAGTAAGG 222

Query:   121 TATTAGAACTGTTTTG-TTTCCTTTACATTACTGTTGTATTCAGGTACTTAATCTCCTGA 63
             TATT  AA  GT   G TTTC    A A TAC   T    T   G A TTAA  T   GA
Sbjct:   223 TATTTTAAA-GTAAAGCTTTCAAGGAAAGTACAAATCAGGTATTGAAATTAAATTGAAGA 281

Query:    62 CTCTAGCTATATTGTGCTTGTTCTATCATACTTTTAATAATATTTTGGA 14
             C  TAGCT TA T T CTT TT  ATCATA  T  AATAATATTTT GA
Sbjct:   282 CA-TAGCTTTACTCT-CTTCTTTGATCATAACTAAAATAATATTTTAGA 328


>cbil|dbest|1200138 AA550128 1230m3  Lib=9[Plasmodium_falciparum|||||]
            Length=694
            Length = 694

  Plus Strand HSPs:

 Score = 200 (30.0 bits), Expect = 0.019, P = 0.019
 Identities = 126/210 (60%), Positives = 126/210 (60%), Strand = Plus / Plus

Query:     9 GAACATCCAAAATATTATTAAAAGTATGATAGAACAAGCAC-AATATAGCTAGAGTCAGG 67
             G ACAT CAA ATATTATTAAAA T T AT G A A   A  AA A A  TA A   A  
Sbjct:    48 GCACATTCAATATATTATTAAAATTCT-ATGGGAAATATATGAAAAAAAATAAAAAAAAT 106

Query:    68 AGATTAAGTACCTGAATACAACAGTAATGTAAAGGAAACAAAACAGTTCTAATATCTAAC 127
             A AT AA TA  T AATA AA A  AAT  AAA  AAA  A A A  T TA TAT T  C
Sbjct:   107 AAATAAAATAAATAAATAAAATA--AATAAAAACAAAAGGATATATATATA-TATATTTC 163

Query:   128 ATA-TAGTTGGAGACAAATACCAAGAGAATGAATGGTCCTTTAAAATAGAATTAAGTAGA 186
             ATA TA TT  A A  AATA C   A AATGAA   TC TTT A  TA   TT   T GA
Sbjct:   164 ATAATATTTTTATA--AATATCTTTATAATGAAA--TCTTTTCAT-TACCTTTTCTTTGA 218

Query:   187 AACACAACTAAAT--CTTTTATATACTCCTGAAA 218
             AA   AA T  AT  CTTTT  ATA TCCT A A
Sbjct:   219 AATGTAATTTTATTTCTTTTGAATAATCCTCATA 252


>cbil|dbest|854628 AA215315 zr94c09.r1 5'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=466
            Author_cmt: gb:M65131 METHYLMALONYL-COA MUTASE PRECURSOR (HUMAN);
            Length = 466

  Plus Strand HSPs:

 Score = 194 (29.1 bits), Expect = 0.020, P = 0.019
 Identities = 168/282 (59%), Positives = 168/282 (59%), Strand = Plus / Plus

Query:    14 TCCAAAATATTATTAAAAGTATGATAGAACAAGCACAATATAGCTAGAGTCAGGAGATTA 73
             TC AAAATATTATT  A  TATGAT  AA AAG A A TA AGCTA  GTC   A  TTA
Sbjct:    77 TCTAAAATATTATTTTAGTTATGATCAAAGAAG-AGAGTAAAGCTAT-GTCTTCAATTTA 134

Query:    74 AGTACCTGAATACAACAGTAATGTAAAGGAAA-CAAAACAGTTCTAATATCTAACAT-AT 131
             A T C   A    A   GTA T T    GAAA C   AC  TT  AATA CT AC T AT
Sbjct:   135 ATTTCAATACCTGATTTGTACTTTCCTTGAAAGCTTTACT-TTAAAATACCTTACGTTAT 193

Query:   132 AGT--TGGAGACAAATACCAAGAGAATGAATGGTCC-TTTAAAAT--AGAATTAAGTAGA 186
             AG   TGG G CA  T C A  AG ATG A    C  TTT A AT  A AA TAA  A A
Sbjct:   194 AGGCCTGGTGTCA--TGCTATAAGTATGTACATACAGTTTCACATTCAAAAATAAAAAAA 251

Query:   187 AACACAACTAAAT-CTTTTATATACTC-CTGAAAGAG-ACT--AG-AAGA-CTACCAACC 239
             AA  C  CTAAA  CT T  TATACTC CT  AA A  ACT  A  AAGA CT    AC 
Sbjct:   252 AAATCC-CTAAAAACTCTCGTATACTCTCTATAACAATACTTTATCAAGAACTCTGGAC- 309

Query:   240 AAAGCGCGTT-TCTGAAAATAATGAACATGACGGATTCAGGTGAAAACTTTC 290
             AA G G  TT T T  AAA AAT A   TGA G ATT A   GAA   TTTC
Sbjct:   310 AATG-GTATTATTTTTAAA-AATCATGGTGATGTATTTATTAGAATG-TTTC 358


>cbil|dbest|1200490 AA550480 1634m3  Lib=9[Plasmodium_falciparum|||||]
            Length=522
            Length = 522

  Minus Strand HSPs:

 Score = 195 (29.3 bits), Expect = 0.022, P = 0.022
 Identities = 125/193 (64%), Positives = 125/193 (64%), Strand = Minus / Plus

Query:   205 TAAAAGATTTAGTTGTGTTTCTACTTAATTCTATTTTAAAGGACCATTCAT-TCTCT-TG 148
             TAAAA AT T  TTGTGTTTCTA TTAAT  TAT T  A G A  ATTCA  T   T TG
Sbjct:    37 TAAAAAATATT-TTGTGTTTCTAATTAATCTTATGTGTA-G-AT-ATTCACATGAGTGTG 92

Query:   147 GTAT-TTGTCTCCAACTATATGTTAGAT-ATTAGAACTG-TTTTGTTTCCTT-TACATTA 92
             GT T TT T TC  AC  TA  TT  AT ATTA A  T  TTTT  TTC TT T  A TA
Sbjct:    93 GTGTCTTCTATCTGACAGTACCTTT-ATGATTATATATAATTTTCCTTCTTTATGTAATA 151

Query:    91 CTGTTGTATTCAGGTACTTA-ATCTC-CTG-ACTC-T-AGCTATATTGTG-CTTGTTCTA 38
              T TT TA T A  T CT A AT T  CTG A T  T A  TATATT TG C TGTT TA
Sbjct:   152 ATTTT-TAAT-ATTTCCTAATATTTTTCTGCATTAATGATTTATATTTTGTCATGTTTTA 209

Query:    37 TCATACTT-TTAATAATATTT 18
             T AT  T  TTAAT  TATTT
Sbjct:   210 TTATTATAATTAATG-TATTT 229


>cbil|dbest|1133714 AA489044 aa56d07.s1 3'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=495
            Author_cmt: gb:M65131 METHYLMALONYL-COA MUTASE PRECURSOR (HUMAN);
            Length = 495

  Minus Strand HSPs:

 Score = 187 (28.1 bits), Expect = 0.050, P = 0.049
 Identities = 127/211 (60%), Positives = 127/211 (60%), Strand = Minus / Plus

Query:   224 AGTCTCTTTC-AG-GAGTATATAAAAGATTTAGTTGTGTTTCTACTTAATTCT-ATTTTA 168
             AGT T  TT  AG GAGTATA A A   TTTAG   T TTT T  TTA TT T A  T A
Sbjct:     3 AGTATTGTTATAGAGAGTATAGAGAGTTTTTAGGGATTTTTTTT-TTATTTTTGAAGTGA 61

Query:   167 AAG-GACCATTCATTCTCTTGGTATTTGTCTCCAA--CTATATGTTAGATATTAGAACTG 111
             AA  G    T CAT CT  T G AT  G C CCA   CTATA GT AG TATT  AA  G
Sbjct:    62 AACTGTATGTACATACTTATAGCAT--GACACCAGGCCTATAAGTAAGGTATTTTAAA-G 118

Query:   110 TTTTG-TTTCCTTTACATTACTGTTGTATTCAGGTACTTAATCTCCTGACTCTAGCTATA 52
             T   G TTTC    A A TAC   T    T   G A TTAA  T   GAC  TAGCT TA
Sbjct:   119 TAAAGCTTTCAAGGAAAGTACAAATCAGGTATTGAAATTAAATTGAAGACA-TAGCT-TA 176

Query:    51 TTGTGCTTGTTCTATCATACTTTTAATAATATTTTGGA 14
              T T CTT TT  ATCATA  T  AATAATATTTT GA
Sbjct:   177 CTCT-CTTCTTTGATCATAACTAAAATAATATTTTAGA 213


>cbil|dbest|828256 AA189650 mt63e09.r1 5'
            Lib=544[Mus_musculus||Thymus|||4_weeks] Length=478
            Length = 478

  Minus Strand HSPs:

 Score = 184 (27.6 bits), Expect = 0.067, P = 0.065
 Identities = 108/168 (64%), Positives = 108/168 (64%), Strand = Minus / Plus

Query:   244 GCTTTGGTTGGTAGTCTTCT-AGTCTCTTTC-AGGAGTATATAAAAGAT-TT-AGTTGTG 189
             G TTT  TTGGT  TCTTCT A T TCTTT  AGGAG A   A  AGAT TT AG  GT 
Sbjct:   265 GGTTTTTTTGGT--TCTTCTCATTTTCTTTGTAGGAGAAGGCATGAGATGTTGAGG-GTC 321

Query:   188 TTTC-TACTTAATTCTATTTTAAAGGACCATTCATTCTCTTGGTATTTGTCTCCAACTAT 130
             TTTC TAC T A   TA  T     GAC A  CA TCTC    TAT T T T C  CT T
Sbjct:   322 TTTCATACATGAAAATAAATAGTTTGAC-AG-CAATCTCAGAATATATTTTTTC--CT-T 376

Query:   129 ATGTTAGATATTAGAACTGTTTTGTTTCCTTTACATTACTGTTGTATTCAGGT 77
             AT T A A A  AG ACTGTTTTGTTT CT TACA TAC   T TATT  GGT
Sbjct:   377 ATTTGA-ACAA-AGTACTGTTTTGTTTACTCTACAGTACACCTTTATTT-GGT 426


>cbil|dbest|828267 AA189661 mt63h09.r1 5'
            Lib=544[Mus_musculus||Thymus|||4_weeks] Length=493
            Length = 493

  Minus Strand HSPs:

 Score = 184 (27.6 bits), Expect = 0.071, P = 0.068
 Identities = 108/168 (64%), Positives = 108/168 (64%), Strand = Minus / Plus

Query:   244 GCTTTGGTTGGTAGTCTTCT-AGTCTCTTTC-AGGAGTATATAAAAGAT-TT-AGTTGTG 189
             G TTT  TTGGT  TCTTCT A T TCTTT  AGGAG A   A  AGAT TT AG  GT 
Sbjct:   278 GGTTTTTTTGGT--TCTTCTCATTTTCTTTGTAGGAGAAGGCATGAGATGTTGAGG-GTC 334

Query:   188 TTTC-TACTTAATTCTATTTTAAAGGACCATTCATTCTCTTGGTATTTGTCTCCAACTAT 130
             TTTC TAC T A   TA  T     GAC A  CA TCTC    TAT T T T C  CT T
Sbjct:   335 TTTCATACATGAAAATAAATAGTTTGAC-AG-CAATCTCAGAATATATTTTTTC--CT-T 389

Query:   129 ATGTTAGATATTAGAACTGTTTTGTTTCCTTTACATTACTGTTGTATTCAGGT 77
             AT T A A A  AG ACTGTTTTGTTT CT TACA TAC   T TATT  GGT
Sbjct:   390 ATTTGA-ACAA-AGTACTGTTTTGTTTACTCTACAGTACACCTTTATTT-GGT 439


>cbil|dbest|362070 H60651 yr13c01.r1 5'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=328
            Length = 328

  Plus Strand HSPs:

 Score = 174 (26.1 bits), Expect = 0.11, P = 0.11
 Identities = 122/200 (61%), Positives = 122/200 (61%), Strand = Plus / Plus

Query:     3 ACGTTTGAACA-TCCAAAATATTATTAAAAGTATGATAGAACA--AGCACAATATAGCTA 59
             AC TTT AA A TC AAAATATTATTAAA GTA  ATA  ACA  A  A AATA  GC A
Sbjct:    64 ACTTTTAAAAAATCAAAAATATTATTAAATGTAA-ATATCACATTATGA-AATAATGCAA 121

Query:    60 GAGTCAGGAGATTAAGTACCTGAATACAACAGTAATGTAAAGGA-AACAAAA---CAGTT 115
              AG  AGGA AT  AG A C  AA  C   AG  AT T AA  A AA AAAA   CAGT 
Sbjct:   122 AAGA-AGGA-ATGGAGAAGCAAAAAGCTTGAGGCATATCAAAAACAATAAAATGGCAGTC 179

Query:   116 CTAATATCTAACATATAGTTGGAGACAAATAC-CAAGAGAATGAATGGTCCTTTAAAATA 174
              TAA  TCT  C TATA     A A  AAT   CA G GA T A    T CT TAAAA  
Sbjct:   180 ATAAG-TCTTCC-TATATCAAAATAACAATGTGCATG-GATTAAGCAATACTATAAAAGG 236

Query:   175 GAATTAAGT-AGAAACACAACTAAATC 200
              A   A GT AGAAACA   CT A TC
Sbjct:   237 CAGAGATGTCAGAAACAAGTCTGATTC 263


>cbil|dbest|828263 AA189657 mt63g09.r1 5'
            Lib=544[Mus_musculus||Thymus|||4_weeks] Length=770
            Length = 770

  Minus Strand HSPs:

 Score = 184 (27.6 bits), Expect = 0.12, P = 0.11
 Identities = 108/168 (64%), Positives = 108/168 (64%), Strand = Minus / Plus

Query:   244 GCTTTGGTTGGTAGTCTTCT-AGTCTCTTTC-AGGAGTATATAAAAGAT-TT-AGTTGTG 189
             G TTT  TTGGT  TCTTCT A T TCTTT  AGGAG A   A  AGAT TT AG  GT 
Sbjct:   267 GGTTTTTTTGGT--TCTTCTCATTTTCTTTGTAGGAGAAGGCATGAGATGTTGAGG-GTC 323

Query:   188 TTTC-TACTTAATTCTATTTTAAAGGACCATTCATTCTCTTGGTATTTGTCTCCAACTAT 130
             TTTC TAC T A   TA  T     GAC A  CA TCTC    TAT T T T C  CT T
Sbjct:   324 TTTCATACATGAAAATAAATAGTTTGAC-AG-CAATCTCAGAATATATTTTTTC--CT-T 378

Query:   129 ATGTTAGATATTAGAACTGTTTTGTTTCCTTTACATTACTGTTGTATTCAGGT 77
             AT T A A A  AG ACTGTTTTGTTT CT TACA TAC   T TATT  GGT
Sbjct:   379 ATTTGA-ACAA-AGTACTGTTTTGTTTACTCTACAGTACACCTTTATTT-GGT 428


>cbil|dbest|1469405 AA441084 LD15867.5prime 5prime
            Lib=1060[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stag
            e_embryonic] Length=411
            Length = 411

  Minus Strand HSPs:

 Score = 175 (26.3 bits), Expect = 0.13, P = 0.12
 Identities = 125/216 (57%), Positives = 125/216 (57%), Strand = Minus / Plus

Query:   234 GTAGTCTTCTAGTCTCTTTCAGGAGTATATAAAAGATTTAGTTGTGTTTCTACTTAATTC 175
             G A T TT TA T T  TT A  AGTAT TAA  GA  T G   T  TT  A   AATTC
Sbjct:    47 GAAATATT-TACTATAGTTTATTAGTATGTAAC-GACCTTGAAATAATTTGAAA-AATTC 103

Query:   174 TATTTTAAAGGACCATTCATTCTCTTGGTAT-TTGTCTCCAACTATATGTTAGATATTAG 116
             TATTTTAAA GAC ATT A T T TTG TA  TTGT T   A T T T TTA ATA  A 
Sbjct:   104 TATTTTAAAAGACAATTTAATTTATTG-TACCTTGTGTATCAGTGTTTATTACATAACAA 162

Query:   115 A-AC-TGTTTTGTTTCCTTTACATTACTGTTGT-ATTCAGGTACTTAATCTCCTGACTCT 59
             A A  T TTT  TTT CT  A  TTAC    GT A T    TA TTAA  T  TG    T
Sbjct:   163 ATAAATATTTATTTTTCTCGATTTTACAAGAGTTAATATAATATTTAAGTTAATGTGA-T 221

Query:    58 AGCTAT-ATTGTGCTTGTTCTATCATACTTTTAATAATATT 19
             A C AT ATT     T TT TAT A AC T   AT  TATT
Sbjct:   222 A-CAATTATTTATAATATTATATTAGACCTGACATGTTATT 261


>cbil|dbest|1741373 AI003389 am78f08.s1 3'
            Lib=629[Homo_sapiens||schizophrenic_brain_S-11_frontal_lobe|||34_ye
            ars_old] Length=396
            Length = 396

  Plus Strand HSPs:

 Score = 169 (25.4 bits), Expect = 0.25, P = 0.22
 Identities = 129/214 (60%), Positives = 129/214 (60%), Strand = Plus / Plus

Query:    77 ACCTGAATACAACAGTAATGTAAAGGAAACAAAACAGTTCTAATATCTAAC-ATATAGTT 135
             A CTGA T CAACAGTA T  AAAGGAAACAAA CA    T A A CTA C A A A TT
Sbjct:    30 AACTGA-T-CAACAGTACTTAAAAGGAAACAAA-CAAAAATCACA-CTAGCCACAAATTT 85

Query:   136 GGAGACAAATAC-CAAGAGAATGAATGGTCCTTTAAAATAGAATTAAGTAGAAACACAAC 194
               A  CA ATAC CA GA AAT AAT  T  T T    T GA T     A A   AC   
Sbjct:    86 CCAC-CATATACACATGA-AATTAATTTTAATCTGTTTT-GACTCCTTGACACTAACTGA 142

Query:   195 TAAATCTTTTA-TATACTCCTGAAAGAG-ACT-AGAAGACTACCAACCAAAGCGC-GTTT 250
             T A T  T  A TAT  T   GAAAGA  AC  AG AGA  AC AA CAAAG    GTTT
Sbjct:   143 TCATTAATGAAATATGATATGGAAAGATCACAGAGTAGAAAAC-AAGCAAAGATTAGTTT 201

Query:   251 CTGAAAATAATGAACATGACGGATTCAG-GTGAAAACTTTC 290
              T A AA A TGA  AT A   AT CAG G GAAAAC T C
Sbjct:   202 AT-ACAACAGTGACTAT-ATACAT-CAGAGGGAAAACATGC 239


>cbil|dbest|1200608 AA550598 1765m3  Lib=9[Plasmodium_falciparum|||||]
            Length=582
            Length = 582

  Minus Strand HSPs:

 Score = 174 (26.1 bits), Expect = 0.27, P = 0.24
 Identities = 114/184 (61%), Positives = 114/184 (61%), Strand = Minus / Plus

Query:   211 AGTATATAAAAGATTTAGTTGTGTTTCTACTTAATTCTATTTTAAAGGACCATTCATTCT 152
             AGT  A AAAAG  TTAG  GT T T  ACTTAAT C ATTTT  A  A  AT  ATT T
Sbjct:   295 AGTCCACAAAAGCATTAG--GTATAT--ACTTAATACAATTTTGTATAATAAT--ATTAT 348

Query:   151 CTTGGTATTTGTC-TCCAACTATATGTTAGATATTAGAACTGTTTTGTTTCCT--TTACA 95
             C   G AT    C T   A T TAT TTA  TA  A AA   TT   TT CCT  TTA A
Sbjct:   349 CAAAGAATAACACGTATGATTCTATATTATGTAAAATAAAA-TTAAATTCCCTAATTAAA 407

Query:    94 TTACTGTTGTATTCAGG-TACTTA-ATCTCCTGACTCTAGCTATATTGTGCTTGTTCTAT 37
             TT  TG  GTA TC    TA TT  AT TC TGA T TA  TATATTGTGCTT TTCT T
Sbjct:   408 TT--TGAAGTACTCTTAATATTTTCATGTC-TGAATATATATATATTGTGCTTCTTCT-T 463

Query:    36 CATACTTTT 28
             C TA T TT
Sbjct:   464 CTTAATGTT 472


>cbil|dbest|1235146 AA584632 no12e12.s1 3'
            Lib=993[Homo_sapiens||pheochromocytoma|||] Length=413 Author_cmt:
            contains Alu repetitive element;contains element L1 repetitive
            element ;
            Length = 413

  Minus Strand HSPs:

 Score = 166 (24.9 bits), Expect = 0.79, P = 0.55
 Identities = 118/188 (62%), Positives = 118/188 (62%), Strand = Minus / Plus

Query:   281 CACCTGAATCCGTCATGTTCATTATTTTCAGAAACGCGCTTTGGT--TGGTAGTCTT-CT 225
             CACCTG  T   T  TGT  ATT TT   AGA ACG G TTT     TG T GTC   CT
Sbjct:   225 CACCTGGCTGATTTTTGT--ATTTTTAGTAGAGACGGGGTTTCACCATGTTGGTCAGGCT 282

Query:   224 AGTCTCTTTCAGGAGTATATAAAAGATT-TAGTTGTGTTTCTACTTAATTCTATTTTAAA 166
             AG      T AGG GT T TAA  GA   TAGTT TGTTTCTACTT AT  T TT T AA
Sbjct:   283 AGGAGAAATTAGG-GTTTTTAAGGGACCATAGTTTTGTTTCTACTTTATATTCTTATTAA 341

Query:   165 GGACCATTCATTCTCTTGGT-ATTTGT-CTCCAACTATATGTTAGA-TA-TTAGAAC-TG 111
             G    AT   TTC  T GGT A T GT CTC AAC AT T TTAG  TA TTAGAA  T 
Sbjct:   342 GTTT-ATAGTTTCA-TAGGTTAGTGGTTCTCAAAC-AT-T-TTAGCCTACTTAGAAAATC 396

Query:   110 TTTTGTTTCCTTTACAT 94
             T TT TT C T T  AT
Sbjct:   397 TATT-TTACATCTGGAT 412


>cbil|dbest|499891 N93103 zb59f10.s1 3' Lib=415[Homo_sapiens|lung||||19_weeks]
            Length=147
            Length = 147

  Plus Strand HSPs:

 Score = 159 (23.9 bits), Expect = 1.2, P = 0.70
 Identities = 71/105 (67%), Positives = 71/105 (67%), Strand = Plus / Plus

Query:    95 TGTAAAGGAAACAAAACAGTTCTAATATCTAACATAT-AGTTGGAGACAAATACCAAGAG 153
             TG A A GAAACAAAACA TT TAAT TC  A ATAT A   G A A AAA A  AAGA 
Sbjct:     2 TGGATATGAAACAAAACAATTTTAATTTCAGA-ATATTACAAGAATATAAA-AGAAAGAC 59

Query:   154 AATGAAT-GG-TCCTTTAAAATAGAATTAAGTAGAAACA--CAACTAA 197
             AATG AT GG TC TTT    TA AATTA  TA A A A  CAA TAA
Sbjct:    60 AATGCATAGGATCGTTTCTT-TACAATTACATATACATAGTCAAATAA 106


>cbil|dbest|151062 F10974 HSC3MF012 3'
            Lib=186[Homo_sapiens|brain|total_brain|||3_months_old] Length=264
            Length = 264

  Plus Strand HSPs:

 Score = 152 (22.8 bits), Expect = 1.4, P = 0.75
 Identities = 70/105 (66%), Positives = 70/105 (66%), Strand = Plus / Plus

Query:    95 TGTAAAGGAAACAAAACAGTTCTAATATCTAACATATAGTTGGAG-ACAAATACCAAGAG 153
             TG A A GAAACAAAACA TT TAAT TC  A ATAT     GA  A AAA A  AAGA 
Sbjct:     2 TGGATATGAAACAAAACAATTTTAATTTCAGA-ATATTACAAGANTATAAA-AGAAAGAC 59

Query:   154 AATGAAT-GG-TCCTTTAAAATAGAATTAAGTAGAAACA--CAACTAA 197
             AATG AT GG TC TTT    TA AATTA  TA A A A  CAA TAA
Sbjct:    60 AATGCATAGGATCGTTTCTT-TACAATTACATATACATAGTCAAATAA 106


>cbil|dbest|239963 R63208 yi07b04.s1 3'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=201
            Length = 201

  Plus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 2.3, P = 0.90
 Identities = 94/151 (62%), Positives = 94/151 (62%), Strand = Plus / Plus

Query:    78 CCTGAATACAACAGTA-ATGTAAAGGAAACAAAA-CAGTTCTAATATCTAACATATAGTT 135
             C T AA ACAA A    AT  AAA  AAA AA A CA TT TA TAT    CAT T  TT
Sbjct:    30 CTTAAACACAAAACACCATTAAAACCAAATAACATCATTTGTAGTATGG--CAT-TC-TT 85

Query:   136 GGAGACAAATACCAAGAGAATGAATGGTCCTTTAAAATAGAATTAAG-TAGAAACACAAC 194
               A ACAAA  C AA A   T AATG T  TTTAAAATAGA T A G TA   AC  AAC
Sbjct:    86 AAAAACAAAG-C-AA-ATTTT-AATGATTTTTTAAAATAGACT-ANGCTAATTACTAAAC 140

Query:   195 TAAATCTTTTATATACTCCTGAAAGAGACTAGAA 228
              AAAT TTT AT TACT  T A A  GACT  AA
Sbjct:   141 CAAATATTTCAT-TACTTGTTATAN-GACTTTAA 172


>cbil|dbest|27315 T08261 EST06152 5'-end Lib=21[Homo_sapiens|||||] Length=375
            Length = 375

  Minus Strand HSPs:

 Score = 162 (24.3 bits), Expect = 4.5, P = 0.99
 Identities = 72/113 (63%), Positives = 72/113 (63%), Strand = Minus / Plus

Query:   210 GTATATAAAAGATTTAGTTGTGTTTCTACTTAATTCTATTTTAAAGGACCATTCATTCTC 151
             GTAT T AAAGATTT  TT T TTT TACTTAATTCT T TT A  GACC T  A   T 
Sbjct:   260 GTAT-TCAAAGATTTTTTTTTTTTT-TACTTAATTCTCTCTTTACTGACCCTG-AGAGTG 316

Query:   150 TTGGTATTTGTCTCCAACTATATGTT-AGATATTAGAACTGTTTTGTTTCCTTT 98
                 TATTT T  CCAA T   T TT AG   T A AACT    T TTTCCTTT
Sbjct:   317 ACCATATTTTTAACCAATTTGGTCTTCAGCC-TCAAAACTTAGCTCTTTCCTTT 369


>cbil|dbest|1146216 AA501586 ne97h07.s1 
            Lib=890[Homo_sapiens||kidney|||] Length=177
            Length = 177

  Plus Strand HSPs:

 Score = 143 (21.5 bits), Expect = 5.3, P = 1.0
 Identities = 87/138 (63%), Positives = 87/138 (63%), Strand = Plus / Plus

Query:    65 AGGAGATTAAGTACCTGAATACAACAGTAATGTAAAGGAAACAAAAC--AGTTCTAATAT 122
             AGGA ATTAA  A C  AATA  A A T AT T AAGG A CAAAAC  A T  TAA A 
Sbjct:    24 AGGATATTAATGAGC--AATAAGAAA-TCATCTGAAGGCA-CAAAACTTACTGGTAAGAG 79

Query:   123 CTA--ACATATAGTTGGAGACA-AATACCAAGAGAATG-AATGGTCCT-T-TAAAATAGA 176
               A  ACATA A     A ACA AATA  A  A A T  AA  GT  T T TAAA TA  
Sbjct:    80 TAAGTACATAGAAAAAAACACAGAATATTATAACACTATAACTGTGGTATGTAAATTACT 139

Query:   177 ATTAAGTAGAAACACAACTAAA 198
              TTAAGTAGAAACAC A  AAA
Sbjct:   140 CTTAAGTAGAAACACTAAAAAA 161


>cbil|dbest|824830 AA185765 MAAD0173.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=312 Author_cmt:
            Schistomoma mansoni mRNA for eggshell protein
            Length = 312

  Minus Strand HSPs:

 Score = 158 (23.7 bits), Expect = 5.8, P = 1.0
 Identities = 160/253 (63%), Positives = 160/253 (63%), Strand = Minus / Plus

Query:   267 ATGTTCATTAT--TTTCA-GAAACGCGCTTTGGTTGGTAGTCTTC-TAGTCTCTTTCAGG 212
             AT T CATTAT  TTT A GA  C C C TTG TT G A TC T  TA T T TT  A  
Sbjct:     4 ATATCCATTATCATTTGATGATTCTC-CATTGTTTTG-A-TCATAATAAT-TATT--ATT 57

Query:   211 AGTA-TATAAAAGATTTAGTTGTGT---TTCTAC-TTAATTCTATTTTAAAGG-ACCATT 158
             AGTA TAT A A ATTT GTTGTG    TT TA  TT A  C  TT  A A G A CAT 
Sbjct:    58 AGTAGTATCATATATTT-GTTGTGAGCATTATAAGTTGAACCACTTCCATACGCATCAT- 115

Query:   157 CATTCTCTTGGTATTTGTC-TCCAACTATATGTTAGA-TAT-TAGAACT-GTT--TTGTT 104
              ATTC  TTGGTATTTGTC T CA CTATAT  T  A T T TAG AC  G    TTG T
Sbjct:   116 -ATTCAATTGGTATTTGTCCTTCA-CTATATTGTCCACTTTCTAGTACCAGCAAGTTGAT 173

Query:   103 -TCCTTTACATTACTGTTGTATTCAGGTACTTAATCTCCTG-ACTCTAGCTATATTGTGC 46
              T  TTTAC   AC  TT TATT    T    AAT T  T  ACT T  CTATATT T  
Sbjct:   174 CTAATTTACC--ACCATTATATTTTCCTTTAGAATATAATTTACTTT--CTATATTATAT 229

Query:    45 TT-G-TTCTATCATACTTTTAATAATAT 20
             TT G TT TA CAT  T TT A  ATAT
Sbjct:   230 TTAGCTTTTA-CATTTTGTTTACCATAT 256


>cbil|dbest|1591165 AA865828 oh03h03.s1 3' Lib=1045[Homo_sapiens|kidney||||]
            Length=346
            Length = 346

  Plus Strand HSPs:

 Score = 159 (23.9 bits), Expect = 7.7, P = 1.0
 Identities = 81/118 (68%), Positives = 81/118 (68%), Strand = Plus / Plus

Query:    97 TAAAGGAAACAAAACAGTTCTAATATCTAACATATAGTTGGAGACAAATACCAAGAGAAT 156
             TAA G A A  A ACAG    AAT TCT ACATATAGTTG A ACA ATAC A  A AAT
Sbjct:   184 TAATGCATATCATACAGCAA-AATCTCTTACATATAGTTGTATACATATAC-AT-A-AAT 239

Query:   157 GAATGGTCCTTTAAAATAGAATTAAGTA--GAAACACAACTA-AATCTT-TT-ATATACT 211
             G ATG  C T T AAA AGAATT  GTA  G  A ACA   A AAT TT TT ATA A T
Sbjct:   240 GTATGCACTTCTTAAA-AGAATTT-GTAACGTGA-ACATTCACAATTTTCTTCATAAA-T 295

Query:   212 CCT 214
             CCT
Sbjct:   296 CCT 298


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      290       290      10. 117 11 N/A 73   0.024 75
                                                  81   0.024 105
   -1      0      290       290      10. 117 11 N/A 73   0.024 75
                                                  81   0.024 105


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  /usr/local/db/others/blast/dbEST
    Release date:  unknown
    Posted date:  10:29 AM EDT Sep 6, 1998
    Format:  BLAST
  # of letters in database:  680,019,941
  # of sequences in database:  1,803,623
  # of database sequences satisfying E:  24
  No. of states in DFA:  181 (181 KB)
  Total size of DFA:  188 KB (192 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  20.55u 2.65s 23.20t  Elapsed: 00:00:04
  Total cpu time:  20.60u 9.44s 30.04t  Elapsed: 00:00:11
  Start:  Sat Sep 26 13:56:33 1998   End:  Sat Sep 26 13:56:44 1998

Date: 17:20:55 on Mon 18 Dec 117.