blastn_dbest_files/344653_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  344653
        (220 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|344653 R95409 SMNHADA009034SK 5' Lib=323[Schi...   995  1.4e-38   1
A cbil|dbest|1737220 AA999585 MCCE3545.M1F 3'-end Lib=565[S...   567  1.7e-19   1
A cbil|dbest|824828 AA185763 MAAD0171.M2R 5'-end Lib=583[S...   567  1.7e-19   1
A cbil|dbest|824810 AA185819 MAAD0143.M2R 5'-end Lib=583[S...   558  4.3e-19   1
A cbil|dbest|824850 AA185785 MAAD0195.M2R 5'-end Lib=583[S...   557  4.8e-19   1
A cbil|dbest|1737267 AA999632 MCCE3645.M1F 3'-end Lib=565[S...   557  5.3e-19   1
A cbil|dbest|1737117 AA999482 MCCE3357.M1F 3'-end Lib=565[S...   558  6.4e-19   1
A cbil|dbest|345045 R95652 SMNHADA020043SK 5' Lib=323[Schi...   560  6.5e-19   1
A cbil|dbest|1737113 AA999478 MCCE3352.M1F 3'-end Lib=565[S...   550  1.4e-18   1
A cbil|dbest|782427 AA143860 MCCE0103.M1F 3'-end Lib=565[S...   528  6.2e-18   1
A cbil|dbest|1210006 AA559599 MC080528.NA3 5' Lib=977[Schis...   537  7.3e-18   1
A cbil|dbest|1210210 AA559803 MC250470.NA3 5' Lib=977[Schis...   525  2.5e-17   1
A cbil|dbest|1209850 AA559443 MC260430.NA3 5' Lib=977[Schis...   515  9.4e-17   1
A cbil|dbest|1736909 AA999274 MCCE3075.M1F 3'-end Lib=565[S...   508  1.2e-16   1
A cbil|dbest|764150 AA125714 MLLG0137.M1F 3'-end Lib=558[S...   486  7.8e-16   1
A cbil|dbest|779129 AA140564 MEEG0224.M1F  Lib=56...   486  1.2e-15   1
A cbil|dbest|1815815 AI068208 EST209899 5'-end Lib=1384[Sch...   473  1.6e-15   1
A cbil|dbest|1814745 AI067138 EST208809 5'-end Lib=1384[Sch...   473  2.2e-15   1
A cbil|dbest|1765400 AI026193 MEEG0429.M1F 3'-end Lib=562[S...   477  2.2e-15   1
A cbil|dbest|39279 T14506 SMEST0167 3'-end Lib=100[Schist...   479  2.6e-15   1
A cbil|dbest|1815903 AI068296 EST209987 5'-end Lib=1384[Sch...   473  2.8e-15   1
A cbil|dbest|1765419 AI026212 MEEG0448.M1F 3'-end Lib=562[S...   477  2.9e-15   1
A cbil|dbest|1814942 AI067335 EST209013 5'-end Lib=1384[Sch...   463  9.1e-15   1
A cbil|dbest|1814722 AI067115 EST208785 5'-end Lib=1384[Sch...   463  1.0e-14   1
A cbil|dbest|1758109 AI018952 SMEST0592 3'-end Lib=100[Schi...   467  1.1e-14   1
A cbil|dbest|1815396 AI067789 EST209473 5'-end Lib=1384[Sch...   447  4.0e-14   1
A cbil|dbest|1814743 AI067136 EST208807 5'-end Lib=1384[Sch...   447  8.0e-14   1
A cbil|dbest|1814576 AI066969 EST208634 5'-end Lib=1384[Sch...   447  1.1e-13   1
A cbil|dbest|1815125 AI067518 EST209200 5'-end Lib=1384[Sch...   438  2.2e-13   1
A cbil|dbest|1814640 AI067033 EST208702 5'-end Lib=1384[Sch...   440  2.5e-13   1
A cbil|dbest|824845 AA185780 MAAD0189.M2R 5'-end Lib=583[S...   409  2.7e-12   1
A cbil|dbest|1736914 AA999279 MCCE3085.M1F 3'-end Lib=565[S...   355  7.4e-10   1
A cbil|dbest|1689169 AA952832 SMTBCEA000415SK 5' Lib=1128[S...   353  1.6e-09   1
A cbil|dbest|345053 R95660 SMNHADA020083SK 5' Lib=323[Schi...   346  5.8e-09   1
A cbil|dbest|824825 AA185760 MAAD0168.M2R 5'-end Lib=583[S...   231  0.00034   1
A cbil|dbest|1218455 AA568015 HL02151.5prime 5prime Lib=105...   165  0.46      1



>cbil|dbest|344653 R95409 SMNHADA009034SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=220
            Length = 220

  Plus Strand HSPs:

 Score = 995 (149.3 bits), Expect = 1.4e-38, P = 1.4e-38
 Identities = 205/220 (93%), Positives = 205/220 (93%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGGTNAANAAC 60
             |||| ||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGGTNAANAAC 60

Query:    61 GAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAG 120
             ||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||| ||
Sbjct:    61 GAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAG 120

Query:   121 GGTAGTCTAGNTCAGCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGTTACCAGTG 180
             |||||||||| |||||||||||||||||||| |||||||||| |||||| ||||||||||
Sbjct:   121 GGTAGTCTAGNTCAGCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGTTACCAGTG 180

Query:   181 AATNATATANACCTCGANGGGGGGCCCTGATACCCAATAC 220
             ||| ||||| ||||||| ||||||||||||||||||||||
Sbjct:   181 AATNATATANACCTCGANGGGGGGCCCTGATACCCAATAC 220


>cbil|dbest|1737220 AA999585 MCCE3545.M1F 3'-end
            Lib=565[Schistosoma_mansoni|||||Larvae] Length=405 Author_cmt:
            cytochrome oxidase subunit 1
            Length = 405

  Minus Strand HSPs:

 Score = 567 (85.1 bits), Expect = 1.7e-19, P = 1.7e-19
 Identities = 141/173 (81%), Positives = 141/173 (81%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTATTGAGC-TGANCTAGACTACCCTNAAC 115
             AAC C TGTA AGCTACCTA   ACTACGATTATT AGC T A  TA ACTACCC  AAC
Sbjct:     1 AACCCTTGTATAGCTACCTAACTACTACGATTATTTAGCATTACTTA-ACTACCCATAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TTAGAAGCAT TA AT ATCAACAT ACTG GAACA GA CA TCATCACTTTCGT  T 
Sbjct:    60 TTAGAAGCATTTAAATAATCAACATGACTGGGAACAGGAACAGTCATCACTTTCGTAATG 119

Query:    54 NACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              ACCCACCTGAACCTCATA ATCCTATTATA CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCCACCTGAACCTCATA-ATCCTATTATA-CGATTACCA-ACAACCAAAGAC 170


>cbil|dbest|824828 AA185763 MAAD0171.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=392 Author_cmt:
            Cytochrome oxidase subunit 1 (Fasciola hepatica)
            Length = 392

  Plus Strand HSPs:

 Score = 567 (85.1 bits), Expect = 1.7e-19, P = 1.7e-19
 Identities = 141/173 (81%), Positives = 141/173 (81%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGGTNAANAAC 60
             GTCT TG  TGT GG TAATCG TATAATAGGAT TATGAGGTTCAGGTGGGT  A  AC
Sbjct:   223 GTCTTTGGTTGTTGG-TAATCG-TATAATAGGAT-TATGAGGTTCAGGTGGGTGCATTAC 279

Query:    61 GAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAG 120
             GAAAGTGATGA TG TC TGTTC CAGT ATGTTGAT AT TA ATGCTTCTAAGTT  G
Sbjct:   280 GAAAGTGATGACTGTTCCTGTTCCCAGTCATGTTGATTATTTAAATGCTTCTAAGTTATG 339

Query:   121 GGTAGTCTAGNTCA-GCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGTT 173
             GGTAGT TA  T A GCT AATAATCGTAGT   TAGGTAGCT TACA G GTT
Sbjct:   340 GGTAGT-TAAGTAATGCTAAATAATCGTAGTAGTTAGGTAGCTATACAAGGGTT 392


>cbil|dbest|824810 AA185819 MAAD0143.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=392 Author_cmt:
            Cytochrome oxidase subunit 1 (Fasciola hepatica)
            Length = 392

  Plus Strand HSPs:

 Score = 558 (83.7 bits), Expect = 4.3e-19, P = 4.3e-19
 Identities = 140/173 (80%), Positives = 140/173 (80%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGGTNAANAAC 60
             GTCT TG  TGT GG TAATCG TATAATAGGAT TATGAGGTTCAGGTGGGT  A  AC
Sbjct:   223 GTCTTTGGTTGTTGG-TAATCG-TATAATAGGAT-TATGAGGTTCAGGTGGGTGCATTAC 279

Query:    61 GAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAG 120
             GAAAGTGATGA TG TC TGTTC CAGT ATGTTGAT AT TA ATGC TCTAAGTT  G
Sbjct:   280 GAAAGTGATGACTGTTCCTGTTCCCAGTCATGTTGATTATTTAAATGCCTCTAAGTTATG 339

Query:   121 GGTAGTCTAGNTCA-GCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGTT 173
             GGTAGT TA  T A GCT AATAATCGTAGT   TAGGTAGCT TACA G GTT
Sbjct:   340 GGTAGT-TAAGTAATGCTAAATAATCGTAGTAGTTAGGTAGCTATACAAGGGTT 392


>cbil|dbest|824850 AA185785 MAAD0195.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=393 Author_cmt:
            Cytochrome oxidase subunit 1 (Fasciola hepatica)
            Length = 393

  Plus Strand HSPs:

 Score = 557 (83.6 bits), Expect = 4.8e-19, P = 4.8e-19
 Identities = 141/173 (81%), Positives = 141/173 (81%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGG-TNAANAA 59
             GTCT TG  TGT GG TAATCG TATAATAGGAT TATGAGGTTCAGGTGGG T  A  A
Sbjct:   223 GTCTTTGGTTGTTGG-TAATCG-TATAATAGGAT-TATGAGGTTCAGGTGGGGTGCATTA 279

Query:    60 CGAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNA 119
             CGAAAGTGATGA TG TC TGTTC CAGT ATGTTGAT AT TA ATGCTTCTAAGTT  
Sbjct:   280 CGAAAGTGATGACTGTTCCTGTTCCCAGTCATGTTGATTATTTAAATGCTTCTAAGTTAT 339

Query:   120 GGGTAGTCTAGNTCA-GCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGTT 173
             GGGTAGT TA  T A GCT AATAATCGTAGT   TAGGTAGCT TACA G GTT
Sbjct:   340 GGGTAGT-TAAGTAATGCTAAATAATCGTAGTAGTTAGGTAGCTATACAGGGGTT 393


>cbil|dbest|1737267 AA999632 MCCE3645.M1F 3'-end
            Lib=565[Schistosoma_mansoni|||||Larvae] Length=354 Author_cmt:
            cytochrome oxidase subunit 1
            Length = 354

  Minus Strand HSPs:

 Score = 557 (83.6 bits), Expect = 5.3e-19, P = 5.3e-19
 Identities = 141/173 (81%), Positives = 141/173 (81%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTATTGAGC-TGANCTAGACTACCCTNAAC 115
             AAC C TGTA AGCTACCTA   ACTACGATTATT AGC T A  TA ACTACCC  AAC
Sbjct:     1 AACCCTTGTATAGCTACCTAACTACTACGATTATTTAGCATTACTTA-ACTACCCATAAC 59

Query:   114 TTAGAAGCATATACA-TNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNT 56
             TTAGAAGCAT TA A T ATCAACAT ACTG GAACA GA CA TCATCACTTTCGT  T
Sbjct:    60 TTAGAAGCATTTAAAATAATCAACATGACTGGGAACAGGAACAGTCATCACTTTCGTAAT 119

Query:    55 TNACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
               ACCCACCTGAACCTCATA ATCCTATTATA CGATTACC  ACA  CA AGAC
Sbjct:   120 GCACCCACCTGAACCTCATA-ATCCTATTATA-CGATTACCA-ACAACCAAAGAC 171


>cbil|dbest|1737117 AA999482 MCCE3357.M1F 3'-end
            Lib=565[Schistosoma_mansoni|||||Larvae] Length=267
            Length = 267

  Minus Strand HSPs:

 Score = 558 (83.7 bits), Expect = 6.4e-19, P = 6.4e-19
 Identities = 140/173 (80%), Positives = 140/173 (80%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTATTGAGC-TGANCTAGACTACCCTNAAC 115
             AAC C TGTA AGCTACCTA   ACTACGATTATT AGC T A  TA ACTACCC  AAC
Sbjct:     1 AACCCTTGTATAGCTACCTAACTACTACGATTATTTAGCATTACTTA-ACTACCCATAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TTAGAAGCAT TA AT ATC ACAT ACTG GAACA GA CA TCATCACTTTCGT  T 
Sbjct:    60 TTAGAAGCATTTAAATAATCGACATGACTGGGAACAGGAACAGTCATCACTTTCGTAATG 119

Query:    54 NACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              ACCCACCTGAACCTCATA ATCCTATTATA CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCCACCTGAACCTCATA-ATCCTATTATA-CGATTACCA-ACAACCAAAGAC 170


>cbil|dbest|345045 R95652 SMNHADA020043SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=213
            Length = 213

  Plus Strand HSPs:

 Score = 560 (84.0 bits), Expect = 6.5e-19, P = 6.5e-19
 Identities = 140/173 (80%), Positives = 140/173 (80%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGGTNAANAAC 60
             GTCT TG  TGT GG TAATCG TATAATAGGAT TATGAGGTTCAGGTGGGT  A  AC
Sbjct:    44 GTCTTTGGTTGTTGG-TAATCG-TATAATAGGAT-TATGAGGTTCAGGTGGGTGCATTAC 100

Query:    61 GAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAG 120
             GAAAGTGATGA TG TC TGTTC CAGT ATGTTGAT AT TA ATGCTTCTAAGTT  G
Sbjct:   101 GAAAGTGATGACTGTTCCTGTTCCCAGTCATGTTGATTATTTAAATGCTTCTAAGTTATG 160

Query:   121 GGTAGTCTAGNTCA-GCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGTT 173
             GGTAGT TA  T A GCT AATAATCGTAG    TAGGTAGCT TACA G GTT
Sbjct:   161 GGTAGT-TAAGTAATGCTAAATAATCGTAGNAGTTAGGTAGCTATACAAGGGTT 213


>cbil|dbest|1737113 AA999478 MCCE3352.M1F 3'-end
            Lib=565[Schistosoma_mansoni|||||Larvae] Length=282 Author_cmt:
            cytochrome oxidase subunit 1
            Length = 282

  Minus Strand HSPs:

 Score = 550 (82.5 bits), Expect = 1.4e-18, P = 1.4e-18
 Identities = 140/173 (80%), Positives = 140/173 (80%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTATTGAGC-TGANCTAGACTACCCTNAAC 115
             AAC C TGTA AGCTACCTA   ACTACGATTATT AGC T A  TA ACTACCC  AAC
Sbjct:     2 AAC-CTTGTATAGCTACCTAACTACTACGATTATTTAGCATTACTTA-ACTACCCATAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TTAGAAGCAT TA AT ATCAACAT ACTG GAACA GA CA TCATCACTTTCGT  T 
Sbjct:    60 TTAGAAGCATTTAAATAATCAACATGACTGGGAACAGGAACAGTCATCACTTTCGTAATG 119

Query:    54 NACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              ACCCACCTGAACC CATA ATCCTATTATA CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCCACCTGAACCCCATA-ATCCTATTATA-CGATTACCA-ACAACCAAAGAC 170


>cbil|dbest|782427 AA143860 MCCE0103.M1F 3'-end
            Lib=565[Schistosoma_mansoni|||||Larvae] Length=625 Author_cmt:
            cytochrome oxidase, subunit 1
            Length = 625

  Minus Strand HSPs:

 Score = 528 (79.2 bits), Expect = 6.2e-18, P = 6.2e-18
 Identities = 134/164 (81%), Positives = 134/164 (81%), Strand = Minus / Plus

Query:   164 ANAGCTACC-TATNGACTACGATTATTGAGC-TGANCTAGACTACCCTNAACTTAGAAGC 107
             A AGCTACC TA   ACTACGATTATT AGC T A  TA ACTACCC  AACTTAGAAGC
Sbjct:    10 ATAGCTACCCTAACTACTACGATTATTTAGCATTACTTA-ACTACCCATAACTTAGAAGC 68

Query:   106 ATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACCCACC 47
             AT TA AT ATCAACAT ACTG GAACA GA CA TCATCACTTTCGT  T  ACCCACC
Sbjct:    69 ATTTAAATAATCAACATGACTGGGAACAGGAACAGTCATCACTTTCGTAATGCACCCACC 128

Query:    46 TGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             TGAACCTCATA ATCCTATTATA CGATTACC  ACA  CA AGAC
Sbjct:   129 TGAACCTCATA-ATCCTATTATA-CGATTACCA-ACAACCAAAGAC 171


>cbil|dbest|1210006 AA559599 MC080528.NA3 5'
            Lib=977[Schistosoma_mansoni|whole_organism||||cercaria] Length=207
            Author_cmt: R95652, uncharacterised Schistosoma mansoni cDNA clone
            Length = 207

  Plus Strand HSPs:

 Score = 537 (80.6 bits), Expect = 7.3e-18, P = 7.3e-18
 Identities = 137/173 (79%), Positives = 137/173 (79%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGGTNAANAAC 60
             GTCT TG  TGT GG TAATCG TATAATAGGAT TATGAGGTTCAGGTGGGT  A  AC
Sbjct:    38 GTCTTTGGTTGTTGG-TAATCG-TATAATAGGAT-TATGAGGTTCAGGTGGGTGCATTAC 94

Query:    61 GAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAG 120
              AAAGTGATGA TG  C TGT C CAGT ATGTTGAT AT TA ATGCTTCTAAGTT  G
Sbjct:    95 NAAAGTGATGACTGTNCCTGTCCCCAGTCATGTTGATTATTTAAATGCTTCTAAGTTATG 154

Query:   121 GGTAGTCTAGNTCA-GCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGTT 173
             GGTAGT TA  T A GCT AATAATCGTAGT   TAGGTA CT TACA G GTT
Sbjct:   155 GGTAGT-TAAGTAATGCTAAATAATCGTAGTAGTTAGGTANCTATACAAGGGTT 207


>cbil|dbest|1210210 AA559803 MC250470.NA3 5'
            Lib=977[Schistosoma_mansoni|whole_organism||||cercaria] Length=208
            Author_cmt: R95652, uncharacterised Schistosoma mansoni cDNA clone
            Length = 208

  Plus Strand HSPs:

 Score = 525 (78.8 bits), Expect = 2.5e-17, P = 2.5e-17
 Identities = 135/173 (78%), Positives = 135/173 (78%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGGTNAANAAC 60
             GTCT TG  TGT GG TAATCG TATAATAGGAT TATGAGGTTCAGGTGGGT  A  AC
Sbjct:    39 GTCTTTGGTTGTTGG-TAATCG-TATAATAGGAT-TATGAGGTTCAGGTGGGTGCATTAC 95

Query:    61 GAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAG 120
              AAAGTGATGA TG  C TGT C CAGT ATGTTGAT AT TA ATGCT CTAAGTT  G
Sbjct:    96 NAAAGTGATGACTGTNCCTGTNCCCAGTCATGTTGATTATTTAAATGCTNCTAAGTTATG 155

Query:   121 GGTAGTCTAGNTCA-GCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGTT 173
             GGTAGT TA  T A GCT AATAA CGTAGT   TAGGTA CT TACA G GTT
Sbjct:   156 GGTAGT-TAAGTAATGCTAAATAANCGTAGTAGTTAGGTANCTATACAAGGGTT 208


>cbil|dbest|1209850 AA559443 MC260430.NA3 5'
            Lib=977[Schistosoma_mansoni|whole_organism||||cercaria] Length=159
            Author_cmt: R95652, uncharacterised Schistosoma mansoni cDNA clone
            Length = 159

  Plus Strand HSPs:

 Score = 515 (77.3 bits), Expect = 9.4e-17, P = 9.4e-17
 Identities = 125/152 (82%), Positives = 125/152 (82%), Strand = Plus / Plus

Query:    22 GATATAATAGGATATATGAGGTTCAGGTGGGTNAANAACGAAAGTGATGAATGCTCNTGT 81
             G TATAATAGGAT TATGAGGTTCAGGTGGGT  A  ACGAAAGTGATGA TG TC TGT
Sbjct:     9 GGTATAATAGGAT-TATGAGGTTCAGGTGGGTGCATTACGAAAGTGATGACTGTTCCTGT 67

Query:    82 TCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAGGGTAGTCTAGNTCA-GCTCAA 140
             TC CAGT ATGTTGAT AT TA ATGCTTCTAAGTT  GGGTAGT TA  T A GCT AA
Sbjct:    68 TCCCAGTCATGTTGATTATTTAAATGCTTCTAAGTTATGGGTAGT-TAAGTAATGCTAAA 126

Query:   141 TAATCGTAGTCNATAGGTAGCTNTACATGNGTT 173
             TAATCGTAGT   TAGGTAGCT TACA G GTT
Sbjct:   127 TAATCGTAGTAGTTAGGTAGCTATACAAGGGTT 159


>cbil|dbest|1736909 AA999274 MCCE3075.M1F 3'-end
            Lib=565[Schistosoma_mansoni|||||Larvae] Length=258
            Length = 258

  Minus Strand HSPs:

 Score = 508 (76.2 bits), Expect = 1.2e-16, P = 1.2e-16
 Identities = 134/172 (77%), Positives = 134/172 (77%), Strand = Minus / Plus

Query:   172 ACNCATGTANAGCTACCTATNGACTACGATTATTGAGC-TGANCTAGACTACCCTNAACT 114
             AC C TGTA AGCTACCTA   ACTACGATTAT   GC T A  TA ACTACCC  AACT
Sbjct:     1 ACCCTTGTATAGCTACCTAACTACTACGATTATCCCGCATTACTTA-ACTACCCATAACT 59

Query:   113 TAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTN 54
              AGAAGCAT T C T ATCAACAT ACTG  AACA GA CA TCATCACTTTCGT  T  
Sbjct:    60 CAGAAGCATTTCCCTCATCAACATGACTGGCAACAGGAACAGTCATCACTTTCGTCATGC 119

Query:    53 ACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             ACCCACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 ACCCACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 169


>cbil|dbest|764150 AA125714 MLLG0137.M1F 3'-end
            Lib=558[Schistosoma_mansoni|||||Lung] Length=389 Author_cmt:
            cytochrome oxidase subunit 1
            Length = 389

  Minus Strand HSPs:

 Score = 486 (72.9 bits), Expect = 7.8e-16, P = 7.8e-16
 Identities = 132/173 (76%), Positives = 132/173 (76%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAAC 115
             AAC C TGT  AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AAC
Sbjct:     1 AACCCTTGTTTAGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TTAGAAGCAT TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT    
Sbjct:    60 TTAGAAGCATTTAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACA 119

Query:    54 NACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              ACCCACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCCACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 170


>cbil|dbest|779129 AA140564 MEEG0224.M1F 
            Lib=562[Schistosoma_mansoni|||||egg] Length=249 Author_cmt:
            Cytochrome oxidase subunit I
            Length = 249

  Minus Strand HSPs:

 Score = 486 (72.9 bits), Expect = 1.2e-15, P = 1.2e-15
 Identities = 132/173 (76%), Positives = 132/173 (76%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAAC 115
             AAC C TGT  AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AAC
Sbjct:     1 AACCCTTGTTTAGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TTAGAAGCAT TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT    
Sbjct:    60 TTAGAAGCATTTAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACA 119

Query:    54 NACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              ACCCACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCCACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 170


>cbil|dbest|1815815 AI068208 EST209899 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=737 Author_cmt:
            cytochrome C oxidase subunit I
            Length = 737

  Minus Strand HSPs:

 Score = 473 (71.0 bits), Expect = 1.6e-15, P = 1.6e-15
 Identities = 129/169 (76%), Positives = 129/169 (76%), Strand = Minus / Plus

Query:   169 CATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAG 111
             C TGT  AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAG
Sbjct:     1 CTTGTTTAGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAG 59

Query:   110 AAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACC 51
             AAGCAT TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACC
Sbjct:    60 AAGCATTTAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACC 119

Query:    50 CACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             CACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 166


>cbil|dbest|1814745 AI067138 EST208809 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=536 Author_cmt:
            cytochrome C oxidase subunit I
            Length = 536

  Minus Strand HSPs:

 Score = 473 (71.0 bits), Expect = 2.2e-15, P = 2.2e-15
 Identities = 129/169 (76%), Positives = 129/169 (76%), Strand = Minus / Plus

Query:   169 CATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAG 111
             C TGT  AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAG
Sbjct:     1 CTTGTTTAGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAG 59

Query:   110 AAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACC 51
             AAGCAT TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACC
Sbjct:    60 AAGCATTTAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACC 119

Query:    50 CACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             CACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 166


>cbil|dbest|1765400 AI026193 MEEG0429.M1F 3'-end
            Lib=562[Schistosoma_mansoni|||||egg] Length=353 Author_cmt:
            Cytochrome oxidase subiunit 1 (Fasciola hepatica)
            Length = 353

  Minus Strand HSPs:

 Score = 477 (71.6 bits), Expect = 2.2e-15, P = 2.2e-15
 Identities = 131/173 (75%), Positives = 131/173 (75%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAAC 115
             AAC C TGT  AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AAC
Sbjct:     1 AACCCTTGTTTAGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TTAGAAGCAT TA AT ATCAACAT ACT  GAA A GA CA TCATCACTTTCGT    
Sbjct:    60 TTAGAAGCATTTAAATAATCAACATGACTAGGAAAAGGAACAGTCATCACTTTCGTAACA 119

Query:    54 NACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              ACCCACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCCACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 170


>cbil|dbest|39279 T14506 SMEST0167 3'-end Lib=100[Schistosoma_mansoni|||||]
            Length=240
            Length = 240

  Minus Strand HSPs:

 Score = 479 (71.9 bits), Expect = 2.6e-15, P = 2.6e-15
 Identities = 131/173 (75%), Positives = 131/173 (75%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAAC 115
             AAC C TGT  AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AAC
Sbjct:     1 AACCCTTGTTTAGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TTAGAAGCAT TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT    
Sbjct:    60 TTAGAAGCATTTAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACA 119

Query:    54 NACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              ACCCACCTGAACCTCATA ATCCTATTA A CG TTACC  ACA  CA AGAC
Sbjct:   120 CACCCACCTGAACCTCATA-ATCCTATTACA-CGNTTACCA-ACAACCAAAGAC 170


>cbil|dbest|1815903 AI068296 EST209987 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=425 Author_cmt:
            cytochrome C oxidase subunit I
            Length = 425

  Minus Strand HSPs:

 Score = 473 (71.0 bits), Expect = 2.8e-15, P = 2.8e-15
 Identities = 129/169 (76%), Positives = 129/169 (76%), Strand = Minus / Plus

Query:   169 CATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAG 111
             C TGT  AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAG
Sbjct:     1 CTTGTTTAGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAG 59

Query:   110 AAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACC 51
             AAGCAT TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACC
Sbjct:    60 AAGCATTTAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACC 119

Query:    50 CACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             CACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 166


>cbil|dbest|1765419 AI026212 MEEG0448.M1F 3'-end
            Lib=562[Schistosoma_mansoni|||||egg] Length=266
            Length = 266

  Minus Strand HSPs:

 Score = 477 (71.6 bits), Expect = 2.9e-15, P = 2.9e-15
 Identities = 131/173 (75%), Positives = 131/173 (75%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAAC 115
             AAC C TGT  AG  ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AAC
Sbjct:     1 AACCCTTGTTTAGGCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TTAGAAGCAT TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT    
Sbjct:    60 TTAGAAGCATTTAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACA 119

Query:    54 NACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              ACCCACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 CACCCACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 170


>cbil|dbest|1814942 AI067335 EST209013 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=366 Author_cmt:
            cytochrome C oxidase subunit I
            Length = 366

  Minus Strand HSPs:

 Score = 463 (69.5 bits), Expect = 9.1e-15, P = 9.1e-15
 Identities = 125/162 (77%), Positives = 125/162 (77%), Strand = Minus / Plus

Query:   162 AGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAGAAGCATA 104
             AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAGAAGCAT 
Sbjct:     1 AGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAGAAGCATT 59

Query:   103 TACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACCCACCTGA 44
             TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACCCACCTGA
Sbjct:    60 TAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACCCACCTGA 119

Query:    43 ACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             ACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 ACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 159


>cbil|dbest|1814722 AI067115 EST208785 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=334 Author_cmt:
            cytochrome C oxidase subunit I
            Length = 334

  Minus Strand HSPs:

 Score = 463 (69.5 bits), Expect = 1.0e-14, P = 1.0e-14
 Identities = 125/162 (77%), Positives = 125/162 (77%), Strand = Minus / Plus

Query:   162 AGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAGAAGCATA 104
             AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAGAAGCAT 
Sbjct:     1 AGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAGAAGCATT 59

Query:   103 TACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACCCACCTGA 44
             TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACCCACCTGA
Sbjct:    60 TAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACCCACCTGA 119

Query:    43 ACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             ACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 ACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 159


>cbil|dbest|1758109 AI018952 SMEST0592 3'-end Lib=100[Schistosoma_mansoni|||||]
            Length=193
            Length = 193

  Minus Strand HSPs:

 Score = 467 (70.1 bits), Expect = 1.1e-14, P = 1.1e-14
 Identities = 131/173 (75%), Positives = 131/173 (75%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAAC 115
             AAC C TGT  AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AAC
Sbjct:     1 AACCCTTGTTTAGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANG-AGCATTCATCACTTTCGTTNT 56
             TTAGAAGCAT TA AT ATCAACAT ACT  G ACA G A CA TCATCACTTTCGT   
Sbjct:    60 TTAGAAGCATTTAAATAATCAACATGACTAGGGACAGGGAACAGTCATCACTTTCGTAAC 119

Query:    55 TNACCCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
               ACCCACCTGAACCTCATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 ACACCCACCTGAACCTCATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 171


>cbil|dbest|1815396 AI067789 EST209473 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=436 Author_cmt:
            cytochrome C oxidase subunit I
            Length = 436

  Minus Strand HSPs:

 Score = 447 (67.1 bits), Expect = 4.0e-14, P = 4.0e-14
 Identities = 121/157 (77%), Positives = 121/157 (77%), Strand = Minus / Plus

Query:   157 CCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAGAAGCATATACAT 99
             CCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAGAAGCAT TA AT
Sbjct:     1 CCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAGAAGCATTTAAAT 59

Query:    98 NATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACCCACCTGAACCTC 39
              ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACCCACCTGAACCTC
Sbjct:    60 AATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACCCACCTGAACCTC 119

Query:    38 ATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             ATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 ATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 154


>cbil|dbest|1814743 AI067136 EST208807 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=219
            Length = 219

  Minus Strand HSPs:

 Score = 447 (67.1 bits), Expect = 8.0e-14, P = 8.0e-14
 Identities = 121/157 (77%), Positives = 121/157 (77%), Strand = Minus / Plus

Query:   157 CCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAGAAGCATATACAT 99
             CCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAGAAGCAT TA AT
Sbjct:     1 CCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAGAAGCATTTAAAT 59

Query:    98 NATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACCCACCTGAACCTC 39
              ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACCCACCTGAACCTC
Sbjct:    60 AATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACCCACCTGAACCTC 119

Query:    38 ATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             ATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 ATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 154


>cbil|dbest|1814576 AI066969 EST208634 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=160 Author_cmt:
            cytochrome C oxidase subunit I
            Length = 160

  Minus Strand HSPs:

 Score = 447 (67.1 bits), Expect = 1.1e-13, P = 1.1e-13
 Identities = 121/157 (77%), Positives = 121/157 (77%), Strand = Minus / Plus

Query:   157 CCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAGAAGCATATACAT 99
             CCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAGAAGCAT TA AT
Sbjct:     1 CCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAGAAGCATTTAAAT 59

Query:    98 NATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACCCACCTGAACCTC 39
              ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACCCACCTGAACCTC
Sbjct:    60 AATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACCCACCTGAACCTC 119

Query:    38 ATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             ATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 ATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 154


>cbil|dbest|1815125 AI067518 EST209200 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=205 Author_cmt:
            cytochrome C oxidase subunit I
            Length = 205

  Minus Strand HSPs:

 Score = 438 (65.7 bits), Expect = 2.2e-13, P = 2.2e-13
 Identities = 120/157 (76%), Positives = 120/157 (76%), Strand = Minus / Plus

Query:   157 CCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAGAAGCATATACAT 99
             CCTAT  ACTA GATTA  T AG T    TA  C ACCC  AACTTAGAAGCAT TA AT
Sbjct:     1 CCTATTTACTATGATTACCTAAGATTGCTTATCC-ACCCACAACTTAGAAGCATTTAAAT 59

Query:    98 NATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACCCACCTGAACCTC 39
              ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACCCACCTGAACCTC
Sbjct:    60 AATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACCCACCTGAACCTC 119

Query:    38 ATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
             ATA ATCCTATTA A CGATTACC  ACA  CA AGAC
Sbjct:   120 ATA-ATCCTATTACA-CGATTACCA-ACAACCAAAGAC 154


>cbil|dbest|1814640 AI067033 EST208702 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=148
            Length = 148

  Minus Strand HSPs:

 Score = 440 (66.0 bits), Expect = 2.5e-13, P = 2.5e-13
 Identities = 116/148 (78%), Positives = 116/148 (78%), Strand = Minus / Plus

Query:   162 AGCTACCTATNGACTACGATTAT-TGAGCTGANCTAGACTACCCTNAACTTAGAAGCATA 104
             AGC ACCTAT  ACTA GATTA  T AG T    TAG C ACCC  AACTTAGAAGCAT 
Sbjct:     1 AGCCACCTATTTACTATGATTACCTAAGATTGCTTAGCC-ACCCACAACTTAGAAGCATT 59

Query:   103 TACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTTNACCCACCTGA 44
             TA AT ATCAACAT ACT  GAACA GA CA TCATCACTTTCGT     ACCCACCTGA
Sbjct:    60 TAAATAATCAACATGACTAGGAACAGGAACAGTCATCACTTTCGTAACACACCCACCTGA 119

Query:    43 ACCTCATATATCCTATTATATCGATTACC 15
             ACCTCATA ATCCTATTA A CGATTACC
Sbjct:   120 ACCTCATA-ATCCTATTACA-CGATTACC 146


>cbil|dbest|824845 AA185780 MAAD0189.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=342 Author_cmt:
            Cytochrome oxidase subunit 1 (Fasciola hepatica)
            Length = 342

  Plus Strand HSPs:

 Score = 409 (61.4 bits), Expect = 2.7e-12, P = 2.7e-12
 Identities = 101/122 (82%), Positives = 101/122 (82%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGT-GGGTNAANAA 59
             GTCT TG  TGT GG TAATCG TATAATAGGAT TATGAGGTTCAGGT GGGT  A  A
Sbjct:   223 GTCTTTGGTTGTTGG-TAATCG-TATAATAGGAT-TATGAGGTTCAGGTTGGGTGCATTA 279

Query:    60 CGAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNA 119
             CGAAAGTGATGA TG TC TGTTC CAGT ATGTTGAT AT TA ATGCTTCTAAGTT  
Sbjct:   280 CGAAAGTGATGACTGTTCCTGTTCCCAGTCATGTTGATTATTTAAATGCTTCTAAGTTAT 339

Query:   120 GGG 122
             GGG
Sbjct:   340 GGG 342


>cbil|dbest|1736914 AA999279 MCCE3085.M1F 3'-end
            Lib=565[Schistosoma_mansoni|||||Larvae] Length=342 Author_cmt:
            calcium binding protein
            Length = 342

  Minus Strand HSPs:

 Score = 355 (53.3 bits), Expect = 7.4e-10, P = 7.4e-10
 Identities = 91/116 (78%), Positives = 91/116 (78%), Strand = Minus / Plus

Query:   173 AACNCATGTANAGCTACCTATNGACTACGATTATTGAGC-TGANCTAGACTACCCTNAAC 115
             AAC C TGTA AGCTACCTA   ACTACGA TATT AGC T A  TA ACTACCC  AAC
Sbjct:     1 AACCCTTGTATAGCTACCTAACTACTACGAATATTTAGCATTACTTA-ACTACCCATAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTT 58
             TTAGAAGC T TA AT  TCAACAT ACTG GAACA GA CA TCATCACTTTCG T
Sbjct:    60 TTAGAAGCGTTTAAATACTCAACATGACTGGGAACAGGACCAGTCATCACTTTCGCT 116


>cbil|dbest|1689169 AA952832 SMTBCEA000415SK 5'
            Lib=1128[Schistosoma_mansoni|||||cercariae] Length=195
            Length = 195

  Minus Strand HSPs:

 Score = 353 (53.0 bits), Expect = 1.6e-09, P = 1.6e-09
 Identities = 121/171 (70%), Positives = 121/171 (70%), Strand = Minus / Plus

Query:   171 CNCATGTANAGC-TACCTATNGACTACGATTATTGAGC--TGANCTAGACTACCCTNAAC 115
             C C TGTA AGC TACCTA   ACTAC ATTATT A C  T A CT  ACTACCC  AAC
Sbjct:     1 CCCTTGTATAGCCTACCTAACTACTACCATTATTTACCCATTACCTT-ACTACCCATAAC 59

Query:   114 TTAGAAGCATATACATNATCAACATNACTGAGAACANGAGCATTCATCACTTTCGTTNTT 55
             TT GA  C T TA  T  TCA  A  ACT  GA CA GA CA TCATCACTTTC  T   
Sbjct:    60 TT-GAGCCCTTTAACTACTCAG-ACTACTTGGA-CAAGAACAGTCATCACTTTCCGTAA- 115

Query:    54 NAC-CCACCTGAACCTCATATATCCTATTATATCGATTACCCCACANTCANAGAC 1
              AC CCACCTGAACC  ATA ATCCTATTATA CGATTACCC A A  C  AGAC
Sbjct:   116 GACACCACCTGAACCCTATA-ATCCTATTATACCGATTACCCAAGAACCCAAGAC 169


>cbil|dbest|345053 R95660 SMNHADA020083SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=110
            Length = 110

  Plus Strand HSPs:

 Score = 346 (51.9 bits), Expect = 5.8e-09, P = 5.8e-09
 Identities = 88/111 (79%), Positives = 88/111 (79%), Strand = Plus / Plus

Query:    62 AAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTTCTAAGTTNAGG 121
             AAAGTGATGA TG TC TGTTC CAGT ATGTTGAT AT TA ATGCTTCTAAGTT  GG
Sbjct:     1 AAAGTGATGACTGTTCCTGTTC-CAGTCATGTTGATTATTTAAATGCTTCTAAGTTATGG 59

Query:   122 GTAGTCTAGNTCA-GCTCAATAATCGTAGTCNATAGGTAGCTNTACATGNGT 172
             GTAG  TA  T A G T AATAATCGTAGT   TAGGTAGCT TACA G GT
Sbjct:    60 GTAGN-TAAGTAATGNTAAATAATCGTAGTAGTTAGGTAGCTATACAAGGGT 110


>cbil|dbest|824825 AA185760 MAAD0168.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=296 Author_cmt:
            Cytochrome oxidase subunit 1 (Fasciola hepatica)
            Length = 296

  Plus Strand HSPs:

 Score = 231 (34.7 bits), Expect = 0.00034, P = 0.00034
 Identities = 57/68 (83%), Positives = 57/68 (83%), Strand = Plus / Plus

Query:     1 GTCTNTGANTGTGGGGTAATCGATATAATAGGATATATGAGGTTCAGGTGGGTNAANAAC 60
             GTCT TG  TGT GG TAATCG TATAATAGGAT TATGAGGTTCAGGTGGGT  A  AC
Sbjct:   232 GTCTTTGGTTGTTGG-TAATCG-TATAATAGGAT-TATGAGGTTCAGGTGGGTGCATTAC 288

Query:    61 GAAAGTGA 68
             GAAAGTGA
Sbjct:   289 GAAAGTGA 296


>cbil|dbest|1218455 AA568015 HL02151.5prime 5prime
            Lib=1056[Drosophila_melanogaster|head--brain_&_sensory_organ||||adu
            lt] Length=502
            Length = 502

  Plus Strand HSPs:

 Score = 165 (24.8 bits), Expect = 0.62, P = 0.46
 Identities = 85/134 (63%), Positives = 85/134 (63%), Strand = Plus / Plus

Query:    58 AACGAAAGTGATGAATGCTCNTGTTCTCAGTNATGTTGATNATGTATATGCTT-CTAAGT 116
             AACGAAAGTGA GAATG    T TTCT AGT  TG   A   TG A AT  T  C AAGT
Sbjct:   210 AACGAAAGTGAGGAATGAGAATTTTCTTAGT--TGCCTACGCTGCAAATTGTGACAAAGT 267

Query:   117 TNAGGGTAGTCTAGNTCAGCTCAATA-ATCG-TAGTCNAT-AGG-TAGCTNTACATGNGT 172
               A G T  TC A  TCA CTC ATA ATC  TAGT  AT A   T   T TACA    T
Sbjct:   268 GAAAGCTT-TCCACCTCAACTCTATACATCAATAGTTTATCAACATTTGTATACAAATAT 326

Query:   173 TACCAGTGAATNATATANA 191
             TAC AGT AAT ATATA A
Sbjct:   327 TACGAGT-AAT-ATATACA 343


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      220       205      10. 115 11 N/A 73   0.023 73
                                                  78   0.022 96
   -1      0      220       205      10. 115 11 N/A 73   0.023 73
                                                  78   0.022 96


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  /usr/local/db/others/blast/dbEST
    Release date:  unknown
    Posted date:  10:29 AM EDT Sep 6, 1998
    Format:  BLAST
  # of letters in database:  680,019,941
  # of sequences in database:  1,803,623
  # of database sequences satisfying E:  36
  No. of states in DFA:  126 (126 KB)
  Total size of DFA:  129 KB (192 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  14.61u 2.10s 16.71t  Elapsed: 00:00:04
  Total cpu time:  14.70u 9.01s 23.71t  Elapsed: 00:00:11
  Start:  Sat Sep 26 16:57:47 1998   End:  Sat Sep 26 16:57:58 1998

Date: 17:27:9 on Mon 18 Dec 117.