blastn_dbest_files/29017_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  29017
        (267 letters)

Database:  dbEST
           1,352,941 sequences; 500,351,318 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|29017 T09921 0469m7  Lib=9[Plasmodi...  1300  1.4e-52   1
A cbil|dbest|1200151 AA550141 1254m3  Lib=9[Plasmo...   211  0.0042    1
A cbil|dbest|28897 T09801 0383m3  Lib=9[Plasmodi...   201  0.0042    1
A cbil|dbest|504850 N98000 2020C3  Lib=114[Plasmo...   198  0.0083    1
A cbil|dbest|419035 N21752 SMNHADA017050SK 5' Lib=323[Schi...   193  0.0099    1
A cbil|dbest|456311 N50782 yz23a12.s1 3' Lib=390[Homo_sapi...   192  0.018     1
A cbil|dbest|28775 T09679 0263m3  Lib=9[Plasmodi...   188  0.019     1
A cbil|dbest|1133523 AA488853 aa55b10.s1 3' Lib=595[Homo_sa...   185  0.026     1
A cbil|dbest|1376042 AA670458 ae62h09.s1 3' Lib=537[Homo_sa...   184  0.027     1
A cbil|dbest|875729 AA236003 zs05a03.s1 3' Lib=595[Homo_sa...   185  0.028     1
A cbil|dbest|28817 T09721 0321m3  Lib=9[Plasmodi...   184  0.028     1
A cbil|dbest|1133595 AA488925 aa55b10.r1 5' Lib=595[Homo_sa...   185  0.030     1
A cbil|dbest|1191387 AA545284 vj94a12.s1 5' Lib=862[Mus_mus...   186  0.032     1
A cbil|dbest|902852 AA261860 zs18g12.s1 3' Lib=595[Homo_sa...   185  0.035     1
A cbil|dbest|539519 W31685 zb97e06.s1 3' Lib=417[Homo_sapi...   181  0.035     1
A cbil|dbest|463162 N57554 yy81e07.s1 3' Lib=390[Homo_sapi...   185  0.041     1
A cbil|dbest|504799 N97949 1710C3  Lib=114[Plasmo...   177  0.064     1
A cbil|dbest|504807 N97957 1718C3  Lib=114[Plasmo...   177  0.066     1
A cbil|dbest|504535 N98162 1106C3  Lib=114[Plasmo...   177  0.070     1
A cbil|dbest|1200551 AA550541 1703m3  Lib=9[Plasmo...   175  0.11      1
A cbil|dbest|1311328 AA613700 no38g01.s1  Lib=994[...   174  0.11      1
A cbil|dbest|504425 N97575 1020C3  Lib=114[Plasmo...   171  0.13      1
A cbil|dbest|504537 N98164 1109C3  Lib=114[Plasmo...   168  0.14      1
A cbil|dbest|1027912 AA386604 vb53c03.r1 5' Lib=845[Mus_mus...   175  0.14      1
A cbil|dbest|1117131 AA472361 vh06e09.r1 5' Lib=868[Mus_mus...   169  0.15      1
A cbil|dbest|260403 H00523 yj24g05.r1 5' Lib=271[Homo_sapi...   164  0.20      1
A cbil|dbest|1200306 AA550296 1425m3  Lib=9[Plasmo...   171  0.26      1
A cbil|dbest|241043 R64288 yi21h01.r1 5' Lib=271[Homo_sapi...   168  0.26      1
A cbil|dbest|1106083 AA461348 zx70c05.r1 5' Lib=843[Homo_sa...   167  0.31      1
A cbil|dbest|1026299 AA384826 EST98577 5'-end Lib=692[Homo_...   163  0.31      1
A cbil|dbest|1233741 AA583227 nn33f11.s1  Lib=989[...   165  0.31      1
A cbil|dbest|672245 AA052014 SWMFCA718SK 5' Lib=283[Brugia...   160  0.32      1
A cbil|dbest|1200248 AA550238 1358m3  Lib=9[Plasmo...   168  0.35      1
A cbil|dbest|1200701 AA550691 1928m3  Lib=9[Plasmo...   168  0.35      1
A cbil|dbest|560183 W51835 zc49e10.s1 3' Lib=423[Homo_sapi...   167  0.37      1
A cbil|dbest|1200632 AA550622 1803m3  Lib=9[Plasmo...   168  0.38      1
A cbil|dbest|504715 N97881 1439C3  Lib=114[Plasmo...   159  0.43      1
A cbil|dbest|28892 T09796 0377m7  Lib=9[Plasmodi...   156  0.44      1
A cbil|dbest|44119 T18080 0467c3 5' Lib=8[Plasmodium_falc...   158  0.50      1
A cbil|dbest|453198 N47669 yy54h03.r1 5' Lib=390[Homo_sapi...   156  0.50      1
A cbil|dbest|1405937 AA699323 zi44e12.s1 3' Lib=452[Homo_sa...   155  0.54      1
A cbil|dbest|349492 H48285 yq69f08.s1 3' Lib=262[Homo_sapi...   158  0.56      1
A cbil|dbest|1199999 AA549989 1068m3  Lib=9[Plasmo...   160  0.57      1
A cbil|dbest|1200127 AA550117 1216m3  Lib=9[Plasmo...   158  0.61      1
A cbil|dbest|76301 Z46694 ATTS4356 3' Lib=97[Arabidopsis_...   153  0.61      1
A cbil|dbest|1007307 AA365948 EST76885 5'-end Lib=734[Homo_...   153  0.62      1
A cbil|dbest|305948 H44897 yo04e04.r1 5' Lib=300[Homo_sapi...   150  0.65      1
A cbil|dbest|1098913 AA454414 MBAFCX1C11T3 5' Lib=531[Brugi...   155  0.66      1
A cbil|dbest|811385 AA172903 ms45f02.r1 5' Lib=532[Mus_mus...   158  0.70      1
A cbil|dbest|148716 F11670 HSC30B041  Lib=186[Hom...   150  0.70      1
A cbil|dbest|244686 R67931 yi29a01.s1 3' Lib=271[Homo_sapi...   151  0.73      1
A cbil|dbest|504758 N97924 1548C3  Lib=114[Plasmo...   154  0.73      1
A cbil|dbest|1203908 AA553540 nk78b12.s1  Lib=941[...   152  0.74      1
A cbil|dbest|1200177 AA550167 1281m3  Lib=9[Plasmo...   157  0.74      1
A cbil|dbest|504654 N97580 1320C3  Lib=114[Plasmo...   149  0.76      1
A cbil|dbest|472325 N66313 yz38a07.s1 3' Lib=371[Homo_sapi...   152  0.84      1
A cbil|dbest|702119 AA070212 zm68c05.s1 3' Lib=502[Homo_sa...   150  0.88      1
A cbil|dbest|303215 H42164 yo11b05.r1 5' Lib=300[Homo_sapi...   150  0.88      1
A cbil|dbest|775764 AA137323 mq27a04.r1 5' Lib=539[Mus_mus...   150  0.92      1
A cbil|dbest|1200510 AA550500 1656m3  Lib=9[Plasmo...   151  0.94      1
A cbil|dbest|391178 H88869 yw24b10.r1 5' Lib=371[Homo_sapi...   149  0.97      1
A cbil|dbest|855074 AA215770 zr96d03.r1 5' Lib=595[Homo_sa...   147  0.97      1
A cbil|dbest|232477 R55771 yg89e03.s1 3' Lib=263[Homo_sapi...   149  0.99      1
A cbil|dbest|1150721 AA506091 ni13a04.s1  Lib=896[...   140  0.99      1
A cbil|dbest|86076 T36043 EST96066 3'-end Lib=235[Homo_sa...   138  0.992     1
A cbil|dbest|504658 N97584 1324C3  Lib=114[Plasmo...   137  0.997     1
A cbil|dbest|804499 D86776 D86776  Lib=473[Rattus...   136  0.9992    1
A cbil|dbest|804510 D86787 D86787  Lib=473[Rattus...   136  0.9992    1
A cbil|dbest|1173139 AA528499 ne99h11.s1  Lib=890[...   148  0.9992    1
A cbil|dbest|1030727 AA389409 mp12e10.r1 5' Lib=538[Mus_mus...   136  0.9994    1



>cbil|dbest|29017 T09921 0469m7  Lib=9[Plasmodium_falciparum|||||]
            Length=267
            Length = 267

  Plus Strand HSPs:

 Score = 1300 (195.1 bits), Expect = 1.4e-52, P = 1.4e-52
 Identities = 262/267 (98%), Positives = 262/267 (98%), Strand = Plus / Plus

Query:     1 TTGTTTTATTTTGTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCA 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 TTGTTTTATTTTGTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCA 60

Query:    61 TCAAGTTTTAATTATATGATAGGCAAAACGATAGAGTATGATATAAAGATTAGTTATTAT 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 TCAAGTTTTAATTATATGATAGGCAAAACGATAGAGTATGATATAAAGATTAGTTATTAT 120

Query:   121 GAAATATATGAAGGGCATGNTAAAAATGGTGAAGAGGTTTGTGTATTTATATATGAGAAG 180
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GAAATATATGAAGGGCATGNTAAAAATGGTGAAGAGGTTTGTGTATTTATATATGAGAAG 180

Query:   181 AATAATAAAGAAACGAGTTTTGTAAAANGATATATAAAACNCCATTTGTCATATTCTAAG 240
             ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct:   181 AATAATAAAGAAACGAGTTTTGTAAAANGATATATAAAACNCCATTTGTCATATTCTAAG 240

Query:   241 AACTTAATTCATCCTANATNTTTTAAA 267
             |||||||||||||||| || |||||||
Sbjct:   241 AACTTAATTCATCCTANATNTTTTAAA 267


>cbil|dbest|1200151 AA550141 1254m3  Lib=9[Plasmodium_falciparum|||||]
            Length=690
            Length = 690

  Minus Strand HSPs:

 Score = 211 (31.7 bits), Expect = 0.0042, P = 0.0042
 Identities = 125/198 (63%), Positives = 125/198 (63%), Strand = Minus / Plus

Query:   199 AACTCG-T-TTCTTTATTATTCTTCTCATATATAAATACACAAACCTCTTCACCATTTTT 142
             AA TCG T TTCTT AT  TT  T TCAT  AT   T  A AAA  T    A  ATTTTT
Sbjct:   406 AATTCGATCTTCTTCATGTTTGATTTCATCAATTTTTGAAAAAA--TAAAAATAATTTTT 463

Query:   141 ANCAT--GCCCTTCATATATTTCAT-AATAACTAATCTTTATATCAT-ACTCTATCGTTT 86
               CAT  G   TTCATATATTTC T AATAA TAAT  T A A  AT ACT  AT  TTT
Sbjct:   464 TCCATATGTTTTTCATATATTTCTTTAATAATTAATAATAA-ACGATTACTTAATGATTT 522

Query:    85 TGCCTATCATAT-AATTAAAACTTGATGGCAAATCACCAAAAAGTTT-ATTCACAAAATA 28
             T C  AT A AT AA  AAAACT  AT   A ATCA CA A  GT T AT  A  A ATA
Sbjct:   523 TCCAGATGA-ATCAAAGAAAACTA-ATATGATATCAACATA--GTCTGATAAATCATATA 578

Query:    27 TTGTAACATTT-TAACAAAATAAAA 4
             T  TA  ATT  TA CAAAAT  AA
Sbjct:   579 TAATACTATTAATATCAAAATCTAA 603


>cbil|dbest|28897 T09801 0383m3  Lib=9[Plasmodium_falciparum|||||]
            Length=399
            Length = 399

  Plus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0042, P = 0.0042
 Identities = 159/270 (58%), Positives = 159/270 (58%), Strand = Plus / Plus

Query:     5 TTTATTT-TGTTAAAATGTTACAATAT--TTTGTGAATAAA-CTTTTTGGTGATTTGC-C 59
             TT ATT  T TTA AAT T AC  TAT  TTTGT  AT A  C TTTT  T ATTTG  C
Sbjct:    17 TTAATTCATCTTATAAT-TCACTTTATAATTTGTTTATTATTCATTTTA-TAATTTGTTC 74

Query:    60 ATCAAGTTTTAATTATATGATAGGCA-AAACGATAGAGT-ATGATATAAAGATTAGTTAT 117
             AT AA T  T  TTATA   T   CA AAA   TA A T ATG  ATAA       TTAT
Sbjct:    75 AT-AATTCATT-TTATAATTTGTTCATAAATTTTACATTTATGGCATAATTCGCTCTTAT 132

Query:   118 TA-TGAAATATATGAAGG-G--CATGNTAAAAA-TGGTGA-AGAGGTTTGTGTATTTATA 171
              A TG   TA AT AA   G  CAT  T AAA  T  T A A   GTT  T TATTTATA
Sbjct:   133 AAATGTTGTACATAAAACTGTTCATTATCAAACCTATTCACATTCGTTA-TATATTTATA 191

Query:   172 TATGAGAAGAATAATAAAGAAACGAGTTTTGTAAA-ANGATATATAAAACNCCATTTGTC 230
             TAT A    AATAAT AA  AA GA TTT GTAAA A  A A ATAAAA       T TC
Sbjct:   192 TATAANTCAAATAATTAANGAA-GA-TTTAGTAAATATTAAA-ATAAAANAGANACTATC 248

Query:   231 A-TATTCTAAGAACTTAATTCATCCTANATNTTTTAAA 267
               T TT T A    TT AT   TCCTA A  T  TAAA
Sbjct:   249 CGTTTTGTTATTTTTTCATATTTCCTACAAATNATAAA 286


>cbil|dbest|504850 N98000 2020C3  Lib=114[Plasmodium_falciparum|||||]
            Length=273
            Length = 273

  Minus Strand HSPs:

 Score = 198 (29.7 bits), Expect = 0.0084, P = 0.0083
 Identities = 148/237 (62%), Positives = 148/237 (62%), Strand = Minus / Plus

Query:   238 TAGAATATGACAAATGGNGTTTTATATATCNTTTTACAAAACTCGTTTCTTTAT-TAT-T 181
             TAGAATAT AC A T     T TA ATAT  TT TA A A  T  T T T TAT TAT T
Sbjct:    40 TAGAATATTACCATTATATATGTAAATAT-ATTATATATATATA-TATATATATATATAT 97

Query:   180 CT-TCTCATATATAAATACACAAACCTCTTCACCATTTTTAN-CATGCCC--TT--CATA 127
              T T T ATATATAAATA A A A  T TT     TTTTT   C T  CC  TT  CA A
Sbjct:    98 ATATAT-ATATATAAATATATATATTTTTTTTTTTTTTTTTTNCTTTTCCAATTGGCAAA 156

Query:   126 T-AT-TTCATAATAACTA-ATCTTTATATCATACTCTATCGTTTTGCCTATCATATAATT 70
             T AT TTC  AAT ACTA AT TTTATA C TACT T T GTTT  C T T A A A TT
Sbjct:   157 TTATATTCGAAATTACTATATTTTTATAAC-TACTTT-TGGTTTAACAT-T-A-A-ACTT 210

Query:    69 AAAACTTGATGGCAAATCACCAAAAAGTTTATTCACAAAATATTGTAACATTTTAACAAA 10
             AAAA    AT    A T A  AA AA TT AT CA AAAA A    AA A    AA AAA
Sbjct:   211 AAAAAAA-ATAT--ATTTAT-AAGAA-TTAATNCATAAAAGAAAAAAAAAAAAAAAAAAA 265

Query:     9 ATAAAACA 2
             A AAAA A
Sbjct:   266 AAAAAAAA 273


>cbil|dbest|419035 N21752 SMNHADA017050SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=386
            Length = 386

  Plus Strand HSPs:

 Score = 193 (29.0 bits), Expect = 0.0099, P = 0.0099
 Identities = 103/164 (62%), Positives = 103/164 (62%), Strand = Plus / Plus

Query:    42 ACTTTT--TGGTGATTTGC-CATCAA-GTTTTAATTATATGATAGGCAAAACGATAGAGT 97
             ACTT T  TGG  AT T C CAT AA GTT      A  T ATA G AA A   T G  T
Sbjct:   130 ACTTNTGGTGGAAATATTCTCATTAATGTTGGCCCAACTTCATATGGAACAATTTCGCCT 189

Query:    98 ATGATATAAAGATTAGTTATTATGAAATATATGAAGGGCATGN-TAAAAATGGTGAAGAG 156
             AT  TAT AAGA    TTATTA  AA TA  TGAA GG  TG  TA AAATGGTGAAG  
Sbjct:   190 ATT-TATGAAGAACGTTTATTAC-AATTAGGTGAATGGT-TGTCTATAAATGGTGAAGGT 246

Query:   157 GTTTGTG-TATTTATATATGAGAAGAATA-ATAAAGAAACGAGTTTTG 202
              TTT TG TA T A   ATG GA GAAT  A AAAGAA C A TT TG
Sbjct:   247 ATTTATGCTACTCAACCATG-GAGGAATTCAAAAAGAACCAAATTATG 293


>cbil|dbest|456311 N50782 yz23a12.s1 3'
            Lib=390[Homo_sapiens||multiple_sclerosis_lesions|||Age_46]
            Length=463
            Length = 463

  Minus Strand HSPs:

 Score = 192 (28.8 bits), Expect = 0.018, P = 0.018
 Identities = 128/198 (64%), Positives = 128/198 (64%), Strand = Minus / Plus

Query:   211 ATCNTTTTACAAAACTCGTTTCTTTATTATTCTTCTCATA-TATAAA-TACACAAAC--C 156
             A C T TTAC AAA  C TTT TTT TT TT TTCTCA   T T  A T   C      C
Sbjct:   148 AACTTCTTACTAAAG-CTTTTATTTTTTTTT-TTCTCAAGGTGTTTAGTGGGCCTTTTGC 205

Query:   155 TCTTCACCATTTTTANCATGCCCTTCATATATTTCATAATAACTAATCTTTATAT-CA-- 99
             T TT A CATTTTT  C T    TT A ATATTTCATAATAAC   T TT  TAT CA  
Sbjct:   206 TTTTTAACATTTTTTACTT----TTGAAATATTTCATAATAACCTTTGTTACTATTCAAC 261

Query:    98 TACTCTATCGT-TTTGCCTATCATATAATTAAAAC--TTGATGGCAAATCACCAAAAAGT 42
             TA  CT T  T TTTG  TATCA A A T A AAC  TTG T   AAAT A  A AA GT
Sbjct:   262 TAACCTTTAATATTTGT-TATCAAACAGTAATAACAATTGTTATTAAAT-AT-ACAA-GT 317

Query:    41 TTATTCACAAAATATTGTAACATTTTAA 14
             T ATT A  AAA   T TAACATTTTAA
Sbjct:   318 T-ATTAAACAAACCCT-TAACATTTTAA 343


>cbil|dbest|28775 T09679 0263m3  Lib=9[Plasmodium_falciparum|||||]
            Length=341
            Length = 341

  Minus Strand HSPs:

 Score = 188 (28.2 bits), Expect = 0.019, P = 0.019
 Identities = 98/162 (60%), Positives = 98/162 (60%), Strand = Minus / Plus

Query:   220 GTTTTATATATCNTTTTACAAAACTCGTTTCTTTATTATTCTTCTCATATATAAATACAC 161
             GTTT   AT T  TTTT  A  A T G TTCT TA  A   TTC C T T T  AT CA 
Sbjct:     9 GTTTCTCATTTAATTTTTNATTAATAGATTCTCTAAAAACATTC-CTTTT-TGGATGCAT 66

Query:   160 A-AACC-TCTTCACCATTT-TTANCATGCCCTTCATATATTTCATAATAACTAATCTTTA 104
             A AA   TCTTCA  AT   TTA  ATG    TCATATATTTCAT ATAA TA T TTTA
Sbjct:    67 ATAATTGTCTTCATTATCAATTAA-ATGATGATCATATATTTCATGATAATTATTTTTTA 125

Query:   103 TATCATACTCTATCGTTTTGCCTATC-ATATAATTAAAACTTGAT 60
             TATCAT     AT GT T      TC A AT AT A  AC TG T
Sbjct:   126 TATCATCAAAAATTGTATAAATNTTCCAAATGATCATCACGTGTT 170


>cbil|dbest|1133523 AA488853 aa55b10.s1 3'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=341
            Length = 341

  Plus Strand HSPs:

 Score = 185 (27.8 bits), Expect = 0.026, P = 0.026
 Identities = 131/211 (62%), Positives = 131/211 (62%), Strand = Plus / Plus

Query:    33 TGTGAATAAACTTTTTGGTGATTTG---CCATCAAGTTTTAATTATATGA-TAGGCAAAA 88
             T TGAATAAACTTT TGGT  TTTG   CCA C A TTTTA   AT  GA T  G AAAA
Sbjct:    67 TATGAATAAACTTTCTGGTCTTTTGAGACCACCCATTTTTATAGATCAGAATCAG-AAAA 125

Query:    89 C-GATAGAGTATGATATAAAGATTAGTTATTATGAAATATATGAAGGGCATGNTAAAAAT 147
             C G TA A   T A   A A ATT G   T AT   A A A  AA    A G  AAAA T
Sbjct:   126 CAGGTAAACC-TCACTCACACATTTGGACTCATTTGA-ACAAAAATCT-AGGCCAAAA-T 181

Query:   148 GGTGAAGAGGTT-TGTGTATTTATATATGAGAAGAATAA-TAAAGA-AACGAGTTTTGTA 204
               TGAA AG  T TGTGT TTT TA  TG GAAG ATA  TAA G  AA G  TTT GT 
Sbjct:   182 ACTGAAAAGCCTATGTGTTTTTTTAATTG-GAAGTATATGTAAGGTTAATGCATTTAGTG 240

Query:   205 AAAN-GA-TATATAAA-ACNCCATTTGTCATATTCTAAGA 241
             AA   GA TA A AAA AC   AT TG CA ATT   AGA
Sbjct:   241 AACGTGACTA-ACAAAGACTA-ATGTG-CACATTAACAGA 277


>cbil|dbest|1376042 AA670458 ae62h09.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=393 Author_cmt: contains Alu repetitive element;
            Length = 393

  Plus Strand HSPs:

 Score = 184 (27.6 bits), Expect = 0.028, P = 0.027
 Identities = 122/194 (62%), Positives = 122/194 (62%), Strand = Plus / Plus

Query:     6 TTATTTTGTTAAAATGTTACAATATTTTGTGAATA-AACTTTTTGGTGATTTGCCATCAA 64
             TTAT  T TT A AT     AA ATTT   GA  A AACTT     TGA   G  AT A 
Sbjct:   123 TTATGGTATTGACATTAGTGAAGATTTCA-GATCAGAACTTGACC-TGAAA-GAAATTAT 179

Query:    65 GTTTTAATTATAT-GA-TAGGCAAAA--CGATAGAGTATGATAT-A-AAGATTAGT-TAT 117
             GT T AATTATA  GA TA  CAA A  C AT GAGT T A AT A AAG  TA   TAT
Sbjct:   180 GTGT-AATTATACAGAATAACCAACATTCTATTGAGTGTAAAATCATAAGTGTAAAGTAT 238

Query:   118 TATGAAATATATGAAGGGCATGNTAAAAATGGTGAAGAGGT-TTGTGTATTTATATATGA 176
             TA  AAAT  A  AA   CAT  T A AA   T AAGAGGT TT T TATTTATAT   A
Sbjct:   239 TAACAAATTAACTAAT--CATCATGACAACT-TCAAGAGGTATTAT-TATTTATATCCAA 294

Query:   177 GAAGAATAATAAAGAAAC-GAG 197
                 AA AATAAAGAAAC GAG
Sbjct:   295 TTTTAACAATAAAGAAACTGAG 316


>cbil|dbest|875729 AA236003 zs05a03.s1 3'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=406
            Length = 406

  Minus Strand HSPs:

 Score = 185 (27.8 bits), Expect = 0.028, P = 0.028
 Identities = 131/211 (62%), Positives = 131/211 (62%), Strand = Minus / Plus

Query:   241 TCTTAGAATATGACAAATGGNGT-TTTATATA-TCNTTTT-ACAAAACTCGTTT-CTTTA 186
             TCT   AAT TG CA AT   GT TTT T TA TC   TT AC AAA  C TT  C TTA
Sbjct:   136 TCTGTTAATGTG-CACATT-AGTCTTTGT-TAGTCACGTTCACTAAATGCATTAACCTTA 192

Query:   185 T-TATTCTTCTCATATATAAATACACAAAC-CTCTTCACCATTTTTANCATGCCCTTCAT 128
               TAT CTTC  AT TA AAA ACACA A  CT TTCA  ATTTT   C  G   TT  T
Sbjct:   193 CATATACTTCCAAT-TAAAAAAACACATAGGCTTTTCAGTATTTTGGCCTAGATTTT--T 249

Query:   127 ATATTTCATAATAACTAATCTTTATATCATACTCTATC-GTTTTGCCTATCAT-ATAATT 70
              T T   AT A   C AAT T T   T A   T TA C GTTTT C  AT  T AT   T
Sbjct:   250 GT-TCAAATGAGTCCAAATGTGTGAGTGAGGTT-TACCTGTTTT-CTGATTCTGATCTAT 306

Query:    69 AAAACTTGATGG-C--AAATCACCAAAAAGTTTATTCACA 33
             AAAA T G TGG C  AAA  ACCA AAAGTTTATTCA A
Sbjct:   307 AAAAATGGGTGGTCTCAAAAGACCAGAAAGTTTATTCATA 346


>cbil|dbest|28817 T09721 0321m3  Lib=9[Plasmodium_falciparum|||||]
            Length=346
            Length = 346

  Plus Strand HSPs:

 Score = 184 (27.6 bits), Expect = 0.028, P = 0.028
 Identities = 130/206 (63%), Positives = 130/206 (63%), Strand = Plus / Plus

Query:    22 TTACA-ATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAAGTTTTAATTATATGAT 80
             TTA A AT TTTTGTGA T A  TT     TG T TG  A  AAG    AATT T  GA 
Sbjct:     4 TTATACATCTTTTGTGATTTAGGTTAAAA-TG-TATGTTA--AAGAAGAAATTGTG-GAG 58

Query:    81 -AGGCAAAACGATA-GAG-T-ATGA-TATAAAGATTAGTTATTATGAAATATATGAAGGG 135
              A G AAAAC AT  GA  T AT A TA AAAGA  AG  A  AT AAATATATGAA GG
Sbjct:    59 GAAGAAAAACTATCTGATATTATCAATAAAAAGAA-AGAAAACATAAAATATATGAAAGG 117

Query:   136 CATGNTAAAAATGGTGAAGAGGTTTGTGT-ATTT-ATATATGAGAAGAA--TAATAAAGA 191
              ATG  AAAA T  TGAA A  TT   G  ATTT A A  TGA A GAA  TA T A GA
Sbjct:   118 AATG--AAAATTCCTGAAAATATTCTAGCCATTTCAAACTTGA-AGGAAGTTATTGATGA 174

Query:   192 AACGAGTTTTGTAAAANGATATATAAA-ACNCCATT 226
               C AG TTTGT AA    T TAT A  AC CCA T
Sbjct:   175 TGC-AGATTTGTTAATATTTGTATTACCACACCAAT 209


>cbil|dbest|1133595 AA488925 aa55b10.r1 5'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=286
            Length = 286

  Minus Strand HSPs:

 Score = 185 (27.8 bits), Expect = 0.031, P = 0.030
 Identities = 131/211 (62%), Positives = 131/211 (62%), Strand = Minus / Plus

Query:   241 TCTTAGAATATGACAAATGGNGT-TTTATATA-TCNTTTT-ACAAAACTCGTTT-CTTTA 186
             TCT   AAT TG CA AT   GT TTT T TA TC   TT AC AAA  C TT  C TTA
Sbjct:    50 TCTGTTAATGTG-CACATT-AGTCTTTGT-TAGTCACGTTCACTAAATGCATTAACCTTA 106

Query:   185 T-TATTCTTCTCATATATAAATACACAAAC-CTCTTCACCATTTTTANCATGCCCTTCAT 128
               TAT CTTC  AT TA AAA ACACA A  CT TTCA  ATTTT   C  G   TT  T
Sbjct:   107 CATATACTTCCAAT-TAAAAAAACACATAGGCTTTTCAGTATTTTGGCCTAGATTTT--T 163

Query:   127 ATATTTCATAATAACTAATCTTTATATCATACTCTATC-GTTTTGCCTATCAT-ATAATT 70
              T T   AT A   C AAT T T   T A   T TA C GTTTT C  AT  T AT   T
Sbjct:   164 GT-TCAAATGAGTCCAAATGTGTGAGTGAGGTT-TACCTGTTTT-CTGATTCTGATCTAT 220

Query:    69 AAAACTTGATGG-C--AAATCACCAAAAAGTTTATTCACA 33
             AAAA T G TGG C  AAA  ACCA AAAGTTTATTCA A
Sbjct:   221 AAAAATGGGTGGTCTCAAAAGACCAGAAAGTTTATTCATA 260


>cbil|dbest|1191387 AA545284 vj94a12.s1 5'
            Lib=862[Mus_musculus|embryo|embryo|||2-cell] Length=444
            Length = 444

  Plus Strand HSPs:

 Score = 186 (27.9 bits), Expect = 0.033, P = 0.032
 Identities = 118/185 (63%), Positives = 118/185 (63%), Strand = Plus / Plus

Query:    63 AAGTTTTAATTATATGATAGGCAAAACG-ATAGAGTATGATATAAAGAT-TAGTTATTA- 119
             AAG T   ATT TAT A AG  AAAA G AT    T T ATATA A AT TA TTATTA 
Sbjct:   157 AAGCTGAGATT-TATTAAAGA-AAAATGTATTTTATGTTATATATAAATATA-TTATTAC 213

Query:   120 T-GAAATATATGAAGG-GCATGNTAAAAATGGTGAAG-AGGT-TTGTGTA-T-T-TATAT 172
             T G AA ATAT AAG  G  T  TAA  AT  T A   A GT TTGTG A T T TATA 
Sbjct:   214 TTGTAA-ATATAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAA 272

Query:   173 ATGAGAAGAATAATAAAGAAACGAGTTTTG-TAAAANGATATATA-AAACNCCATTTGTC 230
             A GAGAAGAATAA  AA A A G   TTTG T  AA  ATA AT  AAA   CAT  G C
Sbjct:   273 ACGAGAAGAATAAAGAAAAGATGCACTTTGCTTTAAT-ATAAATGCAAATAACAT--GCC 329

Query:   231 ATATTCTAAGAA 242
             A ATT  AA AA
Sbjct:   330 AAATTAAAAAAA 341


>cbil|dbest|902852 AA261860 zs18g12.s1 3'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=437
            Length = 437

  Minus Strand HSPs:

 Score = 185 (27.8 bits), Expect = 0.035, P = 0.035
 Identities = 131/211 (62%), Positives = 131/211 (62%), Strand = Minus / Plus

Query:   241 TCTTAGAATATGACAAATGGNGT-TTTATATA-TCNTTTT-ACAAAACTCGTTT-CTTTA 186
             TCT   AAT TG CA AT   GT TTT T TA TC   TT AC AAA  C TT  C TTA
Sbjct:   124 TCTGTTAATGTG-CACATT-AGTCTTTGT-TAGTCACGTTCACTAAATGCATTAACCTTA 180

Query:   185 T-TATTCTTCTCATATATAAATACACAAAC-CTCTTCACCATTTTTANCATGCCCTTCAT 128
               TAT CTTC  AT TA AAA ACACA A  CT TTCA  ATTTT   C  G   TT  T
Sbjct:   181 CATATACTTCCAAT-TAAAAAAACACATAGGCTTTTCAGTATTTTGGCCTAGATTTT--T 237

Query:   127 ATATTTCATAATAACTAATCTTTATATCATACTCTATC-GTTTTGCCTATCAT-ATAATT 70
              T T   AT A   C AAT T T   T A   T TA C GTTTT C  AT  T AT   T
Sbjct:   238 GT-TCAAATGAGTCCAAATGTGTGAGTGAGGTT-TACCTGTTTT-CTGATTCTGATCTAT 294

Query:    69 AAAACTTGATGG-C--AAATCACCAAAAAGTTTATTCACA 33
             AAAA T G TGG C  AAA  ACCA AAAGTTTATTCA A
Sbjct:   295 AAAAATGGGTGGTCTCAAAAGACCAGAAAGTTTATTCATA 334


>cbil|dbest|539519 W31685 zb97e06.s1 3'
            Lib=417[Homo_sapiens|parathyroid_gland|parathyroid_tumor|||adult]
            Length=382
            Length = 382

  Plus Strand HSPs:

 Score = 181 (27.2 bits), Expect = 0.036, P = 0.035
 Identities = 101/163 (61%), Positives = 101/163 (61%), Strand = Plus / Plus

Query:     2 TGTTTTATTTTGTTAAAATG-TTACAATATTTTGTGAA-TAAACTTTTTGGTGATTTGCC 59
             TGTTTTATTTT T  AAATG TT  AATATTTT TG A TA A   T T  T AT T C 
Sbjct:    70 TGTTTTATTTT-TACAAATGGTTTTAATATTTT-TGTAGTACAGCATATATTCATATACT 127

Query:    60 ATCAA-GTTT--TAATTATATGATAGGCAAAACGAT--AGAGTATGATATAAAGATTAGT 114
             A  AA GT T  TAATT TA   TA GCAA   G T  AG GTATGA ATA   A T  T
Sbjct:   128 AAAAAAGTGTGATAATT-TAAATTATGCAATGGGTTTTAGGGTATGAAATACCCAATTTT 186

Query:   115 TATTATGAAATATATGAAGGGCATGNTAAAAATGGTGA-AGAGGTT 159
              A  AT AAATATA  AA GG A   T  A  T  T A AGAGG T
Sbjct:   187 AAGCATTAAATATACAAAAGGAAAAGTGGATTTATTTACAGAGGAT 232


>cbil|dbest|463162 N57554 yy81e07.s1 3'
            Lib=390[Homo_sapiens||multiple_sclerosis_lesions|||Age_46]
            Length=468
            Length = 468

  Minus Strand HSPs:

 Score = 185 (27.8 bits), Expect = 0.042, P = 0.041
 Identities = 131/211 (62%), Positives = 131/211 (62%), Strand = Minus / Plus

Query:   241 TCTTAGAATATGACAAATGGNGT-TTTATATA-TCNTTTT-ACAAAACTCGTTT-CTTTA 186
             TCT   AAT TG CA AT   GT TTT T TA TC   TT AC AAA  C TT  C TTA
Sbjct:   121 TCTGTTAATGTG-CACATT-AGTCTTTGT-TAGTCACGTTCACTAAATGCATTAACCTTA 177

Query:   185 T-TATTCTTCTCATATATAAATACACAAAC-CTCTTCACCATTTTTANCATGCCCTTCAT 128
               TAT CTTC  AT TA AAA ACACA A  CT TTCA  ATTTT   C  G   TT  T
Sbjct:   178 CATATACTTCCAAT-TAAAAAAACACATAGGCTTTTCAGTATTTTGGCCTAGATTTT--T 234

Query:   127 ATATTTCATAATAACTAATCTTTATATCATACTCTATC-GTTTTGCCTATCAT-ATAATT 70
              T T   AT A   C AAT T T   T A   T TA C GTTTT C  AT  T AT   T
Sbjct:   235 GT-TCAAATGAGTCCAAATGTGTGAGTGAGGTT-TACCTGTTTT-CTGATTCTGATCTAT 291

Query:    69 AAAACTTGATGG-C--AAATCACCAAAAAGTTTATTCACA 33
             AAAA T G TGG C  AAA  ACCA AAAGTTTATTCA A
Sbjct:   292 AAAAATGGGTGGTCTCAAAAGACCAGAAAGTTTATTCATA 331


>cbil|dbest|504799 N97949 1710C3  Lib=114[Plasmodium_falciparum|||||]
            Length=391
            Length = 391

  Plus Strand HSPs:

 Score = 177 (26.6 bits), Expect = 0.066, P = 0.064
 Identities = 141/220 (64%), Positives = 141/220 (64%), Strand = Plus / Plus

Query:     1 TTGTTTTATTTTGTTAAAATGTTACAATATTTT-GTGAATAAACTTTTTGGTGATTTGCC 59
             TTG TTTATTTTGTTA A TG TA  ATA T   G  AATAA  T TTT  TGA     C
Sbjct:   155 TTGATTTATTTTGTTATA-TGATAATATAATACAGAAAATAATATCTTTA-TGAA----C 208

Query:    60 ATCAAGTTTTAATTATATGATAGGC-A-AA-ACGATAGA--GTATGATATAAAGATTAGT 114
             A CAAGTT T  TTA A GA A  C A AA A  ATA A  GTAT  TATA  GA TAG 
Sbjct:   209 A-CAAGTTAT--TTACACGAAAATCCAGAAGATCATACACAGTATTTTATAG-GAGTAGC 264

Query:   115 TATTATGAAATATATGAAGGGCA-TGNTAAAA-ATGG-TGAAGAG-GTTTG--TGTATTT 168
              AT A  AAATA AT AA    A T  TA    A  G TG A AG GT T   T TATTT
Sbjct:   265 -ATAAATAAATAAATAAATAAAAATAATACCGTACCGCTGTAAAGTGTATAAATATATTT 323

Query:   169 ATATATG-AGAAGAA-TAATAAAG-A-AACGAGTTTTGTAAAANGATATATA 216
             ATATAT  AGAA  A T ATA AG A AA  AGT TT TA A  G TAT TA
Sbjct:   324 ATATATATAGAAATACTTATATAGCAGAATAAGTATTTTATA-TGTTATTTA 374


>cbil|dbest|504807 N97957 1718C3  Lib=114[Plasmodium_falciparum|||||]
            Length=395
            Length = 395

  Minus Strand HSPs:

 Score = 177 (26.6 bits), Expect = 0.068, P = 0.066
 Identities = 151/273 (55%), Positives = 151/273 (55%), Strand = Minus / Plus

Query:   267 TTTAAAANATNTAGGAT-GAATTAAGT-TCT-TAGAATATGACAAATGGNGTTTTATATA 211
             T TAAAA  T     AT G ATTA  T T T TA AA  T ACAAA          TAT 
Sbjct:   120 TATAAAATTTCACAAATAGTATTATATATATATATAAATTCACAAAAAACTAGCGCTAT- 178

Query:   210 TCNTTTTACAAAACTCGTTTCTTTATTAT-TCTTCTC-ATATATAAATACACAAACCTCT 153
             T   T TA A A  T  TT CTTT  TA  T TT T  ATATATAAATA A A    T T
Sbjct:   179 TGAGTGTATATATATT-TTACTTTTGTAGATATTATATATATATAAATATATATGTATGT 237

Query:   152 TCACCATTTTTANCATGCCCTTCATATATTTCATA-ATAACTAATCTTTATATCATAC-T 95
               A  AT T TA  AT    T  AT TAT T AT  A AA TA T TTTA A  A  C T
Sbjct:   238 ATAATATATATATTATTATATGTATTTATGT-ATCCAGAAATATTTTTTACAATAGTCAT 296

Query:    94 CTATCGTTTT-GCCTATCATATAATTAAAACTTGATGGCAAATCACCAAAAAGTTTATTC 36
              T TC  TTT G CTAT  TATAA  AAAA TT AT   A AT    A  A  T  A  C
Sbjct:   297 TTTTCACTTTCGTCTATTTTATAAAAAAAAATTTATATAATATTTATATTAT-TAGAAAC 355

Query:    35 ACAAAATATTGTAACATTTTAAC-AA-AATAAAACAA 1
             ACA A TA   TAA ATT  A   AA AATAAAA AA
Sbjct:   356 ACACATTAGATTAAAATTAAATTTAATAATAAAAAAA 392


>cbil|dbest|504535 N98162 1106C3  Lib=114[Plasmodium_falciparum|||||]
            Length=281
            Length = 281

  Minus Strand HSPs:

 Score = 177 (26.6 bits), Expect = 0.072, P = 0.070
 Identities = 111/199 (55%), Positives = 111/199 (55%), Strand = Minus / Plus

Query:   193 TTTCTTTATTAT-TCTTCTC-ATATATAAATACACAAACCTCTTCACCATTTTTANCATG 136
             TT CTTT   A  T TT T  ATATATAAATA A A    T T  A  AT T TA  AT 
Sbjct:    21 TTACTTTTGNAGATATTATATATATATAAATATATATGTATGTATAATATATATATTATT 80

Query:   135 CCCTTCATATATTTCATAATAACTAATCTTTATATCATAC-TCTATCGTTTT-GCCTATC 78
                T  AT TAT T    A AA TA T TTTA A  A  C T T TC  TTT G CTAT 
Sbjct:    81 ATATGTATTTATGTNTCCAGAAATATTTTTTACAATAGNCATTTTTCACTTTCGTCTATT 140

Query:    77 ATATAATTAAAACTTGATGGCAAATCACCAAAAAGTTTATTCACAAAATATTGTAACATT 18
              TATAA  AAAA TT AT   A AT     A  A T  A  CACA A TA   TAA ATT
Sbjct:   141 TTATAAAAAAAAATTTATATAATATTNTATATTATTAGAAACACACATTAGATTAAAATT 200

Query:    17 TTAAC-AA-AATAAAACAA 1
               A   AA AATAAAA AA
Sbjct:   201 AAATTTAATAATAAAAAAA 219


>cbil|dbest|1200551 AA550541 1703m3  Lib=9[Plasmodium_falciparum|||||]
            Length=432
            Length = 432

  Minus Strand HSPs:

 Score = 175 (26.3 bits), Expect = 0.11, P = 0.11
 Identities = 117/177 (66%), Positives = 117/177 (66%), Strand = Minus / Plus

Query:   198 ACTCGTTTCTTTATTATTCTTCT-CATATATAAATACACAAACCTCTTCACCATTTTTAN 140
             ACTC  TT TTTATT TT TTCT CATATATAAAT  A A A  T TT A C TTTT A 
Sbjct:   254 ACTCTCTT-TTTATTTTT-TTCTTCATATATAAATTTA-ATA--T-TTAAAC-TTTTCAA 306

Query:   139 CATGCC-CTTCATATATTTCATAATAACTAATCTTTA-TATCATA-CTCT-ATCGT-TTT 85
              A GC  CTTC T T TTTC T  TA  TA  C T A TAT AT  CTCT ATC T TTT
Sbjct:   307 GA-GCATCTTCTTTTGTTTCTTTTTAT-TACACATAAGTATAATTTCTCTCATCCTCTTT 364

Query:    84 GCCTATCATATAATT-AAAACTT-G-ATGGCAAATCACCAAAAAG-TT-TATTCACAAAA 30
               CT T ATAT  T  AAAAC   G ATGG    T  C AA A   TT T TTCAC  A 
Sbjct:   365 TTCT-TAATATCGTGGAAAACAAAGGATGGTCCCTTTCTAATATTATTCTCTTCACTCAT 423

Query:    29 T-ATTGT 24
             T ATTGT
Sbjct:   424 TTATTGT 430


>cbil|dbest|1311328 AA613700 no38g01.s1 
            Lib=994[Homo_sapiens|prostate|prostate_tumor|||] Length=413
            Author_cmt: gb:M82809 ANNEXIN IV (HUMAN);
            Length = 413

  Minus Strand HSPs:

 Score = 174 (26.1 bits), Expect = 0.11, P = 0.11
 Identities = 104/155 (67%), Positives = 104/155 (67%), Strand = Minus / Plus

Query:   214 TATATCNTTTTACAAAACTCGTTTCTTTA-TT-AT-T-CT-TCT-CATATA-TAAATAC- 163
             TAT  C T TT CA AA T GTTTCT  A TT AT T C  T T CATATA TAA TAC 
Sbjct:    19 TATTACTTCTT-CATAA-T-GTTTCTGGAGTTGATATTCACTGTGCATATAGTAATTACT 75

Query:   162 ACAAACCTCTTCACCATTTTTANCATGCCCTTCATATATTTCA-TAATAACTAATCTTTA 104
             AC A C TCT  A   TTTTTA  AT    TT AT T T TCA TAATAA T  TCTTTA
Sbjct:    76 ACTATCTTCTATATTGTTTTTAA-ATA---TT-ATTTTTATCACTAATAAGTTTTCTTTA 130

Query:   103 TATCATACTCTATCGTTTTGCCTA-T-CATATAATTAAAACTT 63
             TATCATACT TAT     TGC TA T CAT    T AA AC T
Sbjct:   131 TATCATACTATATTCAGATGCATACTTCATTCCCTGAATACCT 173


>cbil|dbest|504425 N97575 1020C3  Lib=114[Plasmodium_falciparum|||||]
            Length=394
            Length = 394

  Plus Strand HSPs:

 Score = 171 (25.7 bits), Expect = 0.14, P = 0.13
 Identities = 85/129 (65%), Positives = 85/129 (65%), Strand = Plus / Plus

Query:    70 AATTATA-TGATAGGCAAAACGATAGAGTATGATATAAAGATTAGTTATTATGAAATATA 128
             AA  ATA TGA A G A AA GA A AG AT AT  A AGA TA T A  A GAA TA A
Sbjct:    24 AAGAATAATGAGAAGAATAATGAGA-AGAATAATGAACAGAATAATGAGAA-GAA-TA-A 79

Query:   129 TGAAGGGCATGNT-A-AA-AATGGTGAAGAGGTTTGTGT-ATTTATATATGAGAAGAATA 184
             TGAA  G AT  T A AA AAT  TGAA AG  T  TG  A   ATA ATGAGAAGAATA
Sbjct:    80 TGAACAGAATAATGAGAAGAATAATGAACAGAATAATGAGAAGAATA-ATGAGAAGAATA 138

Query:   185 ATAAAGAAACGAGT 198
             AT AA A A GA T
Sbjct:   139 ATGAACAGAAGAAT 152


>cbil|dbest|504537 N98164 1109C3  Lib=114[Plasmodium_falciparum|||||]
            Length=350
            Length = 350

  Plus Strand HSPs:

 Score = 168 (25.2 bits), Expect = 0.15, P = 0.14
 Identities = 74/112 (66%), Positives = 74/112 (66%), Strand = Plus / Plus

Query:    66 TTTTAATTATATGATAGGCAAAACGATAGAGTATGATATAAAGATTAGTTATTATGAAAT 125
             T TT ATTAT  G  AG C A   GAT    TA GA ATA A AT AGTT TTATGAAAT
Sbjct:    94 TATTTATTATTAGGGAGTCCATTAGATTCTTTA-GAAATATATATGAGTTGTTATGAAAT 152

Query:   126 ATATGAAGGGCATGNTAA-A-AATGG-TGAAGAGGTTTGTG-TATTTATATATGA 176
             AT T AAG  CA G T A A AAT   TGAAG GG  TGT  TATTT T T TGA
Sbjct:   153 ATGTAAAGATCAGGATGATATAATATATGAAG-GGAATGTTATATTT-TGTNTGA 205


>cbil|dbest|1027912 AA386604 vb53c03.r1 5'
            Lib=845[Mus_musculus|embryo|embryo|||11.5dpc] Length=513
            Length = 513

  Plus Strand HSPs:

 Score = 175 (26.3 bits), Expect = 0.15, P = 0.14
 Identities = 83/121 (68%), Positives = 83/121 (68%), Strand = Plus / Plus

Query:    17 AAATGTTACAATATTTTGTGAA-TA-AACTTTTTGG-TG-ATT-TG--CCATCAAGTTTT 69
             A AT TTA AA  TTTT TGAA T  AACTT T    T  A T TG  CC T AAGTTTT
Sbjct:   145 ACATTTTAAAAAGTTTTATGAAGTTCAACTTGTAAACTTCAGTCTGAGCCTTGAAGTTTT 204

Query:    70 AATTATATGATAGGCAAAACGATAGAGTATGA-TATAAAGATTAGTTATTATGAAATATA 128
             AATTAT TGA AG    AAC ATA   T TGA T T  A  TTA TTATT TGAA TATA
Sbjct:   205 AATTATTTGA-AGTTTCAAC-ATATTATTTGAATTTTTATTTTA-TTATT-TGAATTATA 260

Query:   129 TGAAG 133
             TGAAG
Sbjct:   261 TGAAG 265


>cbil|dbest|1117131 AA472361 vh06e09.r1 5'
            Lib=868[Mus_musculus|mammary_gland|mammary_gland|||4_weeks]
            Length=378
            Length = 378

  Plus Strand HSPs:

 Score = 169 (25.4 bits), Expect = 0.16, P = 0.15
 Identities = 63/90 (70%), Positives = 63/90 (70%), Strand = Plus / Plus

Query:    16 AAAATG-TTACAATAT-TTTG-TGAATAAACTTTTTGGTGATTTGCCATCAAGTTTTAAT 72
             AAAAT  TTACA TAT TTT  TGAATAAACTTTT  G   T TGCCAT   GTTT AA 
Sbjct:   148 AAAATAATTACACTATATTTAATGAATAAACTTTTGAGATTTCTGCCATATTGTTTCAAG 207

Query:    73 TATATGATAGGCAAAACGATAGAGTATGATAT 104
             TATA  A AG C AAA  AT GAG A G  AT
Sbjct:   208 TATAGTAAAGTCTAAAA-AT-GAGCAAGCCAT 237


>cbil|dbest|260403 H00523 yj24g05.r1 5'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=346
            Length = 346

  Minus Strand HSPs:

 Score = 164 (24.6 bits), Expect = 0.23, P = 0.20
 Identities = 116/187 (62%), Positives = 116/187 (62%), Strand = Minus / Plus

Query:   253 GATGA-ATTAAGTTCTTAGAATATGACAAATGGNGTT--T-TATATATCNTTTTACAAAA 198
             GAT A ATT A TT TTAGAA AT A A AT   GTT  T TA AT TC T  T  A A 
Sbjct:   116 GATAATATTTACTT-TTAGAA-ATAA-ATATTTAGTTATTCTAGATGTCTTCCTCTACAT 172

Query:   197 CTCGTTTCTTTATTATTCTTCTCATATATAAA-TACACAAACCTCTTCACCATTTTTANC 139
             CTC  TT T   TT T C T TC T T T    T C CA AC T TTCA  AT T TA C
Sbjct:   173 CTCCATT-TCCCTT-TCCGTTTCTTTTTTTTCGTGC-CATAC-TGTTCATGATATATACC 228

Query:   138 ATGCCCTTCATATATTTCATAATAACTAATCTTTAT-ATCATACTCTATCGTTTTGCCTA 80
              T C  TTCATAT TTT ATA  AA TAAT  T AT AT   A T  A  GT  TGC  A
Sbjct:   229 -T-CT-TTCATAT-TTTGATATCAA-TAATGATAATGATAGGATTAAAA-GTAATGCGGA 282

Query:    79 TCATATAATTAAA 67
             TCATATAATT AA
Sbjct:   283 TCATATAATTTAA 295


>cbil|dbest|1200306 AA550296 1425m3  Lib=9[Plasmodium_falciparum|||||]
            Length=626
            Length = 626

  Minus Strand HSPs:

 Score = 171 (25.7 bits), Expect = 0.30, P = 0.26
 Identities = 71/112 (63%), Positives = 71/112 (63%), Strand = Minus / Plus

Query:   188 TTATTATTCTTCTCATATATAAATACACAAACCTCT-TCACCATTTTTANCATGCCCTTC 130
             TTATTA T TT T AT TAT A  A          T TCACCATTTTT   AT   C TC
Sbjct:     4 TTATTACTATTATTAT-TATCACCATTTTTTTTATTATCACCATTTTTTTTATTATCATC 62

Query:   129 ATATATTTCATAATAACTAATCTTTATATCATACTCTATCGTTTTGCCTATCA 77
             ATAT TTTCAT AT AC A T TTT TAT AT C C AT  TTTT   TATCA
Sbjct:    63 ATATTTTTCATTATCACCATTTTTTTTATTAT-CACCATTTTTTTCATTATCA 114

 Score = 156 (23.4 bits), Expect = 1.5, P = 0.79
 Identities = 94/152 (61%), Positives = 94/152 (61%), Strand = Minus / Plus

Query:   219 TTTTATATATCNTT-TTACAAA-ACTCGTTTCTTTATTATT--CTTCTCATATATAAATA 164
             T TTAT TA   TT TTA  A  AC   TTT TTTATTAT   C T T  T TAT A  A
Sbjct:     2 TATTAT-TACTATTATTATTATCACCATTTTTTTTATTATCACCATTTTTTTTATTATCA 60

Query:   163 -CACAAACCTC-TT--CACCATTTTTANCATGCCCTTCATATATTTCATAATAACTAATC 108
              CA A    TC TT  CACCATTTTT   AT   C  CAT T TTTCAT AT AC A T 
Sbjct:    61 TCATATTTTTCATTATCACCATTTTTTTTATTATCACCATTTTTTTCATTATCACCATTT 120

Query:   107 TTTATATCAT-AC--TCTATCGTTTTGCCTATCA 77
             TTT  AT AT AC  TCT TC TTTT   TATCA
Sbjct:   121 TTTTCATTATCACCATCT-TCCTTTTTATTATCA 153


>cbil|dbest|241043 R64288 yi21h01.r1 5'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=475
            Length = 475

  Minus Strand HSPs:

 Score = 168 (25.2 bits), Expect = 0.30, P = 0.26
 Identities = 116/186 (62%), Positives = 116/186 (62%), Strand = Minus / Plus

Query:   253 GATGA-ATTAAGTTCTTAGAATATGACAAATGGNGTT--T-TATATATCNTTTTACAAAA 198
             GAT A ATT A TT TTAGAA AT A A AT   GTT  T TA AT TC T  T  A A 
Sbjct:   163 GATAATATTTACTT-TTAGAA-ATAA-ATATTTAGTTATTCTAGATGTCTTCCTCTACAT 219

Query:   197 CTCGTTTCTTTATTATTCTTCTCATATATAAA-TACACAAACCTCTTCACCATTTTTANC 139
             CTC  TT T   TT T C T TC T T T    T C CA AC T TTCA  AT T TA C
Sbjct:   220 CTCCATT-TCCCTT-TCCGTTTCTTTTTTTTCGTGC-CATAC-TGTTCATGATATATACC 275

Query:   138 ATGCCCTTCATATATTTCATAATAACTAATCTTTAT-ATCATACTCTATCGTTTTGCCTA 80
              T C  TTCATAT TTT ATA  AA TAAT  T AT AT   A T  A  GT  TGC  A
Sbjct:   276 -T-CT-TTCATAT-TTTGATATCAA-TAATGATAATGATAGGATTAAAA-GTAATGCGGA 329

Query:    79 TCATATAATTAA 68
             TCATATAATTAA
Sbjct:   330 TCATATAATTAA 341


>cbil|dbest|1106083 AA461348 zx70c05.r1 5' Lib=843[Homo_sapiens|||||8-9_weeks]
            Length=507
            Length = 507

  Minus Strand HSPs:

 Score = 167 (25.1 bits), Expect = 0.37, P = 0.31
 Identities = 149/252 (59%), Positives = 149/252 (59%), Strand = Minus / Plus

Query:   264 AAAANATNTAGGATGAATTAAGTTCTTAGAATATGACAA-ATGGNGTTTTATATATCNTT 206
             AAA  A  TAG A G    A G T  T GAATA  A A  AT G   TT  T TATC TT
Sbjct:   118 AAATAAACTAGAAGGCCAGAGGATAATGGAATAAAAGATCATTGCAATTACT-TATCCTT 176

Query:   205 T-TACAAAACTCGTTTCTTTATTA-TTCTTCTCATATATAAATACACAAACCTCTTCA-C 149
               TA AAA  T GTTT T TATTA TT T CT AT  A  AA ACA    C  C     C
Sbjct:   177 CCTAAAAATATAGTTT-TATATTAATTGTGCTTATGGAAGAA-ACAATGTCAGCCAAGTC 234

Query:   148 CATTTT-TANCATGCCCTTCATATATTTCAT-AATAACTA-ATCTTTATATCATACTCTA 92
             CATTTT TA   TG   T CA  T TTT A  AATA   A ATCT  A  TC T C C A
Sbjct:   235 CATTTTATAGTTTGAG-TGCAATTCTTTGAACAATAGAAATATCTGCAG-TCTTTCAC-A 291

Query:    91 TCGTTTTGCCTATCATATAATTAAAACTTG-ATGGCA-AATCACCAAAAAGTTTAT-TCA 35
               G TTTG  TAT  TAT  T AA A TT  AT   A AATC  C   AAG   AT TCA
Sbjct:   292 --GATTTG--TAT--TATGCTGAAGAGTTTCATCTGACAATCTGCTTCAAGAA-ATCTCA 344

Query:    34 CAAAATATTGTAACATTTTAAC 13
              A AATAT  TAACATTTTAAC
Sbjct:   345 GANAATATGATAACATTTTAAC 366


>cbil|dbest|1026299 AA384826 EST98577 5'-end
            Lib=692[Homo_sapiens|thyroid_gland||||adult] Length=233
            Length = 233

  Minus Strand HSPs:

 Score = 163 (24.5 bits), Expect = 0.37, P = 0.31
 Identities = 123/199 (61%), Positives = 123/199 (61%), Strand = Minus / Plus

Query:   197 CTCGTTTCTTTATTATTCTTCTCA-T-ATATAAATACACA-AACCTCTTCACCATTTTTA 141
             CTC T  CTTTAT AT  T    A T AT TAA T C CA AAC T TTC   AT T TA
Sbjct:    30 CTCATC-CTTTATGATGTTGAGAAATCATCTAATTTCTCAGAACTTTTTCTT-ATCTCTA 87

Query:   140 NCATGCCCTTCATATATT-TCATAATAACTAATCTTTATATCATACTCTATCGTTTTGCC 82
              CA  C  TT AT TA   T ATA TA     TC  T TATCATAC   ATC TT TG  
Sbjct:    88 ACA--CAGTT-AT-TACCATAATANTATTGTCTCCATTTATCATACAGGATCATTATGAA 143

Query:    81 TATCATAT-AATTAAAAC-T-TGATG--GCAAATCAC-CA-AAAAG-TTTATTCACAAAA 30
               T A AT AA TA  A  T TGA    GC   T A  CA AAAAG TTTAT  ACAAAA
Sbjct:   144 AGTAAAATGAAGTAGTATATATGAAAATGCTTTTTAAACACAAAAGCTTTAT--ACAAAA 201

Query:    29 TATTGTAACATTTTAACAAAATAAAAC 3
             TATTGT   ATTT AA AA  TAAA C
Sbjct:   202 TATTGTTGAATTTAAATAAGGTAAATC 228


>cbil|dbest|1233741 AA583227 nn33f11.s1 
            Lib=989[Homo_sapiens|stomach|gastric_tumor|||] Length=443
            Author_cmt: contains Alu repetitive element;
            Length = 443

  Plus Strand HSPs:

 Score = 165 (24.8 bits), Expect = 0.38, P = 0.31
 Identities = 101/165 (61%), Positives = 101/165 (61%), Strand = Plus / Plus

Query:   107 AGATTAGT--TATT-ATGAAATA-T-ATGAAGGGCATGNT-AAAAATGGTGAAGAGGTTT 160
             AGA TAGT  TATT ATGA A A T ATGAA    A G T AAAAAT GT AA A  TTT
Sbjct:   183 AGAATAGTACTATTGATGACACAATGATGAACTATAGGTTCAAAAATTGTTAATAT-TTT 241

Query:   161 G-TGTATTTATATATGAGAAGAATAATAAAGAAACGAGTTT-TGTAAAANGATATATAAA 218
             G TGTATTTATAT T A  A A   ATA   A    AGT T T TA AA  A  T TA A
Sbjct:   242 GCTGTATTTATATGTAAATACATGCATATGTATGTAAGTATATCTACAAGTAAGT-TACA 300

Query:   219 A-CNCCATTTGTCATATTCTAAGAACTTAATTCATCCTANATNTTTTAA 266
               C  CAT    C T TTCT   AA  TA TTCA CCT  AT  T TAA
Sbjct:   301 GGCATCATGACACTTCTTCTCTAAA--TACTTCAGCCTGTATCATCTAA 347


>cbil|dbest|672245 AA052014 SWMFCA718SK 5' Lib=283[Brugia_malayi|||||]
            Length=313
            Length = 313

  Minus Strand HSPs:

 Score = 160 (24.0 bits), Expect = 0.38, P = 0.32
 Identities = 68/103 (66%), Positives = 68/103 (66%), Strand = Minus / Plus

Query:   259 ATNTAGGATGAATTAA-GTTCTTAGAATATGACA-AATGGN---G-TTTTATATATCNTT 206
             AT T   AT A TTAA GTT TTA   TATGA A AAT      G TTTTATATATC TT
Sbjct:   188 ATTTTTAATAATTTAAAGTTTTTAATTTATGATATAATTATTTAGCTTTTATATATCCTT 247

Query:   205 TTACAAAACTCGTTTCTTTATTATTCTTCTCATATATAAATACA 162
             TT CA  ACT   T CTTTATT TT T    ATA ATAAA ACA
Sbjct:   248 TTTCATTACTTTCTCCTTTATTTTTTTAGAAATA-ATAAAAACA 290


>cbil|dbest|1200248 AA550238 1358m3  Lib=9[Plasmodium_falciparum|||||]
            Length=653
            Length = 653

  Minus Strand HSPs:

 Score = 168 (25.2 bits), Expect = 0.43, P = 0.35
 Identities = 110/173 (63%), Positives = 110/173 (63%), Strand = Minus / Plus

Query:   237 AGAATATGA-CAAATGGNGTTTTATATATCNTTTTACAAA-ACTCGTTTCTTTATTATTC 180
             A AATAT A C AATG   T  TA   A C T TTACA   A TCGTTT TTT TT TT 
Sbjct:   479 ATAATATCATCCAATGTATTGGTACG-A-CCTCTTACATTCAATCGTTTATTTTTT-TTA 535

Query:   179 TTCTCATATATAAATACACAA-ACCTCTTCA-CCATTTTTAN-CATGCCC-T-TCAT-AT 126
             TT T A A  T  AT   CAA A CT T  A CCAT TT A  CAT     T T AT AT
Sbjct:   536 TT-TAA-ACGTTCATTTTCAATATCTGTATATCCATGTTCATTCATATATGTATTATTAT 593

Query:   125 --ATTTCATAATAACTAATCTTTATATCATACT-CTATCGTTTTGCCTATCATATAATTA 69
               ATTTCATAATAACTA T TTT T T  T  T CT T  TTTTG C AT ATATA  TA
Sbjct:   594 TCATTTCATAATAACTATTATTTTTTTTGTTTTTCTTTA-TTTTGTC-ATTATATATATA 651


>cbil|dbest|1200701 AA550691 1928m3  Lib=9[Plasmodium_falciparum|||||]
            Length=663
            Length = 663

  Minus Strand HSPs:

 Score = 168 (25.2 bits), Expect = 0.44, P = 0.35
 Identities = 122/201 (60%), Positives = 122/201 (60%), Strand = Minus / Plus

Query:   206 TTTACAAAACTCGTTTCTTTATTATTCTTCTCATATATAAA-TACACAAACCTCTTCACC 148
             TTT  A AAC C TTTCTTTATTATT TT T  TATA AAA T     AA CTCTT    
Sbjct:   424 TTTGAACAAC-CTTTTCTTTATTATTATTTTTTTATAGAAACTTGTGTAAACTCTTGTT- 481

Query:   147 ATTTTTANCATGCCCTTCATATATTTCATAATA-ACTAATCTTTAT-ATCA-TACTCTAT 91
             ATTTT A   T    TT A A AT   A AAT  ACTA T T  A  ATCA TA T TA 
Sbjct:   482 ATTTTGATTTTT---TTGA-AGATGA-AGAATTTACTATTTTAAAGGATCAGTATTATAA 536

Query:    90 CG-TT-T-TGCCTATCATATAAT-TAAAACTTGATGGCAAATCACCAAAAAGTTTATTCA 35
                TT T TG   A  ATA AA  TAAAA T  AT   A AT    AAA A TTTA   A
Sbjct:   537 AACTTCTATGGAAAAAATAGAAAATAAAAATATATATAATATTGAAAAATATTTTAAATA 596

Query:    34 CAAAATATTGTAACATTTTAACAAAATAA 6
               AA  AT  TAA ATTTTA  AAAA AA
Sbjct:   597 TGAAC-ATGTTAAAATTTTATTAAAACAA 624


>cbil|dbest|560183 W51835 zc49e10.s1 3'
            Lib=423[Homo_sapiens||senescent_fibroblast|||] Length=620
            Length = 620

  Minus Strand HSPs:

 Score = 167 (25.1 bits), Expect = 0.46, P = 0.37
 Identities = 125/199 (62%), Positives = 125/199 (62%), Strand = Minus / Plus

Query:   242 TTC-TTAGAATATGACAAATGGNGTTTTATATATCNTTTT-ACAAAACTCGTTTCTTTAT 185
             TTC TT  AA AT A AA T    TT  A ATA   T T  A AAAAC    TT TTTAT
Sbjct:    19 TTCATTTTAA-ATTATAATTTTTATTAAA-ATAAAATATACATAAAACAACATT-TTTAT 75

Query:   184 TATTCTTCTCATATATAAATACACAAACCTCTTCACCATTTTTANCATGCCCTTCATATA 125
              A   T CT ATA ATAA TA A AAA    TTCACCATTTT A CAT C CTT A AT 
Sbjct:    76 CAAAATCCT-ATAAATAATTAAAAAAA----TTCACCATTTTAACCAT-CTCTTAAAATC 129

Query:   124 TTTCATAATAACTA-ATCTT-TATAT-CATACTCTATCGTTTTGCCTATC-ATATAATT- 70
             T   AT  TAAC A AT T  TA AT CATA   TA      T  CT TC ATATA TT 
Sbjct:   130 TACAATT-TAACAACATTTAATACATTCATAACATACAACCATCACT-TCTATATACTTC 187

Query:    69 -AAAAC-TTGATGGCAAATCACCAAAAA 44
              AAAAC TT AT  CA A CA  AAAAA
Sbjct:   188 CAAAACCTTCAT--CACACCAAAAAAAA 213


>cbil|dbest|1200632 AA550622 1803m3  Lib=9[Plasmodium_falciparum|||||]
            Length=746
            Length = 746

  Minus Strand HSPs:

 Score = 168 (25.2 bits), Expect = 0.47, P = 0.38
 Identities = 122/201 (60%), Positives = 122/201 (60%), Strand = Minus / Plus

Query:   206 TTTACAAAACTCGTTTCTTTATTATTCTTCTCATATATAAA-TACACAAACCTCTTCACC 148
             TTT  A AAC C TTTCTTTATTATT TT T  TATA AAA T     AA CTCTT    
Sbjct:   424 TTTGAACAAC-CTTTTCTTTATTATTATTTTTTTATAGAAACTTGTGTAAACTCTTGTT- 481

Query:   147 ATTTTTANCATGCCCTTCATATATTTCATAATA-ACTAATCTTTAT-ATCA-TACTCTAT 91
             ATTTT A   T    TT A A AT   A AAT  ACTA T T  A  ATCA TA T TA 
Sbjct:   482 ATTTTGATTTTT---TTGA-AGATGA-AGAATTTACTATTTTAAAGGATCAGTATTATAA 536

Query:    90 CG-TT-T-TGCCTATCATATAAT-TAAAACTTGATGGCAAATCACCAAAAAGTTTATTCA 35
                TT T TG   A  ATA AA  TAAAA T  AT   A AT    AAA A TTTA   A
Sbjct:   537 AACTTCTATGGAAAAAATAGAAAATAAAAATATATATAATATTGAAAAATATTTTAAATA 596

Query:    34 CAAAATATTGTAACATTTTAACAAAATAA 6
               AA  AT  TAA ATTTTA  AAAA AA
Sbjct:   597 TGAAC-ATGTTAAAATTTTATTAAAACAA 624


>cbil|dbest|504715 N97881 1439C3  Lib=114[Plasmodium_falciparum|||||]
            Length=386
            Length = 386

  Plus Strand HSPs:

 Score = 159 (23.9 bits), Expect = 0.57, P = 0.43
 Identities = 117/195 (60%), Positives = 117/195 (60%), Strand = Plus / Plus

Query:     5 TTTATTTTGTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAA 64
             TTTA TT    AAA T TTA AA  T   GTG A A A  T  T GT AT  GCC T   
Sbjct:     2 TTTAATTAAAAAAACT-TTAAAAAGTGAAGTGGAAACAGATGGTAGTAAT--GCCTTTG- 57

Query:    65 GTTTTAATTATATGATAGGCAAAACG-ATAGAGTATGATATAAAGATTAGTTAT-TATGA 122
             GT    A  ATATGA A   A A CG A AGA  AT ATATAAAGATTA  TAT TA  A
Sbjct:    58 GTAG--ACGATATGAAAAT-ATATCGGAAAGAACATTATATAAAGATTATGTATCTACCA 114

Query:   123 AATATATGAAGGGCATGNTAAAAATGGTGAAGAGGTTTGTGTATTTATATATGAGAAGAA 182
             A T TAT  AG   A   TAAAA T GT AA AGG T  TG AT TA A ATGA A GAA
Sbjct:   115 ATT-TATATAGA--A--CTAAAA-TAGT-AA-AGGATGATGAATATACAAATGA-AGGAA 165

Query:   183 TAATAAAGAAACGAGTT 199
             TA  A   AAA  AGTT
Sbjct:   166 TACAAGGAAAAAAAGTT 182


>cbil|dbest|28892 T09796 0377m7  Lib=9[Plasmodium_falciparum|||||]
            Length=311
            Length = 311

  Minus Strand HSPs:

 Score = 156 (23.4 bits), Expect = 0.58, P = 0.44
 Identities = 108/192 (56%), Positives = 108/192 (56%), Strand = Minus / Plus

Query:   220 GTTTTATATATCNTTTTACAAAACTCGTT-TCTTTATTATTCTTCTCATATATAAATACA 162
             GTTTT TATAT  TTTTA AAAACT G   T    A  A  C T   ATATATAAATA A
Sbjct:   118 GTTTTTTATAT--TTTTATAAAACTGGAAATAGGAAAAACACATAG-ATATATAAATATA 174

Query:   161 CAAACCTCTTCACCATTTTTANCATGCCCTTCATATATTTCATA-ATAACTAATCTTTAT 103
              A        CA CA  TTT    T    TT AT TA    ATA AT   T      TAT
Sbjct:   175 TATNTNNAGACAGCAAATTTTTTGTAATATTTATCTAAAA-ATATATNGTTTTAAAATAT 233

Query:   102 ATCATACTCTATC-GTTTTG-CCTATCATATAATTAAAACTTGATGGCAAATCACCAAAA 45
             ATCATA T TATC  TTT   CCT T ATA  ATT AAA    A    AAA  A  AAAA
Sbjct:   234 ATCATA-TATATCCNTTTNNTCCT-TAATACCATTCAAAGANAAAAANAAANNAAAAAAA 291

Query:    44 AGTTTATTCACAAAAT 29
             A TT  T C   AAAT
Sbjct:   292 ANTTGNTGCTTGAAAT 307


>cbil|dbest|44119 T18080 0467c3 5' Lib=8[Plasmodium_falciparum|||||] Length=212
            Length = 212

  Minus Strand HSPs:

 Score = 158 (23.7 bits), Expect = 0.69, P = 0.50
 Identities = 94/160 (58%), Positives = 94/160 (58%), Strand = Minus / Plus

Query:   248 ATTAAGTT-CTTAGAATATGACAAATGGNGTTTTATAT-ATCNTTTT-ACAAA-ACTCGT 193
             ATTAA TT CTT    T T A AA TG   TTTTATAT ATC      A  A  A T  T
Sbjct:    51 ATTAAATTACTTCCTTTTTTA-AATTGACCTTTTATATTATCAGCACCATTATTATTATT 109

Query:   192 TTCTTTATTATTCTTCTCATATATAAATACACAAACCTCTTCACCATTTT-TANCATGCC 134
             TTCTTTATTAT  T  TCAT T TA   A      C TCTT   CATT   T    T C 
Sbjct:   110 TTCTTTATTATCATAATCATCTTTATTCATTTCCTCATCTTTTTCATTAGCTTTTNTTCT 169

Query:   133 CTTCATATATTTCATAATAACTAATCTTTATATCATACTCTAT 91
              TT    T TTT AT AT ACTAAT T T TATCATA T TAT
Sbjct:   170 TTTGTNTTCTTT-ATCATTACTAATGTNTTTATCATA-TATAT 210


>cbil|dbest|453198 N47669 yy54h03.r1 5'
            Lib=390[Homo_sapiens||multiple_sclerosis_lesions|||Age_46]
            Length=258 Author_cmt: contains element L1 repetitive element ;
            Length = 258

  Plus Strand HSPs:

 Score = 156 (23.4 bits), Expect = 0.70, P = 0.50
 Identities = 80/125 (64%), Positives = 80/125 (64%), Strand = Plus / Plus

Query:   109 ATTAGTTAT-TATGAAATATATGAAGGGCATGN-TAAAAATGGTGAAGAGGTT-TGTGTA 165
             A TAG TAT T T  AA ATATGAA G  ATG  T AAAA G   A  AGG   T TG A
Sbjct:    22 AATAGATATATGTTCAACATATGAATGA-ATGAATGAAAAAGCA-ATCAGGCACTTTG-A 78

Query:   166 TTTATATATGAGAAGAATA-ATAAAGAAACGAGTTTTGTAAAANGATATATAAAACNCCA 224
             TTTA A ATG G  G ATA A A A A AC    T T TA A   ATATATAAAAC  CA
Sbjct:    79 TTTAGA-ATGTGT-GTATACACACACACACATCATATATATATTTATATATAAAACAACA 136

Query:   225 TTTGTCATA 233
               TGTCATA
Sbjct:   137 GATGTCATA 145


>cbil|dbest|1405937 AA699323 zi44e12.s1 3'
            Lib=452[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=364
            Length = 364

  Plus Strand HSPs:

 Score = 155 (23.3 bits), Expect = 0.79, P = 0.54
 Identities = 99/159 (62%), Positives = 99/159 (62%), Strand = Plus / Plus

Query:    12 TGTTAAAATGTTACAATATTTTGT-GAATAAACTTTTTGGTG-ATTTGCCATCAAGTTTT 69
             TGTTAAAAT TTACAATATTTT T GAA   A   TTTG TG A TT   A CAAGT  T
Sbjct:    31 TGTTAAAATATTACAATATTTTTTAGAAGGCATAATTTGATGTACTTAAAACCAAGTAGT 90

Query:    70 AATTATATGATAGGCAAAACGATAGAGTATGATA-TAAAGATTAGTTATTATGAAATATA 128
              A T T TGATA G      GATA      G  A TA   A  AGTTA  A G AATA A
Sbjct:    91 CACTTTTTGATATGTTTTG-GATACTAACCGCAAGTATCTAA-AGTTAACA-GTAATA-A 146

Query:   129 T-GAAGGGCATGNTAAAAATGGTGAAGAGGTTTG--TGTATTTAT 170
             T G AG G  TG  A AA TG TGA G   TTT   TGTATT AT
Sbjct:   147 TAGTAGTGAGTGC-ACAA-TGCTGA-GTCTTTTACATGTATTAAT 188


>cbil|dbest|349492 H48285 yq69f08.s1 3'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=434
            Length = 434

  Plus Strand HSPs:

 Score = 158 (23.7 bits), Expect = 0.81, P = 0.56
 Identities = 110/176 (62%), Positives = 110/176 (62%), Strand = Plus / Plus

Query:     8 ATTTTGTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAAGTT 67
             AT  TG TAAAAT    CAA ATTTT   AA A A   TTTG TG    GCCATCAAGTT
Sbjct:    68 ATACTGATAAAATTCCTCAACATTTTCATAAAATATAATTTGATGTAAAGCCATCAAGTT 127

Query:    68 ---TT-AATTATATGA-TAGGCAAAACGA-TAGAGTATGATATAAAGATTAGTTATTATG 121
                TT AATTA  TGA TAG C AAA  A T   GT TGA  TAAA  TTA TT T A G
Sbjct:   128 CCTTTTAATTAC-TGAATAG-CTAAATAACTCCTGTGTGAACTAAAATTTACTT-T-AGG 183

Query:   122 AAA-TATATGAAGGGCATGNTAAAAATGGTGAAGAGGTTTGTGTATTTATATATGAGAAG 180
             AA  T  AT A G  C T  T AAAATG T A     TT G G A  TAT TAT  GAA 
Sbjct:   184 AAGGTGAATCATGATC-T-ATGAAAATGATTATT---TTAGAGGACATAT-TATAGGAAT 237

Query:   181 AAT 183
             AAT
Sbjct:   238 AAT 240


>cbil|dbest|1199999 AA549989 1068m3  Lib=9[Plasmodium_falciparum|||||]
            Length=520
            Length = 520

  Plus Strand HSPs:

 Score = 160 (24.0 bits), Expect = 0.83, P = 0.57
 Identities = 124/213 (58%), Positives = 124/213 (58%), Strand = Plus / Plus

Query:     5 TTTATTTTGTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAA 64
             T TA TTT  T    TGT A A TAT T  T A TAAA TTTT G T A TT   AT A 
Sbjct:    97 TATAATTTTATGTTTTGTAAAAGTATATATTTA-TAAAATTTT-GTTAAGTTTTAAT-A- 152

Query:    65 GTTTTAATTATATGATAGGCAAAACGATAGAGTATGATATAAAGATTAGT-TATTATGAA 123
              TTTTA TTAT T  TA   AAAA GA AG  TA   TAT A  AT A   TATTATGAA
Sbjct:   153 -TTTTATTTATCTTTTAAT-AAAATGAGAGTTTAAATTATTAC-ATAAAAATATTATGAA 209

Query:   124 ATATATGAAGGGCATGNTAAAAATG-GTGAAGAGGTTTGTGTATTTA-TATATGAGAA-G 180
             ATATAT AA G  A   T AA  T  GT  A    TTT T TATT A T T   A  A G
Sbjct:   210 ATATAT-AATGTAAGAATGAATTTTTGTTCATTTATTTTTTTATTCACTGTTACATTACG 268

Query:   181 AATAATAAA-GAAACGAGTTTTGTAAAANGATATA-TAA 217
               T ATA   G AAC A     GTAA A GA A A TAA
Sbjct:   269 TGTGATACTTGCAACAAAAAAGGTAATATGAAAAAATAA 307


>cbil|dbest|1200127 AA550117 1216m3  Lib=9[Plasmodium_falciparum|||||]
            Length=474
            Length = 474

  Plus Strand HSPs:

 Score = 158 (23.7 bits), Expect = 0.93, P = 0.61
 Identities = 154/260 (59%), Positives = 154/260 (59%), Strand = Plus / Plus

Query:     7 TATTTTGT-TAAAATGT-TACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAA 64
             TAT T  T TAAAAT   TA AA A  T G  A T AA  T T  GT   TTG  AT AA
Sbjct:   115 TATGTCATCTAAAATTAATA-AACAGCTAGATAGTCAAGATATAAGTTCCTTGA-AT-AA 171

Query:    65 GTTTTA---ATTATATGATAGG-CAAAACGATAGAGTATGATATAAAG-ATTAGTTAT-T 118
              TTT A   A  AT TGA AG  C AAA GA AG  TA  A A AA G ATT  TT   T
Sbjct:   172 TTTTAAGAGAGCATCTGA-AGTACTAAAAGAAAGTCTAGCA-ACAATGCATTCATTGGAT 229

Query:   119 ATGAA-ATATATGAAGGGCATGNTAAAAATGGTGAAGAGGTTTGTGTATTTATATATGAG 177
             AT A  A A ATGA GG CA   TA A  T  T AAG   TT     ATTT TA A  A 
Sbjct:   230 ATTATTAGAAATGATGG-CAGTGTAGATTTC-TCAAGTAATTATAAAATTTTTAAAAAAT 287

Query:   178 AAGAATAATAAAGAAACGAGTTTTGTAAA-ANGA-TATATAAAACNCCATTTGTCATATT 235
              AGAA AATAA  AAA GA  TT  TAAA A G  TAT T AA C   ATT  T ATAT 
Sbjct:   288 TAGAAAAATAAT-AAA-GATATTAATAAACACGTCTATGTCAA-CAATATTA-T-ATATA 342

Query:   236 CTAAGAACTTAATTC-A-TCCTANATNTTTTA 265
              TA G A TTAATT  A T  TA AT  TTTA
Sbjct:   343 ATATGTATTTAATTATACTTATACATTATTTA 374


>cbil|dbest|76301 Z46694 ATTS4356 3' Lib=97[Arabidopsis_thaliana|||||]
            Length=262
            Length = 262

  Minus Strand HSPs:

 Score = 153 (23.0 bits), Expect = 0.94, P = 0.61
 Identities = 99/143 (69%), Positives = 99/143 (69%), Strand = Minus / Plus

Query:   193 TTTCTT--TATTATTCTTCTCATATATAAAT-ACACAAACCTC-T-TCACCATTTTTANC 139
             TTTCTT  TATTATTCTTCT  TA A AAA  ACA AAAC  C T TCACC TT TTA C
Sbjct:    11 TTTCTTCATATTATTCTTCTTTTAAAAAAACGACA-AAACAACATATCACC-TTATTA-C 67

Query:   138 ATGCC-CTTCATATATTTCATAATA-ACTAATCTTTATATCATACTCTATCGTTTTGCCT 81
             AT  C C  C TATA T C   ATA ACT  TCTTT TA  A ACT T  C  T   C  
Sbjct:    68 ATCACACGAC-TATACTACTGGATATACTC-TCTTTGTAAGA-ACT-TC-C--TAAACAG 120

Query:    80 A-TCATATAATTAAA-ACTTGATGGCAAA-TCA 51
             A TCAT TA  TAA  ACTT AT GCAA  TCA
Sbjct:   121 AGTCATGTACATAAGCACTT-ATTGCAAGCTCA 152


>cbil|dbest|1007307 AA365948 EST76885 5'-end
            Lib=734[Homo_sapiens|pineal_body||||adult] Length=252
            Length = 252

  Plus Strand HSPs:

 Score = 153 (23.0 bits), Expect = 0.98, P = 0.62
 Identities = 85/129 (65%), Positives = 85/129 (65%), Strand = Plus / Plus

Query:     1 TTGTTTTATTTTGTTAAAATGTTACAAT-ATTTTGTGAATAAACTTTTTGGTGATTTGCC 59
             TTGTTTTATTTTGT  A AT T A AAT A TT GT A TAAAC     GGT  TTT CC
Sbjct:   107 TTGTTTTATTTTGTATAGATCT-AGAATGAATTAGTAATTAAACACAAGGGTTTTTTTCC 165

Query:    60 ATCAAGTTTTAATTATA-TGATAGGCAAAACGATAGAGTATGAT-ATAAAGATTA--GTT 115
               CAA    TAATT TA TGAT    AAAA   TA A TA  A  ATA  GATTA  GT 
Sbjct:   166 --CAAAAAATAATTTTACTGATTTTTAAAAATTTA-ATTAAAAACATAG-GATTACAGTA 221

Query:   116 AT-TATGAAATATAT 129
             AT T T A AT TAT
Sbjct:   222 ATCTCTAACAT-TAT 235


>cbil|dbest|305948 H44897 yo04e04.r1 5'
            Lib=300[Homo_sapiens|brain||||55-year_old] Length=329 Author_cmt:
            contains L1 repetitive element ;
            Length = 329

  Minus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 1.0, P = 0.65
 Identities = 52/78 (66%), Positives = 52/78 (66%), Strand = Minus / Plus

Query:    81 TATCATATAATTAAAACTTGATGGCAAATCACCAAAAAGTTTATTCACAAAATATTGTAA 22
             T T ATAT A   AAA TTGA G  AAA CACCAAAAAGTT  T  A A AA A  G AA
Sbjct:    54 TTTAATATCAGACAAAATTGACGTTAAAACACCAAAAAGTTACTAGAGATAA-AGAGCAA 112

Query:    21 CATTTTAACAAAATAAAA 4
              ATTTTA  A  ATAAAA
Sbjct:   113 AATTTTATAATGATAAAA 130


>cbil|dbest|1098913 AA454414 MBAFCX1C11T3 5' Lib=531[Brugia_malayi|||||adult]
            Length=422
            Length = 422

  Plus Strand HSPs:

 Score = 155 (23.3 bits), Expect = 1.1, P = 0.66
 Identities = 71/107 (66%), Positives = 71/107 (66%), Strand = Plus / Plus

Query:     4 TTTTATTTTGTTAAAATGTTACAATATTTTGTGAATAAACTT--TTTGGT-GAT--TTGC 58
             TTTTA T   TTAAAATGTTACAA ATTTT T AAT A  TT  TTT  T GA   TT  
Sbjct:   199 TTTTACTAGTTTAAAATGTTACAA-ATTTTTTTAATCACTTTATTTTTATTGAAAGTTTT 257

Query:    59 CATCAAGTTTTAATTATATGATAGGCAAAA-CGATAGAGTATGATATAA 106
             C TC AGTTTTAAT  TA  A A G AAAA C   AG  T T A ATAA
Sbjct:   258 C-TCCAGTTTTAATGTTACCAGAAGAAAAAACTCCAGGATTTTAAATAA 305


>cbil|dbest|811385 AA172903 ms45f02.r1 5'
            Lib=532[Mus_musculus|whole_embryo|embryo|||13.5dpc_embryos]
            Length=602 Author_cmt: gb:M12600_rna3 Mouse androgen regulated gene
            RP2, complete cds, with a (MOUSE);
            Length = 602

  Plus Strand HSPs:

 Score = 158 (23.7 bits), Expect = 1.2, P = 0.70
 Identities = 112/180 (62%), Positives = 112/180 (62%), Strand = Plus / Plus

Query:     4 TTTTATTTTGTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTG-ATTTGCCATC 62
             T TTA TTT TTAAAATGTTA AAT TT  GTGAA A  CT      TG ATTTGC AT 
Sbjct:   353 TGTTAATTTTTTAAAATGTTAGAAT-TTG-GTGAACAT-CTGGAACATGTATTTGC-ATT 408

Query:    63 AAGTTTTAATTATA-TGATAGG-CAA--A-ACGATA---GAG-TATGATATAAA-GATTA 112
             A  TTT AATT  A TG T    CAA  A AC AT    G G T TG T T A  GAT  
Sbjct:   409 ATTTTTAAATTTCAGTGTTTTAACAAGCAGACCATTCCTGGGGTGTGTTTTTATTGATCT 468

Query:   113 GTTATTATGAAATATATGA-AGGGCATGNTAAAAATGGTGAAGAGGTTTGTGTATTTATA 171
             GT A TA GA A AT TGA AGG C TG T     T  TG A  GGTTTGT T T TAT 
Sbjct:   469 GTCAGTAAGAGAAAT-TGATAGGACCTGGTTTGGGTTTTGTATTGGTTTGTCTGTATATT 527

Query:   172 TATGAG 177
             T TG G
Sbjct:   528 T-TGGG 532


>cbil|dbest|148716 F11670 HSC30B041 
            Lib=186[Homo_sapiens|brain|total_brain|||3_months_old] Length=279
            Length = 279

  Plus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 1.2, P = 0.70
 Identities = 84/134 (62%), Positives = 84/134 (62%), Strand = Plus / Plus

Query:    13 GTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAAGTTTTAAT 72
             GT AAA T T A AATA   T   A  AA C T TT  T A T G  A CA G T TAAT
Sbjct:     2 GTCAAAGTNTCAAAATAGCATCACACAAANCATGTTTATAAAT-GA-A-CAGGATGTAAT 58

Query:    73 -TATAT-GATAGGCAAAACGATAGA--GTATGATATAAAGATTAGTTATTATGAAATATA 128
              TA AT GAT G CA  A GA AG    TATGA ATAA   TTAGT AT ATGAAATAT 
Sbjct:    59 GTACATAGAT-GACATTANGAAAGTTTNTATGAAATAAT--TTAGTCATCATGAAATATN 115

Query:   129 TGAAGGGCATGNTAAAAA 146
             T    G CAT  TAAAAA
Sbjct:   116 TAGTTGTCAT-ATAAAAA 132


>cbil|dbest|244686 R67931 yi29a01.s1 3'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=366 Author_cmt: contains Alu repetitive
            element;contains LTR4 repetitive element ;
            Length = 366

  Minus Strand HSPs:

 Score = 151 (22.7 bits), Expect = 1.3, P = 0.73
 Identities = 63/90 (70%), Positives = 63/90 (70%), Strand = Minus / Plus

Query:   228 CAAATGGNGTTTTATATA-TCNTTTTACAAAACTCGTTTCTTT-ATTATTCTTCT-C-AT 173
             CAAATGG  TTTTATA A T  TTTTACAAAAC   TT  TTT ATT TTC  C  C A 
Sbjct:    16 CAAATGGA-TTTTATAAAATTATTTTACAAAACATTTTATTTTGATTTTTCGACCACTAA 74

Query:   172 ATATA-AATACACAAACCTCTTCACCATTTTTA 141
             A AT  AA A ACAAAC  C   AC ATTTTTA
Sbjct:    75 AAATTGAAAAAACAAACAACAA-AC-ATTTTTA 105


>cbil|dbest|504758 N97924 1548C3  Lib=114[Plasmodium_falciparum|||||]
            Length=441
            Length = 441

  Plus Strand HSPs:

 Score = 154 (23.1 bits), Expect = 1.3, P = 0.73
 Identities = 158/267 (59%), Positives = 158/267 (59%), Strand = Plus / Plus

Query:     1 TTGTTTTATTTTGTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCA 60
             TTGTTTTATTTTGTT    TGTT CA  ATT   T AA AAA TT T      TT   CA
Sbjct:    65 TTGTTTTATTTTGTT----TGTTTCAGAATTCACT-AACAAAATTATCCAC--TTCATCA 117

Query:    61 TCAAGTTTTAATTATA-TGATAGGCAAA-ACGATA-GAGTA-TGAT-ATAAAGATTAGTT 115
             TCAA TTTT    A A T  TA  C A  A G  A GA TA T AT ATA AG TT GTT
Sbjct:   118 TCAATTTTTTTCAAAACTTTTAAACTATCATGTGAAGAATAATTATCATAGAGTTTTGTT 177

Query:   116 AT-TATGAAATA--T--ATGAAGGGCATGNTAAAAATGGTGAAGAGGTTTGTGTATTTAT 170
             A  TAT  A TA  T  AT AAG  CAT  TAAA A   TGA  A GTT  T  ATT AT
Sbjct:   178 AAATATTCATTAGCTTCATCAAGTTCAT-ATAAATACAATGAGCATGTTATTAAATT-AT 235

Query:   171 ATATGAGAAGAATAATAAAGAAACGAGTTTTGTAAAANGATATATAAAACNCCATTTG-T 229
             ATA  A A  A    TA   A   GA TTTT TAAAA  AT T T  A C  CATT   T
Sbjct:   236 ATAGAATATCACCGTTATTTATTTGATTTTT-TAAAA--AT-TCTTTAGCGTCATTAAAT 291

Query:   230 -CATATTCTAAGAA-CTTAATTCATCCTANATNTTTTAAA 267
              CATA T TA  A  CTT  T C  CCT     TTT A A
Sbjct:   292 TCATAATTTAGTATGCTTGCTACTGCCTTTCCATTTAATA 331


>cbil|dbest|1203908 AA553540 nk78b12.s1 
            Lib=941[Homo_sapiens||Schwannoma_tumor|||] Length=392
            Length = 392

  Plus Strand HSPs:

 Score = 152 (22.8 bits), Expect = 1.3, P = 0.74
 Identities = 148/248 (59%), Positives = 148/248 (59%), Strand = Plus / Plus

Query:     4 TTTTATTTTGTTAAA-ATGTT-ACAATATTTTGTGAATAAACTTTTTGGTG-ATTTGCCA 60
             TTTT TTT    AAA AT TT A AAT  TTTGTGAATAAACTT  T  T  AT T C A
Sbjct:     1 TTTTGTTTAAAGAAATATATTCAAAATCATTTGTGAATAAACTTGATCATCCATCT-CAA 59

Query:    61 TCAAGTTTTAATTATATGATAGGCAAAACGATAGAGTATGATA-TAAAGATTAGTTATTA 119
             T   GTTT A  TATA  ATA   A AA   TA A  AT A A T  AG       A TA
Sbjct:    60 TATTGTTTGACATATAAAATAATTATAAGTGTAAAAAATTACAATTTAGTGCCAACAGTA 119

Query:   120 -TGAA-AT-ATATGAAGGGCATGNTAAAAATGGTGAAGA-GGTTTGTGTAT-TTATATA- 173
              TGA  AT A ATGAA   C T  T AAAA  G GAA A GG  TGTG AT TTA A A 
Sbjct:   120 GTGAGCATGAAATGAAA--C-TATTCAAAA--GAGAATATGGCCTGTGCATATTAAAAAA 174

Query:   174 -TGAGAAGAAT-AATAAAGAAACGAGTTTTGTAAAANGAT-ATATAAAACNCCATTTGTC 230
              T A AA A T AAT  AGA   GAG    GTAA       A ATAA A    AT TG C
Sbjct:   175 TTCAAAACAGTGAATGCAGACTGGAGGA--GTAACTTTTGCAAATAAGATGA-ATATG-C 230

Query:   231 AT-ATTCTAAGAACTTAAT 248
              T ATT T A AACT AAT
Sbjct:   231 TTCATTATTA-AACTCAAT 248


>cbil|dbest|1200177 AA550167 1281m3  Lib=9[Plasmodium_falciparum|||||]
            Length=608
            Length = 608

  Minus Strand HSPs:

 Score = 157 (23.6 bits), Expect = 1.3, P = 0.74
 Identities = 147/257 (57%), Positives = 147/257 (57%), Strand = Minus / Plus

Query:   249 AATTAAGTTCTT-AGAATATGACAAATGGNGTTTTATATATCNTTTTA-CAAAACTCGTT 192
             AATTA G TC T A AATA G C  ATG    T  AT TAT   T  A CA  A T    
Sbjct:   287 AATTAGGATCATGAAAATAAGTCTTATGAGAATAAAT-TATTAATGAATCATTATTTAAA 345

Query:   191 TCTTTATTATTCTTCTCATAT-ATAAATAC-ACAAACCTCTTCACCATTTTTANCATGCC 134
             T TT A TA T TT T ATAT AT A  A  A  AA  T  TCACCATTT T   AT   
Sbjct:   346 TGTTCAGTAATGTT-T-ATATTATTATCATGATGAAAATTGTCACCATTTATTTTATTAT 403

Query:   133 CTTCATATATTTCATAATAACTAATCTTTATATCA-TACTCTATCGTTTTGCCTA-TCAT 76
              TTCAT TATTT  T  T   T ATC  TA  T A T  TCTA C TT T   TA TCAT
Sbjct:   404 ATTCAT-TATTTTCTTTTTCTTTATCAATAATTAACTTTTCTA-CTTTATTATTACTCAT 461

Query:    75 ATAATTAA--A-A-CTTGATGGCAA-AT-CACCAAAAAGTTTATTCACAAAATATTGTAA 22
             ATAATTA   A A C T  T   AA AT CA CA  AA  TT TT  C A   A   T  
Sbjct:   462 ATAATTATTTATATCCTCCTCATAATATTCATCATTAAAATTCTTATCTACTAAAAATT- 520

Query:    21 CATTTTAACAAA-AT-AAAACAA 1
             C TTTT ACAA  AT AAAA AA
Sbjct:   521 CTTTTTTACAATCATTAAAATAA 543


>cbil|dbest|504654 N97580 1320C3  Lib=114[Plasmodium_falciparum|||||]
            Length=259
            Length = 259

  Minus Strand HSPs:

 Score = 149 (22.4 bits), Expect = 1.4, P = 0.76
 Identities = 57/79 (72%), Positives = 57/79 (72%), Strand = Minus / Plus

Query:    79 TCATATAATTAAA-A-CTTGATGGCAAATCACCAAAA-AGTTTATTCACAAAATATTGTA 23
             TCATA AAT A A A C TGA  G AAAT A CAAAA AG  TA  C CAAAA ATT TA
Sbjct:   143 TCATAGAATGAGAGAGCATGAAAG-AAATGAACAAAATAGAGTAAAC-CAAAA-ATTATA 199

Query:    22 ACATTTTAACAAAATAAAACAA 1
             ACATTTTAA     TAAAA AA
Sbjct:   200 ACATTTTAAATTGTTAAAAAAA 221


>cbil|dbest|472325 N66313 yz38a07.s1 3'
            Lib=371[Homo_sapiens|ear|cochlea|||16-22_week_fetus] Length=482
            Length = 482

  Minus Strand HSPs:

 Score = 152 (22.8 bits), Expect = 1.9, P = 0.84
 Identities = 82/130 (63%), Positives = 82/130 (63%), Strand = Minus / Plus

Query:   130 CATA-TATTTCATAATAACTAAT-CTTT-ATATCATACTCTATCGTTTTGC-CTATCATA 75
             CATA T TTT  T A AA TAAT CTTT A A CA A  C AT GTT     CT TCATA
Sbjct:    15 CATACTGTTTAGTGAAAAATAATTCTTTTACAACAAAAACGATTGTTACCAGCT-TCATA 73

Query:    74 TAATTAAAACTTGATGGCAAATCACCAAAAAGTTTATTCACAAAATATT-GTA-ACATTT 17
             TAATTAAAACT  A   CAAAT     AA AG T A  CA AA AT T  GT  A ATT 
Sbjct:    74 TAATTAAAACTGAAAACCAAATTGTGTAACAGGT-AG-CATAACATGTCAGTTTATATTA 131

Query:    16 TAACAAAATAAAA 4
             T   AAAA  AAA
Sbjct:   132 TTTTAAAACCAAA 144


>cbil|dbest|702119 AA070212 zm68c05.s1 3'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=444
            Length = 444

  Plus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 2.1, P = 0.88
 Identities = 64/93 (68%), Positives = 64/93 (68%), Strand = Plus / Plus

Query:    36 GAATAAACTTTTTGGTGATTTGCCATCAAGTTTTAATTATATGATAGGCAAAACGATAG- 94
             GAATAAACTTT   GTGATTT  C T AA TTTT  TT T TGATAGG AAAA  AT   
Sbjct:   335 GAATAAACTTTACTGTGATTTATCCT-AATTTTTTTTT-T-TGATAGG-AAAATAATTTT 390

Query:    95 AGT-ATGATATAAAGATTAGTTAT-TATGAAATATA 128
             A T A G T T AA A  AGTTA  T T A ATATA
Sbjct:   391 ATTTAGGTTTTTAAAAAAAGTTAACTTTCACATATA 426


>cbil|dbest|303215 H42164 yo11b05.r1 5'
            Lib=300[Homo_sapiens|brain||||55-year_old] Length=449 Author_cmt:
            contains L1 repetitive element ;
            Length = 449

  Minus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 2.1, P = 0.88
 Identities = 52/78 (66%), Positives = 52/78 (66%), Strand = Minus / Plus

Query:    81 TATCATATAATTAAAACTTGATGGCAAATCACCAAAAAGTTTATTCACAAAATATTGTAA 22
             T T ATAT A   AAA TTGA G  AAA CACCAAAAAGTT  T  A A AA A  G AA
Sbjct:    54 TTTAATATCAGACAAAATTGACGTTAAAACACCAAAAAGTTACTAGAGATAA-AGAGCAA 112

Query:    21 CATTTTAACAAAATAAAA 4
              ATTTTA  A  ATAAAA
Sbjct:   113 AATTTTATAATGATAAAA 130


>cbil|dbest|775764 AA137323 mq27a04.r1 5'
            Lib=539[Mus_musculus||Kidney|||6_weeks] Length=532 Author_cmt:
            SW:ATP6_MOUSE P00848 ATP SYNTHASE A CHAIN ;
            Length = 532

  Minus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 2.6, P = 0.92
 Identities = 76/120 (63%), Positives = 76/120 (63%), Strand = Minus / Plus

Query:   126 TATTTCATAATAACTAATCTTTATATC-ATACTCTATCGTTTTGCCTATCATATAATTAA 68
             TA TTCAT A   C AA C TTAT    AT C C AT GT  TG C ATCATA AATT  
Sbjct:   182 TAATTCATTACCCC-AA-CATTATTGGGATTCCCAATGGTGGTGGCAATCATAAAATTCC 239

Query:    67 ---AACTTGATGGCAAATCACCAAAAAGTTTATTCACAAAATATTGTAACATTTTAACAA 11
                AA T  A   C AATC  CAAAA G TTATTCACAAA   TT  AA   TTT A AA
Sbjct:   240 CTTAAATCCAATTCCAATCTTCAAAAGGCTTATTCACAAACGGTTTCAATCCTTTCA-AA 298

Query:    10 AAT 8
             AAT
Sbjct:   299 AAT 301


>cbil|dbest|1200510 AA550500 1656m3  Lib=9[Plasmodium_falciparum|||||]
            Length=695
            Length = 695

  Plus Strand HSPs:

 Score = 151 (22.7 bits), Expect = 2.8, P = 0.94
 Identities = 123/220 (55%), Positives = 123/220 (55%), Strand = Plus / Plus

Query:     6 TTATTTTGTTAA-AATGTTACAATA-TTTTGTGAATAAACTTTTTGGTGATTTGCCATCA 63
             TTAT   G TAA AATG TA   T  TTTT  G ATAAACTTTTT GT     G  ATCA
Sbjct:   416 TTATGAAGATAATAATGATATTTTTGTTTTACGTATAAACTTTTTAGTACCAGGAAATCA 475

Query:    64 AGTTTTAATTATATGATAGGCAAA-ACGATAGAGT-ATGATATAAAGATTAGTTAT-TAT 120
             AG   TA T A A GA A   AAA AC  T   G  AT A A  AA AT A  T T TAT
Sbjct:   476 AGGAGTAGTGAAAGGAGAATTAAATACATTTCCGACATTACAACAAAATCAAATGTATAT 535

Query:   121 GAAATATATGAAGGGCATGNTAA-AAATGGTGAAGAGGTTTG--TG-TATTTATATATG- 175
              A A A  TGA     A    A  AAATG   AA A  TT    TG TA T A A A G 
Sbjct:   536 TAGAGAATTGATATTTAAATCACCAAATGAAAAACATTTTCAAATGGTAGTAAAACAAGT 595

Query:   176 AGAAGAATAATAAAGAAACGAGTTTTGTAAAANGATATATAA 217
             A AAGAAT  TAA  AAAC AGT     AAAA GA  TA AA
Sbjct:   596 AAAAGAAT--TAATTAAACAAGTAAAACAAAAAGAAGTAGAA 635


>cbil|dbest|391178 H88869 yw24b10.r1 5'
            Lib=371[Homo_sapiens|ear|cochlea|||16-22_week_fetus] Length=327
            Length = 327

  Minus Strand HSPs:

 Score = 149 (22.4 bits), Expect = 3.5, P = 0.97
 Identities = 75/121 (61%), Positives = 75/121 (61%), Strand = Minus / Plus

Query:   184 TATTCTTCTCATATATAAA-TACACAAACCTCTTCACCATTTTTANCA-TGCCCTTCATA 127
             TATT TT TCATA AT A  TA A    C  CT CA  ATT  T  CA T C  TT A A
Sbjct:   171 TATT-TT-TCATAAATGAGCTAAATCTGCAACTCCAA-ATTAGTGGCAATACATTTAAAA 227

Query:   126 TATTTCATAATAACTAATCTTTATATCATACTCTATCGTTTTGC-CTATCATATAATTAA 68
              A    ATAA A C AA C TT TATCA A    AT GTTTTG  C A CAT TAATTAA
Sbjct:   228 CAAGAAATAAGATCAAAGCATTTTATCAAAAAGCATTGTTTTGGGCAANCATGTAATTAA 287

Query:    67 AACT 64
              ACT
Sbjct:   288 NACT 291


>cbil|dbest|855074 AA215770 zr96d03.r1 5'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=275
            Author_cmt: contains Alu repetitive element;
            Length = 275

  Plus Strand HSPs:

 Score = 147 (22.1 bits), Expect = 3.5, P = 0.97
 Identities = 77/119 (64%), Positives = 77/119 (64%), Strand = Plus / Plus

Query:   149 GTGAAGAGGTTTGTGTATTTATATATGAGAAGAATAATAAA-GAAA--CGA-GTTTTGTA 204
             GTGA GA  T TGT T    A A AT AGAAGAATAAT AA GAAA  C A GTT T TA
Sbjct:   118 GTGA-GAC-TCTGTCTCAAAA-ACATAAGAAGAATAATGAATGAAAGTCCATGTTATTTA 174

Query:   205 AAANGATATATAAAACNCCATTTGTCATATTCTAAGAACTTAATTCATCCTANATNTTTT 264
              AA  ATA A A  AC    TTT TC TA  CT   AAC TAA T AT CT  AT T TT
Sbjct:   175 GAAATATAAACATTACTGTTTTTTTCCTAACCTGCAAACATAAAT-ATGCT-CAT-TATT 231

Query:   265 AAA 267
             AAA
Sbjct:   232 AAA 234


>cbil|dbest|232477 R55771 yg89e03.s1 3'
            Lib=263[Homo_sapiens|whole_brain||||73_days_post_natal] Length=352
            Length = 352

  Plus Strand HSPs:

 Score = 149 (22.4 bits), Expect = 4.5, P = 0.99
 Identities = 85/135 (62%), Positives = 85/135 (62%), Strand = Plus / Plus

Query:     1 TTGTTTTATTTTGTTAAA-ATGTT-ACAATATTTTGTGAATAAACTTTTTGGTG-ATTTG 57
             TT TTTT TTT    AAA AT TT A AAT  TTTGTGAATAAACTT  T  T  AT T 
Sbjct:    11 TTTTTTTGTTTAAAGAAATATATTCAAAATCATTTGTGAATAAACTTGATCATCCATCT- 69

Query:    58 CCATCAAGTTTTA-AT-TA---TA-TGATA-G-GCAAAACGATAGAGTATGATATAAAGA 109
             C AT   GTTT A AT TA   TA T ATA G G AAAA   TA A T T  T   AA A
Sbjct:    70 CAATATTGTTTGACATATAAAATAATTATAAGTGTAAAAAATTACAATTTAGTGCCAACA 129

Query:   110 TTAGTTATTATGAAAT 125
              TAGT A  ATGAAAT
Sbjct:   130 GTAGTGAGCATGAAAT 145


>cbil|dbest|1150721 AA506091 ni13a04.s1 
            Lib=896[Homo_sapiens||colon|||] Length=209
            Length = 209

  Plus Strand HSPs:

 Score = 140 (21.0 bits), Expect = 4.5, P = 0.99
 Identities = 88/138 (63%), Positives = 88/138 (63%), Strand = Plus / Plus

Query:     1 TTGTTTTATTTTGTTAAAATGTTACAATATT-TTGTGAATAAACTTTTTG-GTGATT-T- 56
             TT TTTT TTTTGTTAAAATGT A A T T  TTGT AA AA C TTTT  GT A T T 
Sbjct:    10 TTTTTTTTTTTTGTTAAAATGTGA-ACTTTAATTGTAAA-AATCATTTTCTGTAAATATA 67

Query:    57 GCCAT--CAAGTTTTAATTATATGA-TAGG--CAAAACGATAGAG-TATGATATAAAGAT 110
             G  AT  CAA  T T    A A  A T GG  CA A   ATA AG TATGATAT  A A 
Sbjct:    68 GTTATATCAACCTCTCTGCACACAACTTGGTTCAGATATATACAGATATGATATTCATAG 127

Query:   111 TAGTTATTATGAAATATATGAA 132
               GTTATT TG A  A A GAA
Sbjct:   128 ATGTTATT-TGTACCACA-GAA 147


>cbil|dbest|86076 T36043 EST96066 3'-end Lib=235[Homo_sapiens|testis||||]
            Length=243 Author_cmt: None.
            Length = 243

  Plus Strand HSPs:

 Score = 138 (20.7 bits), Expect = 4.8, P = 0.99
 Identities = 88/138 (63%), Positives = 88/138 (63%), Strand = Plus / Plus

Query:     3 GTTTTATTTT-GTTAAAATGTTACAATATTTTGTGAATAAACTTTTTGGTGATTTGCCA- 60
             GTTTTATT   GTT AA TG TACAATATTTT T   T    TTTTTG T AT  GCCA 
Sbjct:    10 GTTTTATTAAAGTTTAA-TGGTACAATATTTTATCTCTT---TTTTTGTTAAT--GCCAG 63

Query:    61 T-CAAGTTTTAATTATATGA-TAGGCAAAACGA-TAGAG-TATGATATAAAGATTAGTTA 116
             T CAA   T  A T  ATGA T G CAAAA G  TA A  TA G   T AAG TT G   
Sbjct:    64 TACAAAAATACAGTTGATGACTTGACAAAATGGCTACACCTAGGGCTTGAAGGTTTGAGT 123

Query:   117 TTATGAAATA-TATGAAGGGCATG 139
             TT T  AA A TA  AAGGG A G
Sbjct:   124 TTCTCCAACAGTAACAAGGGAAAG 147


>cbil|dbest|504658 N97584 1324C3  Lib=114[Plasmodium_falciparum|||||]
            Length=228
            Length = 228

  Plus Strand HSPs:

 Score = 137 (20.6 bits), Expect = 5.7, P = 1.0
 Identities = 59/98 (60%), Positives = 59/98 (60%), Strand = Plus / Plus

Query:   152 AAGAGGTTTGTGTATTTATATATGAGAAGAATAATAAAGAAACGAGTTTTGTAAAANGAT 211
             AA A  TTT T  ATTTATATATGA  A  A AA AAA AAA      TT TAA A   T
Sbjct:    21 AACAAATTTTTAAATTTATATATGAATAATAGAAAAAATAAATATAAATTATAATATATT 80

Query:   212 ATATAAAACNCCATTTGTCATATTC-TAAGAACTTAAT 248
             ATATA        TTT T A ATT  TAAGAA  TAAT
Sbjct:    81 ATATATTTATATGTTTATAAAATTAATAAGAAAATAAT 118


>cbil|dbest|804499 D86776 D86776 
            Lib=473[Rattus_norvegicus||ovary|||21_day_old] Length=203
            Length = 203

  Minus Strand HSPs:

 Score = 136 (20.4 bits), Expect = 7.1, P = 1.0
 Identities = 52/76 (68%), Positives = 52/76 (68%), Strand = Minus / Plus

Query:   219 TTTTATATATCNTTTTACAAAACTCGTTTCTTTATTATTCTTCTCATATATAAATACACA 160
             T TTA AT T  TTTTA AAAA   GTTTCTTTATT   C  CT AT TA AAATA ACA
Sbjct:    11 TCTTA-ATCTTTTTTTA-AAAAGAGGTTTCTTTATTTGGCGACTTATTTACAAATA-ACA 67

Query:   159 AACCTCTTCACCATTT 144
              A CTC  CA  ATTT
Sbjct:    68 GATCTC--CAATATTT 81


>cbil|dbest|804510 D86787 D86787 
            Lib=473[Rattus_norvegicus||ovary|||21_day_old] Length=203
            Length = 203

  Minus Strand HSPs:

 Score = 136 (20.4 bits), Expect = 7.1, P = 1.0
 Identities = 52/76 (68%), Positives = 52/76 (68%), Strand = Minus / Plus

Query:   219 TTTTATATATCNTTTTACAAAACTCGTTTCTTTATTATTCTTCTCATATATAAATACACA 160
             T TTA AT T  TTTTA AAAA   GTTTCTTTATT   C  CT AT TA AAATA ACA
Sbjct:    11 TCTTA-ATCTTTTTTTA-AAAAGAGGTTTCTTTATTTGGCGACTTATTTACAAATA-ACA 67

Query:   159 AACCTCTTCACCATTT 144
              A CTC  CA  ATTT
Sbjct:    68 GATCTC--CAATATTT 81


>cbil|dbest|1173139 AA528499 ne99h11.s1 
            Lib=890[Homo_sapiens||kidney|||] Length=333
            Length = 333

  Plus Strand HSPs:

 Score = 148 (22.2 bits), Expect = 7.1, P = 1.0
 Identities = 132/219 (60%), Positives = 132/219 (60%), Strand = Plus / Plus

Query:     1 TTGTTTTATTTTGTTAAAATGTTACAATATTTTGTGA-ATAAA-CTTTTTGGTGATTTGC 58
             TT TTTTATTTTGTT  AAT  T   ATATTTT T   A  AA C T  T  T AT T C
Sbjct:   108 TTTTTTTATTTTGTTTTAATACTTGGATATTTTATTCCAGCAATCCTACTT-TAATCT-C 165

Query:    59 CATCA--AGTTTTA-ATTAT-ATGATAGGCAAAACGAT-AGAGTATGA-TATAAAGATT- 111
              AT A  AG T  A AT AT ATG TAG CAA A  AT A A TA  A T TAAA  TT 
Sbjct:   166 AATAATCAGCTAGAGATAATCATGTTAG-CAACAGTATCAAAATAGTAGTCTAAACGTTG 224

Query:   112 AGTTATTATGA-AATATA--TGAAGGGCATGNTAAAAATGGTGAAGAGGTTTGTGTATTT 168
             AG  AT A GA AATAT   T AA    AT   AAAAA GGT AA A  TTT   TA T 
Sbjct:   225 AGCAATAA-GAGAATATTGCTCAATATTATAGAAAAAAGGGTAAA-AT-TTTACATAATC 281

Query:   169 ATATATGAGAAGAATAATAAAGAAACGAGTTT-TGTAAAANGATATAT 215
             AT TA  AG   A  A T  AGA AC A TT  TG  A A  AT TAT
Sbjct:   282 AT-TAC-AGTCTATGATTTTAGACACTATTTAATGCCATAAAAT-TAT 326


>cbil|dbest|1030727 AA389409 mp12e10.r1 5'
            Lib=538[Mus_musculus|whole_embryo|embryo|||8.5dpc_embryos]
            Length=195
            Length = 195

  Minus Strand HSPs:

 Score = 136 (20.4 bits), Expect = 7.4, P = 1.0
 Identities = 60/88 (68%), Positives = 60/88 (68%), Strand = Minus / Plus

Query:   245 AAGTT-CTT-AGAATATGACAAATGGNG---TTTTATATA-TCNTTTTACAAAACTCGTT 192
             AAG T CT  AGA TATGA AAATG      TTTTAT T  TC TT TAC AAACT    
Sbjct:    79 AAGCTACTGGAGATTATGAAAAATGTTTCAATTTTATCTGGTCCTTATACCAAACTAACA 138

Query:   191 TCTTTATTATTCTTCTCATATATAAATACA 162
             TCTTTATTATT T C C T TA   ATACA
Sbjct:   139 TCTTTATTATTAT-CACCT-TAGTGATACA 166


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      267       262      10. 115 11 N/A 73   0.021 75
                                                  80   0.023 103
   -1      0      267       262      10. 115 11 N/A 73   0.021 75
                                                  80   0.023 103


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  dbEST
    Release date:  unknown
    Posted date:  9:10 AM EST Dec 21, 1997
    Format:  BLAST
  # of letters in database:  500,351,318
  # of sequences in database:  1,352,941
  # of database sequences satisfying E:  70
  No. of states in DFA:  148 (148 KB)
  Total size of DFA:  154 KB (192 KB)
  Time to generate neighborhood:  0.00u 0.01s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  12.96u 0.88s 13.84t  Elapsed: 00:00:04
  Total cpu time:  13.08u 0.90s 13.98t  Elapsed: 00:00:05
  Start:  Sat Feb  7 21:51:06 1998   End:  Sat Feb  7 21:51:11 1998

Date: 17:29:4 on Mon 18 Dec 117.