blastn_dbest_files/44106_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  44106
        (273 letters)

Database:  dbEST
           1,352,941 sequences; 500,351,318 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|44106 T18067 0446c3 5' Lib=8[Plasmodium_falc...  1358  3.4e-55   1
A cbil|dbest|1200796 C22425 C22425  Lib=961[Oryza_...   391  1.0e-11   1
A cbil|dbest|1200792 C22421 C22421  Lib=961[Oryza_...   355  3.9e-10   1
A cbil|dbest|924610 AA283518 SW3ICA2642SK 5' Lib=282[Brugi...   312  3.7e-08   1
A cbil|dbest|1373675 AA668091 SWOv3MCAM02D10SK 5' Lib=651[O...   271  2.9e-06   1
A cbil|dbest|688155 AA062288 ml64c06.r1 5' Lib=482[Mus_mus...   227  0.00029   1
A cbil|dbest|608631 AA000202 mg34g11.r1 5' Lib=437[Mus_mus...   222  0.00042   1
A cbil|dbest|608911 AA000622 mg35c01.r1 5' Lib=437[Mus_mus...   222  0.00043   1
A cbil|dbest|764640 AA126326 zm79g03.s1 3' Lib=502[Homo_sa...   222  0.00043   1
A cbil|dbest|672439 W07949 mb45f05.r1 5' Lib=431[Mus_muscu...   222  0.00043   1
A cbil|dbest|585761 W76813 me83g06.r1 5' Lib=437[Mus_muscu...   222  0.00045   1
A cbil|dbest|884981 AA245539 my50a11.r1 5' Lib=609[Mus_mus...   222  0.00045   1
A cbil|dbest|700819 AA068901 mm63f03.r1 5' Lib=500[Mus_mus...   222  0.00045   1
A cbil|dbest|550261 W42370 mc75h02.r1 5' Lib=437[Mus_muscu...   222  0.00045   1
A cbil|dbest|793437 AA154889 mq61g06.r1 5' Lib=544[Mus_mus...   222  0.00046   1
A cbil|dbest|583497 W75262 me54f04.r1 5' Lib=437[Mus_muscu...   222  0.00048   1
A cbil|dbest|1271395 AA592713 vo29c07.r1 5' Lib=909[Mus_mus...   222  0.00049   1
A cbil|dbest|650378 AA034547 mi50g12.r1 5' Lib=437[Mus_mus...   222  0.00050   1
A cbil|dbest|1028110 AA386780 vb54b12.r1 5' Lib=845[Mus_mus...   222  0.00051   1
A cbil|dbest|654587 AA038915 mi96e01.r1 5' Lib=431[Mus_mus...   222  0.00055   1
A cbil|dbest|910559 AA269390 va90e01.r1 5' Lib=593[Mus_mus...   222  0.00056   1
A cbil|dbest|1120821 AA476191 vh23g07.r1 5' Lib=868[Mus_mus...   222  0.00056   1
A cbil|dbest|570884 W62883 md88e05.r1 5' Lib=437[Mus_muscu...   222  0.00058   1
A cbil|dbest|570558 W62502 md69g03.r1 5' Lib=437[Mus_muscu...   222  0.00059   1
A cbil|dbest|877845 AA238509 mx95d10.r1 5' Lib=598[Mus_mus...   222  0.00059   1
A cbil|dbest|638202 AA024130 mi01e04.r1 5' Lib=470[Mus_mus...   222  0.00061   1
A cbil|dbest|1107070 AA462564 vg68a08.r1 5' Lib=855[Mus_mus...   222  0.00062   1
A cbil|dbest|516712 W09448 ma63f05.r1 5' Lib=431[Mus_muscu...   222  0.00063   1
A cbil|dbest|763899 AA125095 mp77d02.r1 5' Lib=544[Mus_mus...   222  0.00064   1
A cbil|dbest|650475 AA034879 mi53c01.r1 5' Lib=437[Mus_mus...   222  0.00066   1
A cbil|dbest|544267 W36905 mb77g12.r1 5' Lib=431[Mus_muscu...   222  0.00066   1
A cbil|dbest|570890 W62889 md88g05.r1 5' Lib=437[Mus_muscu...   222  0.00067   1
A cbil|dbest|685480 AA059676 mj75c11.r1 5' Lib=431[Mus_mus...   222  0.00068   1
A cbil|dbest|612115 AA002650 mg38g08.r1 5' Lib=437[Mus_mus...   223  0.00068   1
A cbil|dbest|553669 W46121 mc78e03.r1 5' Lib=437[Mus_muscu...   222  0.00070   1
A cbil|dbest|561811 W54754 md10g01.r1 5' Lib=437[Mus_muscu...   222  0.00072   1
A cbil|dbest|612361 AA003102 mg50d09.r1 5' Lib=437[Mus_mus...   222  0.00072   1
A cbil|dbest|723497 AA087196 mk22f01.r1 5' Lib=431[Mus_mus...   222  0.00072   1
A cbil|dbest|908380 AA267345 mz96d09.r1 5' Lib=567[Mus_mus...   222  0.00074   1
A cbil|dbest|1379079 AA673479 vp49e09.r1 3' Lib=862[Mus_mus...   222  0.00075   1
A cbil|dbest|720091 AA084756 zn13c01.r1 5' Lib=525[Homo_sa...   216  0.00081   1
A cbil|dbest|542914 W35054 mc40c07.r1 5' Lib=431[Mus_muscu...   216  0.00084   1
A cbil|dbest|673735 W85446 mf45d10.r1 5' Lib=437[Mus_muscu...   222  0.00084   1
A cbil|dbest|675606 W84042 mf25c03.r1 5' Lib=437[Mus_muscu...   220  0.00096   1
A cbil|dbest|573290 W65101 me06b08.r1 5' Lib=437[Mus_muscu...   213  0.0011    1
A cbil|dbest|527815 W20760 mb91b06.r1 5' Lib=431[Mus_muscu...   214  0.0014    1
A cbil|dbest|550237 W42346 mc75d05.r1 5' Lib=437[Mus_muscu...   211  0.0014    1
A cbil|dbest|1392384 AA686237 EST109600 5'-end Lib=304[Ratt...   210  0.0023    1
A cbil|dbest|515346 W08208 mb49c12.r1 5' Lib=431[Mus_muscu...   209  0.0034    1
A cbil|dbest|584971 W77038 me51a12.r1 5' Lib=437[Mus_muscu...   207  0.0036    1
A cbil|dbest|295783 H35159 EST106763  Lib=305[Rat...   204  0.0037    1
A cbil|dbest|646845 AA033148 mi37b07.r1 5' Lib=437[Mus_mus...   207  0.0043    1
A cbil|dbest|667452 AA051761 mj54d11.r1 5' Lib=437[Mus_mus...   204  0.0044    1
A cbil|dbest|1391557 AA685410 EST107102 5'-end Lib=305[Ratt...   197  0.0088    1
A cbil|dbest|517477 W10035 ma44e07.r1 5' Lib=431[Mus_muscu...   192  0.013     1
A cbil|dbest|515040 W08109 mb39f11.r1 5' Lib=431[Mus_muscu...   181  0.054     1
A cbil|dbest|912624 AA271222 va86c05.r1 5' Lib=598[Mus_mus...   181  0.061     1
A cbil|dbest|879259 AA239915 mx81a10.r1 5' Lib=598[Mus_mus...   181  0.062     1
A cbil|dbest|583863 W75653 me55g06.r1 5' Lib=437[Mus_muscu...   180  0.089     1
A cbil|dbest|700621 AA068712 mm60d08.r1 5' Lib=500[Mus_mus...   172  0.095     1
A cbil|dbest|260068 H00188 yj22h07.s1 3' Lib=271[Homo_sapi...   172  0.11      1
A cbil|dbest|705915 C18911 C18911 5' Lib=507[Homo_sapiens|...   170  0.19      1
A cbil|dbest|705033 C18029 C18029 5' Lib=507[Homo_sapiens|...   170  0.20      1
A cbil|dbest|191250 R21233 yh20d09.r1 5' Lib=271[Homo_sapi...   166  0.21      1
A cbil|dbest|784579 AA146046 mq87f07.r1 5' Lib=497[Mus_mus...   164  0.21      1
A cbil|dbest|244144 R67389 yi35f02.s1 3' Lib=271[Homo_sapi...   163  0.23      1
A cbil|dbest|517675 W10428 ma39b07.r1 5' Lib=431[Mus_muscu...   165  0.25      1
A cbil|dbest|881978 AA242157 my30d01.r1 5' Lib=609[Mus_mus...   164  0.35      1
A cbil|dbest|262935 H03055 yj46e09.s1 3' Lib=271[Homo_sapi...   158  0.40      1
A cbil|dbest|412404 D61436 HUM401G09B 5' Lib=318[Homo_sapi...   154  0.98      1



>cbil|dbest|44106 T18067 0446c3 5' Lib=8[Plasmodium_falciparum|||||] Length=273
            Length = 273

  Plus Strand HSPs:

 Score = 1358 (203.8 bits), Expect = 3.4e-55, P = 3.4e-55
 Identities = 272/273 (99%), Positives = 272/273 (99%), Strand = Plus / Plus

Query:     1 GTTGACGCTGTATATGAAGATGATAAAGTCATCGCATTTAATGATATATACCCACAAGCA 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 GTTGACGCTGTATATGAAGATGATAAAGTCATCGCATTTAATGATATATACCCACAAGCA 60

Query:    61 CCAGTACATATTATAGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCA 120
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct:    61 CCAGTACATATTATAGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCA 120

Query:   121 GAAGAAAAACATAAAGAAATTTTAGGACATTTAATGTGGGCTGTTGCTGAAATTGTAAGA 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GAAGAAAAACATAAAGAAATTTTAGGACATTTAATGTGGGCTGTTGCTGAAATTGTAAGA 180

Query:   181 AAAAACAACCTAGGAGATTTCCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCC 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 AAAAACAACCTAGGAGATTTCCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCC 240

Query:   241 ATATACTATTTACATTTACATATATTAGCCAAG 273
             |||||||||||||||||||||||||||||||||
Sbjct:   241 ATATACTATTTACATTTACATATATTAGCCAAG 273


>cbil|dbest|1200796 C22425 C22425 
            Lib=961[Oryza_sativa||callus|||callus] Length=425
            Length = 425

  Plus Strand HSPs:

 Score = 391 (58.7 bits), Expect = 1.0e-11, P = 1.0e-11
 Identities = 153/235 (65%), Positives = 153/235 (65%), Strand = Plus / Plus

Query:    37 TTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAAAAGGAGAGAT 96
             T TA  GATAT  A CCACAAGC CC GT CAT TT TAGTCAT CCAAA A  AGAGAT
Sbjct:    13 TNTAGAGATATTAATCCACAAGCCCCTGTGCATGTTCTAGTCATCCCAAAGATAAGAGAT 72

Query:    97 GGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACATAAAGAAATTTTAGGACATTTAATG 156
             GG  T ACT G CTA  CAAGGC GAA  AA  CAT   GAAATT T GG  AT T  T 
Sbjct:    73 GGGTTGACTGGACTAGACAAGGCTGAACCAAGGCATGTCGAAATTCTGGGCTATCTTCTA 132

Query:   157 TGGGCTGTTGCTGAAATTG--TAAGAAAAAAC--A-ACCTAGGAGATTTCCGATTGGTAG 211
             T  GC G  G   A A TG  T AGAA  AA   A A CT G AG  T CCG  T GT  
Sbjct:   133 TACGCCGC-GAAAATAGTGGCTGAGAAGGAAGGTATAGCT-GAAGGGTACCGTGTCGTCA 190

Query:   212 TTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACATATATTAG 268
             T AACAATGGACCT A G ATGTCAATC  T TA  A  T CA TT CAT TA TAG
Sbjct:   191 TAAACAATGGACCTAAAGGATGTCAATCAGTCTATCACCTGCACTTGCATGTACTAG 247


>cbil|dbest|1200792 C22421 C22421 
            Lib=961[Oryza_sativa||callus|||callus] Length=473
            Length = 473

  Plus Strand HSPs:

 Score = 355 (53.3 bits), Expect = 3.9e-10, P = 3.9e-10
 Identities = 159/257 (61%), Positives = 159/257 (61%), Strand = Plus / Plus

Query:    10 GTATATGAAGATGATAAAGTCATCGCATTTAATGATATATACCCACAAGCACCAGTACAT 69
             GTAT TGA GATGA AA GT  T GC TT A  GA ATA A CC CAAGC CC    CA 
Sbjct:   115 GTATTTGACGATGAGAAGGTTCTGGCTTTCAGAGACATAAATCCTCAAGCTCCGACCCAC 174

Query:    70 ATTATAGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAA 129
             ATT T  TCAT CC AAA  GA  GATGG  T ACT G CTA   AAGGCAGAAGA A  
Sbjct:   175 ATTGTGATCATTCCCAAAGTGAAGGATGGATTAACTGGCCTATCAAAGGCAGAAGAGAGG 234

Query:   130 CATAAAGAAATTTTAGGACATTTAATGTGGGCTGTTGCTGAAATTGTAA-GAAAAAACAA 188
             CAT  AGAAAT  T GG  A  T  T T  G TG     G   TTG AA G A  A   A
Sbjct:   235 CATGTAGAAATACTCGGTTACCTCCTCTATGTTGCCAAAGTTGTTGCAAAGCAGGAGGGA 294

Query:   189 CCT-AGGA-GATTTCCG-ATTGGTAGTTAACAATGGACCTGAG-GCATGTCAATCCATAT 244
             C T A GA G  T CCG ATTG  A T AA  ATGG CC  AG G ATG CAATC  T T
Sbjct:   295 CTTGAAGATGGCTACCGTATTGTCA-TCAATGATGGCCCC-AGTGGATGCCAATCTGTTT 352

Query:   245 ACTATTTACATTTACATAT 263
             AC A  TACAT TACAT T
Sbjct:   353 ACCACATACATGTACATCT 371


>cbil|dbest|924610 AA283518 SW3ICA2642SK 5' Lib=282[Brugia_malayi|||||]
            Length=433
            Length = 433

  Plus Strand HSPs:

 Score = 312 (46.8 bits), Expect = 3.7e-08, P = 3.7e-08
 Identities = 160/251 (63%), Positives = 160/251 (63%), Strand = Plus / Plus

Query:    13 TATGAAG-ATGATAAAGTCATCGCATTTAATGATATATAC-CCACAAGCACCAGTACATA 70
             TATG AG ATGATAA GT  T GC TTT ATGATAT TA  CCACAAGCACCAGTACAT 
Sbjct:   105 TATGGAGGATGATAATGTTCTGGCTTTTCATGATAT-TAGTCCACAAGCACCAGTACATT 163

Query:    71 TTATAGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAAC 130
             TT T GT ATACC AA A    A AT G   T CT G C AAG A G C GA GA  A  
Sbjct:   164 TTCTCGTAATACCTAAGAAATCA-ATCGCAATGCT-G-C-AAG-ACGTC-GAGGATCAGG 217

Query:   131 ATAAAGAA-ATTTTAGGACATTTAATGTGGGCTGTTGCTGAAATTGTAAGAAAAAACAAC 189
             A  A GA  AT TTAGG  A  T  TG  GGCTG  GCT AAA  G AAG AAA      
Sbjct:   218 ACGA-GACTATATTAGGGAAGCTGTTGGTGGCTGCAGCTAAAACAGCAAGTAAACTGGGA 276

Query:   190 CTAGGAGATTTCCGATTG-GTAGTTAACAATG--GACCTG-AGGCATGTCAATCCATATA 245
              T G AGAT  C  AT G GTAGTTA CAAT   G    G A G ATGTCA   C T TA
Sbjct:   277 TTGGAAGATGGCT-ATCGAGTAGTTATCAATAATGGGAAGCATGGATGTCAGAGCGTTTA 335

Query:   246 CTATTTACATTTACATAT 263
               AT T CAT T CAT T
Sbjct:   336 TCATCTTCATGTTCATGT 353


>cbil|dbest|1373675 AA668091 SWOv3MCAM02D10SK 5'
            Lib=651[Onchocerca_volvulus|||||molting_L3] Length=564
            Length = 564

  Plus Strand HSPs:

 Score = 271 (40.7 bits), Expect = 2.9e-06, P = 2.9e-06
 Identities = 157/251 (62%), Positives = 157/251 (62%), Strand = Plus / Plus

Query:    13 TATG-AAGATGATAAAGTCATCGCATTTAATGATATATAC-CCACAAGCACCAGTACATA 70
             TATG AAGATGAT A GT  T GC TTT ATGATAT TA  CC CAAGCACCAGTACAT 
Sbjct:   230 TATGGAAGATGATGATGTTCTGGCTTTTCATGATAT-TAGTCCGCAAGCACCAGTACATT 288

Query:    71 TTATAGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAAC 130
             TT T GT ATACC AA A  A A AT G   T CT G C AAG A G C  A GAA  A 
Sbjct:   289 TTTTGGTAATACCCAAGAA-ACAAATCGCAATGCT-G-C-AAG-ACGTCN-A-GAATCAG 341

Query:   131 -ATAAAGAAATTT-TAGGACATTTAAT-GTGGGCTGTTGCTGAAATTGTAAGAAAAAACA 187
              AT AA A  TT  T GGA A  T  T GT G C G  GC  AA   G A G AAA    
Sbjct:   342 GATGAA-ACCTTACTCGGAAAACTGTTAGTAG-CAGCAGCCAAAGCAGCATGTAAATTGG 399

Query:   188 ACCTAGGAGAT--TTC-CGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATAT 244
              C TA  AGAT  TT  CGA T GT  T AACAATGGA    A G ATGTCA     T T
Sbjct:   400 GCTTAAAAGATGGTTATCGAGTAGTTATCAACAATGGAAAGCATGGATGTCAGAGTGTTT 459

Query:   245 ACTATTTACATTTACATAT 263
             A  AT T CAT T CAT T
Sbjct:   460 ATCATCTTCATCTTCATGT 478


>cbil|dbest|688155 AA062288 ml64c06.r1 5'
            Lib=482[Mus_musculus|kidney|kidney|||4_weeks] Length=391
            Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 391

  Plus Strand HSPs:

 Score = 227 (34.1 bits), Expect = 0.00029, P = 0.00029
 Identities = 145/236 (61%), Positives = 145/236 (61%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T GT ATACC AA 
Sbjct:   129 GTCTT-GCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAG 187

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A  AT AAAG   TT TAG
Sbjct:   188 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGATGAAAGTC-TTCTAG 239

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCT-A-G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCT A G G G  T 
Sbjct:   240 GACATTTAATGATTGTTG--GCAAGAAATGTGCTGCAGATCTGGGCCTGAAGCGCGGGTA 297

Query:   201 CCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACA 260
             CCG  TGGT GT AA  A GG  C GA G   G CA TCC T TA  A  T CA  T CA
Sbjct:   298 CCGGATGGTGGTGAATGAAGGTGCAGACGGGGGACAGTCCGTCTATCACATTCAACTCCA 357

Query:   261 TAT 263
             T T
Sbjct:   358 TGT 360


>cbil|dbest|608631 AA000202 mg34g11.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=449
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 449

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00042, P = 0.00042
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   186 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 241

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   242 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 299

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   300 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 351

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   352 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 411

Query:    32 ATGAC 28
             A GAC
Sbjct:   412 A-GAC 415


>cbil|dbest|608911 AA000622 mg35c01.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=442
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 442

  Plus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00043, P = 0.00043
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T GT ATACC AA 
Sbjct:    39 GTCTT-GCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAG 97

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A  AT AAAG   TT TAG
Sbjct:    98 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGATGAAAGTC-TTCTAG 149

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCT-A-G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCT A G G G  T 
Sbjct:   150 GACATTTAATGATTGTTG--GCAAGAAATGTGCTGCAGATCTGGGCCTGAAGCGCGGGTA 207

Query:   201 CCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACA 260
             CCG  TGGT GT AA  A GG  C GA G   G CA TC  T T CTAT  ACATT AC 
Sbjct:   208 CCGGATGGTGGTGAATGAAGGTGCAGACGGGGGACAGTC--TGT-CTATC-ACATTCACC 263

Query:   261 TATAT 265
             T  AT
Sbjct:   264 TCCAT 268


>cbil|dbest|764640 AA126326 zm79g03.s1 3'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=440 Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C
            INHIBITOR. ;
            Length = 440

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00043, P = 0.00043
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   153 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 208

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   209 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 266

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   267 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 318

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   319 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 378

Query:    32 ATGAC 28
             A GAC
Sbjct:   379 A-GAC 382


>cbil|dbest|672439 W07949 mb45f05.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=435
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 435

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00043, P = 0.00043
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   184 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 239

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   240 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 297

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   298 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 349

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   350 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 409

Query:    32 ATGAC 28
             A GAC
Sbjct:   410 A-GAC 413


>cbil|dbest|585761 W76813 me83g06.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=457
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 457

  Plus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00045, P = 0.00045
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T GT ATACC AA 
Sbjct:    47 GTCTT-GCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAG 105

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A  AT AAAG   TT TAG
Sbjct:   106 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGATGAAAGTC-TTCTAG 157

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCT-A-G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCT A G G G  T 
Sbjct:   158 GACATTTAATGATTGTTG--GCAAGAAATGTGCTGCAGATCTGGGCCTGAAGCGCGGGTA 215

Query:   201 CCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACA 260
             CCG  TGGT GT AA  A GG  C GA G   G CA TC  T T CTAT  ACATT AC 
Sbjct:   216 CCGGATGGTGGTGAATGAAGGTGCAGACGGGGGACAGTC--TGT-CTATC-ACATTCACC 271

Query:   261 TATAT 265
             T  AT
Sbjct:   272 TCCAT 276


>cbil|dbest|884981 AA245539 my50a11.r1 5'
            Lib=609[Mus_musculus|pooled|pooled_organs|||7_day] Length=457
            Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 457

  Plus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00045, P = 0.00045
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T GT ATACC AA 
Sbjct:   129 GTCTT-GCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAG 187

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A  AT AAAG   TT TAG
Sbjct:   188 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGATGAAAGTC-TTCTAG 239

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCT-A-G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCT A G G G  T 
Sbjct:   240 GACATTTAATGATTGTTG--GCAAGAAATGTGCTGCAGATCTGGGCCTGAAGCGCGGGTA 297

Query:   201 CCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACA 260
             CCG  TGGT GT AA  A GG  C GA G   G CA TC  T T CTAT  ACATT AC 
Sbjct:   298 CCGGATGGTGGTGAATGAAGGTGCAGACGGGGGACAGTC--TGT-CTATC-ACATTCACC 353

Query:   261 TATAT 265
             T  AT
Sbjct:   354 TCCAT 358


>cbil|dbest|700819 AA068901 mm63f03.r1 5'
            Lib=500[Mus_musculus||carcinoma|||embryonic] Length=419 Author_cmt:
            TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 419

  Plus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00045, P = 0.00045
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T GT ATACC AA 
Sbjct:   131 GTCTT-GCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAG 189

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A  AT AAAG   TT TAG
Sbjct:   190 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGATGAAAGTC-TTCTAG 241

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCT-A-G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCT A G G G  T 
Sbjct:   242 GACATTTAATGATTGTTG--GCAAGAAATGTGCTGCAGATCTGGGCCTGAAGCGCGGGTA 299

Query:   201 CCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACA 260
             CCG  TGGT GT AA  A GG  C GA G   G CA TC  T T CTAT  ACATT AC 
Sbjct:   300 CCGGATGGTGGTGAATGAAGGTGCAGACGGGGGACAGTC--TGT-CTATC-ACATTCACC 355

Query:   261 TATAT 265
             T  AT
Sbjct:   356 TCCAT 360


>cbil|dbest|550261 W42370 mc75h02.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=416
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 416

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00045, P = 0.00045
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   180 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 235

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   236 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 293

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   294 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 345

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   346 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCC 405

Query:    32 ATGAC 28
             A GAC
Sbjct:   406 A-GAC 409


>cbil|dbest|793437 AA154889 mq61g06.r1 5'
            Lib=544[Mus_musculus||Thymus|||4_weeks] Length=459 Author_cmt:
            TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 459

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00046, P = 0.00046
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   190 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 245

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   246 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 303

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   304 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 355

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   356 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 415

Query:    32 ATGAC 28
             A GAC
Sbjct:   416 A-GAC 419


>cbil|dbest|583497 W75262 me54f04.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=464
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 464

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00048, P = 0.00048
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   182 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 237

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   238 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 295

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   296 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 347

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   348 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 407

Query:    32 ATGAC 28
             A GAC
Sbjct:   408 A-GAC 411


>cbil|dbest|1271395 AA592713 vo29c07.r1 5' Lib=909[Mus_musculus|||||8_weeks]
            Length=385 Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C
            INHIBITOR. ;
            Length = 385

  Plus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00049, P = 0.00049
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T GT ATACC AA 
Sbjct:    73 GTCTT-GCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAG 131

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A  AT AAAG   TT TAG
Sbjct:   132 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGATGAAAGTC-TTCTAG 183

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCT-A-G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCT A G G G  T 
Sbjct:   184 GACATTTAATGATTGTTG--GCAAGAAATGTGCTGCAGATCTGGGCCTGAAGCGCGGGTA 241

Query:   201 CCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACA 260
             CCG  TGGT GT AA  A GG  C GA G   G CA TC  T T CTAT  ACATT AC 
Sbjct:   242 CCGGATGGTGGTGAATGAAGGTGCAGACGGGGGACAGTC--TGT-CTATC-ACATTCACC 297

Query:   261 TATAT 265
             T  AT
Sbjct:   298 TCCAT 302


>cbil|dbest|650378 AA034547 mi50g12.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=468
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 468

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00050, P = 0.00050
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   202 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 257

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   258 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 315

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   316 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 367

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   368 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 427

Query:    32 ATGAC 28
             A GAC
Sbjct:   428 A-GAC 431


>cbil|dbest|1028110 AA386780 vb54b12.r1 5'
            Lib=845[Mus_musculus|embryo|embryo|||11.5dpc] Length=470
            Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 470

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00051, P = 0.00051
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   203 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 258

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   259 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 316

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   317 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 368

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   369 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 428

Query:    32 ATGAC 28
             A GAC
Sbjct:   429 A-GAC 432


>cbil|dbest|654587 AA038915 mi96e01.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=478
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 478

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00055, P = 0.00055
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 404

Query:    32 ATGAC 28
             A GAC
Sbjct:   405 A-GAC 408


>cbil|dbest|910559 AA269390 va90e01.r1 5'
            Lib=593[Mus_musculus|whole_fetus|fetus|||12.5dpc_total_fetus]
            Length=480 Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C
            INHIBITOR. ;
            Length = 480

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00056, P = 0.00056
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   178 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 233

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   234 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 291

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   292 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 343

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GG TA AT TCAT AAA GC 
Sbjct:   344 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGTTAAATGTCATGAAAAGCA 403

Query:    32 ATGAC 28
             A GAC
Sbjct:   404 A-GAC 407


>cbil|dbest|1120821 AA476191 vh23g07.r1 5'
            Lib=868[Mus_musculus|mammary_gland|mammary_gland|||4_weeks]
            Length=480 Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C
            INHIBITOR. ;
            Length = 480

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00056, P = 0.00056
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   184 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 239

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   240 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 297

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   298 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 349

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   350 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 409

Query:    32 ATGAC 28
             A GAC
Sbjct:   410 A-GAC 413


>cbil|dbest|570884 W62883 md88e05.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=484
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 484

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00058, P = 0.00058
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 404

Query:    32 ATGAC 28
             A GAC
Sbjct:   405 A-GAC 408


>cbil|dbest|570558 W62502 md69g03.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=485
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 485

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00059, P = 0.00059
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   180 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 235

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   236 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 293

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   294 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 345

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   346 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 405

Query:    32 ATGAC 28
             A GAC
Sbjct:   406 A-GAC 409


>cbil|dbest|877845 AA238509 mx95d10.r1 5' Lib=598[Mus_musculus||Liver|||]
            Length=486 Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C
            INHIBITOR. ;
            Length = 486

  Plus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00059, P = 0.00059
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T GT ATACC AA 
Sbjct:   118 GTCTT-GCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAG 176

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A  AT AAAG   TT TAG
Sbjct:   177 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGATGAAAGTC-TTCTAG 228

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCT-A-G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCT A G G G  T 
Sbjct:   229 GACATTTAATGATTGTTG--GCAAGAAATGTGCTGCAGATCTGGGCCTGAAGCGCGGGTA 286

Query:   201 CCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACA 260
             CCG  TGGT GT AA  A GG  C GA G   G CA TC  T T CTAT  ACATT AC 
Sbjct:   287 CCGGATGGTGGTGAATGAAGGTGCAGACGGGGGACAGTC--TGT-CTATC-ACATTCACC 342

Query:   261 TATAT 265
             T  AT
Sbjct:   343 TCCAT 347


>cbil|dbest|638202 AA024130 mi01e04.r1 5'
            Lib=470[Mus_musculus|placenta|placenta|||adult] Length=491
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 491

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00061, P = 0.00061
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   150 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 205

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   206 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 263

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   264 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 315

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   316 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 375

Query:    32 ATGAC 28
             A GAC
Sbjct:   376 A-GAC 379


>cbil|dbest|1107070 AA462564 vg68a08.r1 5'
            Lib=855[Mus_musculus||heart|||4_weeks] Length=493 Author_cmt:
            TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 493

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00062, P = 0.00062
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 404

Query:    32 ATGAC 28
             A GAC
Sbjct:   405 A-GAC 408


>cbil|dbest|516712 W09448 ma63f05.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=298
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 298

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00063, P = 0.00063
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:    35 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 90

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:    91 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 148

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   149 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 200

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   201 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 260

Query:    32 ATGAC 28
             A GAC
Sbjct:   261 A-GAC 264


>cbil|dbest|763899 AA125095 mp77d02.r1 5'
            Lib=544[Mus_musculus||Thymus|||4_weeks] Length=498 Author_cmt:
            TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 498

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00064, P = 0.00064
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   187 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 242

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   243 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 300

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   301 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 352

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   353 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 412

Query:    32 ATGAC 28
             A GAC
Sbjct:   413 A-GAC 416


>cbil|dbest|650475 AA034879 mi53c01.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=501
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 501

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00066, P = 0.00066
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   163 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 218

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   219 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 276

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   277 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 328

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   329 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 388

Query:    32 ATGAC 28
             A GAC
Sbjct:   389 A-GAC 392


>cbil|dbest|544267 W36905 mb77g12.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=502
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 502

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00066, P = 0.00066
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 404

Query:    32 ATGAC 28
             A GAC
Sbjct:   405 A-GAC 408


>cbil|dbest|570890 W62889 md88g05.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=505
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 505

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00067, P = 0.00067
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 404

Query:    32 ATGAC 28
             A GAC
Sbjct:   405 A-GAC 408


>cbil|dbest|685480 AA059676 mj75c11.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=506
            Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 506

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00068, P = 0.00068
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   180 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 235

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   236 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 293

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   294 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 345

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   346 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 405

Query:    32 ATGAC 28
             A GAC
Sbjct:   406 A-GAC 409


>cbil|dbest|612115 AA002650 mg38g08.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=527
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 527

  Minus Strand HSPs:

 Score = 223 (33.5 bits), Expect = 0.00068, P = 0.00068
 Identities = 147/238 (61%), Positives = 147/238 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   190 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 245

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   246 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 303

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG  T  T  GA  AT T 
Sbjct:   304 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-CAGAGA-TC-TGGGAT-ATATG 357

Query:    91 TCCTTTTTGGTATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCGA 32
              C T TT GGTAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC A
Sbjct:   358 -CTTCTTGGGTATCAC-AGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCAA 415

Query:    31 TGAC 28
              GAC
Sbjct:   416 -GAC 418


>cbil|dbest|553669 W46121 mc78e03.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=512
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 512

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00070, P = 0.00070
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   186 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 241

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   242 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 299

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   300 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 351

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   352 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 411

Query:    32 ATGAC 28
             A GAC
Sbjct:   412 A-GAC 415


>cbil|dbest|561811 W54754 md10g01.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=517
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 517

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00073, P = 0.00072
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 404

Query:    32 ATGAC 28
             A GAC
Sbjct:   405 A-GAC 408


>cbil|dbest|612361 AA003102 mg50d09.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=517
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 517

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00073, P = 0.00072
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 404

Query:    32 ATGAC 28
             A GAC
Sbjct:   405 A-GAC 408


>cbil|dbest|723497 AA087196 mk22f01.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=517
            Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 517

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00073, P = 0.00072
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   176 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 231

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   232 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 289

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   290 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 341

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   342 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 401

Query:    32 ATGAC 28
             A GAC
Sbjct:   402 A-GAC 405


>cbil|dbest|908380 AA267345 mz96d09.r1 5'
            Lib=567[Mus_musculus|lymph_node|lymph_node|||4_weeks] Length=520
            Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 520

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00074, P = 0.00074
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 404

Query:    32 ATGAC 28
             A GAC
Sbjct:   405 A-GAC 408


>cbil|dbest|1379079 AA673479 vp49e09.r1 3'
            Lib=862[Mus_musculus|embryo|embryo|||2-cell] Length=522 Author_cmt:
            TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 522

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00075, P = 0.00075
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   182 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 237

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   238 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 295

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   296 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 347

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   348 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 407

Query:    32 ATGAC 28
             A GAC
Sbjct:   408 A-GAC 411


>cbil|dbest|720091 AA084756 zn13c01.r1 5' Lib=525[Homo_sapiens|||||hNT_neurons]
            Length=443 Author_cmt: TR:G1256265 G1256265 PROTEIN KINASE C
            INHIBITOR. ;
            Length = 443

  Plus Strand HSPs:

 Score = 216 (32.4 bits), Expect = 0.00081, P = 0.00081
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T GT ATACC AA 
Sbjct:   205 GTCTT-GCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAG 263

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A  AT AAAG   TT TAG
Sbjct:   264 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGATGAAAGTC-TTCTAG 315

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCT-A-G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCT A G G G  T 
Sbjct:   316 GACATTTAATGATTGTTG--GCAAGAAATGTGCTGCAGATCTGGGCCTGAAGCGCGGGTA 373

Query:   201 CCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCCATATACTATTTACATTTACA 260
             C GAT GGT GT AA  A GG  C GA G   G CA TC  T T CTAT  ACATT AC 
Sbjct:   374 CGGAT-GGTGGTGAATGAAGGTGCAGACGGGGGACAGTC--TGT-CTATC-ACATTCACC 428

Query:   261 TATAT 265
             T  AT
Sbjct:   429 TCCAT 433


>cbil|dbest|542914 W35054 mc40c07.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=419
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 419

  Minus Strand HSPs:

 Score = 216 (32.4 bits), Expect = 0.00084, P = 0.00084
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   179 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 234

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   235 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 292

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   293 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 344

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   345 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGA-ATGTCATGAAAAGCA 403

Query:    32 ATGAC 28
             A GAC
Sbjct:   404 A-GAC 407


>cbil|dbest|673735 W85446 mf45d10.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=548
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 548

  Minus Strand HSPs:

 Score = 222 (33.3 bits), Expect = 0.00084, P = 0.00084
 Identities = 148/238 (62%), Positives = 148/238 (62%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   213 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 268

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   269 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 326

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   327 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 378

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   379 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 438

Query:    32 ATGAC 28
             A GAC
Sbjct:   439 A-GAC 442


>cbil|dbest|675606 W84042 mf25c03.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=526
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 526

  Minus Strand HSPs:

 Score = 220 (33.0 bits), Expect = 0.00096, P = 0.00096
 Identities = 146/238 (61%), Positives = 146/238 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   215 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 270

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   271 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 328

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T     A  CT G A  A  AT  C
Sbjct:   329 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TACAGAAATCTGGGAT-AT-ATG-C 383

Query:    91 TCCTTTTTGGTATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCGA 32
             T CTT   GGTAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC A
Sbjct:   384 TTCTTGG-GGTATCAC-AGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCAA 441

Query:    31 TGAC 28
              GAC
Sbjct:   442 -GAC 444


>cbil|dbest|573290 W65101 me06b08.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=429
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 429

  Minus Strand HSPs:

 Score = 213 (32.0 bits), Expect = 0.0011, P = 0.0011
 Identities = 147/238 (61%), Positives = 147/238 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   184 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 239

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   240 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 297

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   298 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 349

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT  AA GC 
Sbjct:   350 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGGAAAGCA 409

Query:    32 ATGAC 28
             A GAC
Sbjct:   410 A-GAC 413


>cbil|dbest|527815 W20760 mb91b06.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=471
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 471

  Minus Strand HSPs:

 Score = 214 (32.1 bits), Expect = 0.0014, P = 0.0014
 Identities = 146/238 (61%), Positives = 146/238 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   176 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 231

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   232 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 289

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  A   T GT  GA  AT T 
Sbjct:   290 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-CAGAAA-T-GTGGGAT-ATATG 343

Query:    91 TCCTTTTTGGTATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCGA 32
              C T TT GGTAT  C A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC A
Sbjct:   344 -CTTCTTGGGTATCCC-AGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCAA 401

Query:    31 TGAC 28
              GAC
Sbjct:   402 -GAC 404


>cbil|dbest|550237 W42346 mc75d05.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=407
            Author_cmt: SW:YHIT_SYNP7 P32084 HYPOTHETICAL 12.4 KD HIT-LIKE
            PROTEIN IN PSBAII 5'REGION ;
            Length = 407

  Minus Strand HSPs:

 Score = 211 (31.7 bits), Expect = 0.0015, P = 0.0014
 Identities = 141/232 (60%), Positives = 141/232 (60%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A  GA TG C   C TC G  CC T  TT AC ACCA
Sbjct:   182 ATGGAGGTGAATGTGA-TAG-ACA--GACTGTCCCCCGTCTGCACCTTCATTCACCACCA 237

Query:   205 ATCGGAAATCTC-CT--AGGTT--GTTTTTTCTTACAATTTCAGCAACAGCCCACATTAA 151
               CGG A  C   CT  AGG    G TTTT C   CA TTT      CA C   CATTAA
Sbjct:   238 TCCGGTACCCGGGCTTTAGGGCCAGATTTTGCAG-CACTTTTCTTGCCAACAATCATTAA 296

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG  T  T  GA  AT T 
Sbjct:   297 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAATTCTGGGAT-ATATG 350

Query:    91 TCCTTTTTGGTATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGC 34
              C T TT GGTAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT  AA GC
Sbjct:   351 -CTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGGAAAGC 407


>cbil|dbest|1392384 AA686237 EST109600 5'-end Lib=304[Rattus_sp.|||||]
            Length=285 Author_cmt: Protein kinase C inhibitor 1
            Length = 285

  Plus Strand HSPs:

 Score = 210 (31.5 bits), Expect = 0.0023, P = 0.0023
 Identities = 102/158 (64%), Positives = 102/158 (64%), Strand = Plus / Plus

Query:    16 GAAGATGATAAA-GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTAT 74
             GA GA GAT    GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T
Sbjct:   125 GAGGACGATCGGTGTCTT-GCTTTTNATGACATTTCCCCTCAAGCACCAACACACTTTCT 183

Query:    75 AGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACATAA 134
              GT ATACC AA A G  A AT  TC   C AG  T      GGCAGA GA  A  AT A
Sbjct:   184 GGTGATACCCAAGAAGC-ACATA-TCC--C-AGATTTNTNT-GGCAGATGATGATGATGA 237

Query:   135 AGAAATTT-TAGGACATTTAATGTGGGCTGTTGCT-GAAAT 173
             A A  TTT TAGGACATTTAATG   G T T GC  GAAAT
Sbjct:   238 A-AGTTTTCTAGGACATTTAATGATTGTT-TGGCAAGAAAT 276


>cbil|dbest|515346 W08208 mb49c12.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=527
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 527

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0034, P = 0.0034
 Identities = 147/238 (61%), Positives = 147/238 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   187 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 242

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   243 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 300

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   301 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 352

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GGG A AT TCAT A A GC 
Sbjct:   353 TGCTTCTTGGGTATCAC-AGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGANAAGCA 411

Query:    32 ATGAC 28
             A GAC
Sbjct:   412 A-GAC 415


>cbil|dbest|584971 W77038 me51a12.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=489
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 489

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0036, P = 0.0036
 Identities = 147/238 (61%), Positives = 147/238 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   227 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 282

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   283 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 340

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   341 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 392

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT  C A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   393 TGCTTCTTGGGTATCCC-AGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 451

Query:    32 ATGAC 28
             A GAC
Sbjct:   452 A-GAC 455


>cbil|dbest|295783 H35159 EST106763  Lib=305[Rattus_sp.|||||]
            Length=333 Author_cmt: Protein kinase C inhibitor 1
            Length = 333

  Plus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0037, P = 0.0037
 Identities = 92/141 (65%), Positives = 92/141 (65%), Strand = Plus / Plus

Query:    16 GAAGATGATAAA-GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTAT 74
             GA GA GAT    GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T
Sbjct:   158 GAGGACGATCGGTGTCTT-GCTTTTNATGACATTTCCCCTCAAGCACCAACACACTTTCT 216

Query:    75 AGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-A 133
              GT ATACC AA A G  A AT  TC   C AG  T      GGCAGA GA  A  AT A
Sbjct:   217 GGTGATACCCAAGAAGC-ACATA-TCC--C-AGATTTCTNT-GGCAGATGATGATGATGA 270

Query:   134 AAGAAATTTTAGGACATTTAATG 156
             AAG   TT TAGGACATTTAATG
Sbjct:   271 AAGTN-TTCTAGGACATTTAATG 292


>cbil|dbest|646845 AA033148 mi37b07.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=527
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 527

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0043, P = 0.0043
 Identities = 147/238 (61%), Positives = 147/238 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   218 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 273

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   274 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 331

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   332 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 383

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT  C A AA  TGT  TGGTGCTTG GGG A AT TCAT AAA GC 
Sbjct:   384 TGCTTCTTGGGTATCCC-AGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGAAAAGCA 442

Query:    32 ATGAC 28
             A GAC
Sbjct:   443 A-GAC 446


>cbil|dbest|667452 AA051761 mj54d11.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=466
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 466

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0044, P = 0.0044
 Identities = 146/238 (61%), Positives = 146/238 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   173 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 228

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   229 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 286

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   287 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 338

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG GG  A AT TCAT  AA GC 
Sbjct:   339 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTGAGGCGAAATGTCATGGAAAGCA 398

Query:    32 ATGAC 28
             A GAC
Sbjct:   399 A-GAC 402


>cbil|dbest|1391557 AA685410 EST107102 5'-end Lib=305[Rattus_sp.|||||]
            Length=287 Author_cmt: Protein kinase C inhibitor 1
            Length = 287

  Plus Strand HSPs:

 Score = 197 (29.6 bits), Expect = 0.0088, P = 0.0088
 Identities = 93/141 (65%), Positives = 93/141 (65%), Strand = Plus / Plus

Query:    16 GAAGATGATAAA-GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTAT 74
             GA GA GAT    GTC T GC TTT ATGA AT T CCC CAAGCACCA  ACA  TT T
Sbjct:   153 GAGGACGATCGGTGTCTT-GCTTTTNATGACATTTCCCCTCAAGCACCAACACACTTTCT 211

Query:    75 AGTCATACCAAA-AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACATA 133
              GT ATACC AA AAG A A AT   C  A T   CT  G    GCAGA GA  A  AT 
Sbjct:   212 GGTGATACCCAAGAAGCACATATCC-CANATT--TCTNTG----GCAGATGATGATGATG 264

Query:   134 AAGAAATTT-TAGGACATTTAATG 156
             AA A  TTT TAGGACATTTAATG
Sbjct:   265 AA-AGTTTTCTAGGACATTTAATG 287


>cbil|dbest|517477 W10035 ma44e07.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=421
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 421

  Minus Strand HSPs:

 Score = 192 (28.8 bits), Expect = 0.013, P = 0.013
 Identities = 142/238 (59%), Positives = 142/238 (59%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TA  A A G  TTG C   C TC G  C  T  TT AC ACCA
Sbjct:   184 ATGGAAGTGAATGTGATTAACA-A-GC-TTGTCCCCCGTCTGCACTTTCATTCACCACCA 240

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   241 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 298

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T     A  CT G  A A  AT  C
Sbjct:   299 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TACAGAAATCTGGGGATAT-ATG-C 354

Query:    91 TCCTTTTTGGTATGACTATAATATGTACTGG-TGCTTGTGGGTATATATCATTAAATGCG 33
             T CTT   GGTAT AC A  A  TGT  TGG TGCTTG  GG A AT TCATT AA GC 
Sbjct:   355 TTCTTGG-GGTATCACCAGGAAGTGTGGTGGGTGCTTGAAGGGAAATGTCATTGAAAGCA 413

Query:    32 ATGAC 28
             A GAC
Sbjct:   414 A-GAC 417


>cbil|dbest|515040 W08109 mb39f11.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=434
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 434

  Plus Strand HSPs:

 Score = 181 (27.2 bits), Expect = 0.056, P = 0.054
 Identities = 153/262 (58%), Positives = 153/262 (58%), Strand = Plus / Plus

Query:     1 GTTGACGCTGTATATGAAGATGATAAAGT-CATCGCATTTAATGATATATACCCACAAGC 59
             G TGAC  T TATATGAAGAT A  A GT C T G  TT   TGA  TA   CC CA GC
Sbjct:   162 GCTGACATTCTATATGAAGATCAGCA-GTGCCTTGTGTTCCGTGACGTAGCTCCTCAGGC 220

Query:    60 ACCAGTACATATTATAGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGC 119
              CC GT CA  TT T GTCAT CC A   GGA AG    T  T CT G  T AGC AGGC
Sbjct:   221 TCCTGTGCACTTTCTGGTCATTCCTA---GGA-AGCCCAT--TCCTCGAATTAGCCAGGC 274

Query:   120 AGAAGAAAAACATAAAGAAATTTTAGGACATTTAATGTGGGCTGTTGCTGAA-ATTGTA- 177
              GAAGA  A  A  A  A  TT TAGGACA TTA T    G TG     GAA AT G A 
Sbjct:   275 TGAAGAGGACGACCAGCAGCTTCTAGGACACTTACTCCTTG-TGGCCAAGAAGATAGCAC 333

Query:   178 AGAAAAAACAACCTAG-GA-GATTTCCGATTGGTAGTTAACAATGG-ACC-TGAG-GCAT 232
             AG    A    C  A  GA G  T  CGA T GT GTTAA  ATGG A   TG G GCA 
Sbjct:   334 AGGCCCAGGGTCTGAAAGATGGGTATCGACTTGTGGTTAATGATGGCAAGATGGGCGCAC 393

Query:   233 -GTCAATCCATATACTATTTACATTTACATA 262
              GTC  T  AT  AC  T  ACATT AC TA
Sbjct:   394 AGTCTGTGTATC-ACC-TGCACATTCACGTA 422


>cbil|dbest|912624 AA271222 va86c05.r1 5' Lib=598[Mus_musculus||Liver|||]
            Length=456 Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C
            INHIBITOR 1 ;
            Length = 456

  Plus Strand HSPs:

 Score = 181 (27.2 bits), Expect = 0.063, P = 0.061
 Identities = 153/262 (58%), Positives = 153/262 (58%), Strand = Plus / Plus

Query:     1 GTTGACGCTGTATATGAAGATGATAAAGT-CATCGCATTTAATGATATATACCCACAAGC 59
             G TGAC  T TATATGAAGAT A  A GT C T G  TT   TGA  TA   CC CA GC
Sbjct:    69 GCTGACATTCTATATGAAGATCAGCA-GTGCCTTGTGTTCCGTGACGTAGCTCCTCAGGC 127

Query:    60 ACCAGTACATATTATAGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGC 119
              CC GT CA  TT T GTCAT CC A   GGA AG    T  T CT G  T AGC AGGC
Sbjct:   128 TCCTGTGCACTTTCTGGTCATTCCTA---GGA-AGCCCAT--TCCTCGAATTAGCCAGGC 181

Query:   120 AGAAGAAAAACATAAAGAAATTTTAGGACATTTAATGTGGGCTGTTGCTGAA-ATTGTA- 177
              GAAGA  A  A  A  A  TT TAGGACA TTA T    G TG     GAA AT G A 
Sbjct:   182 TGAAGAGGACGACCAGCAGCTTCTAGGACACTTACTCCTTG-TGGCCAAGAAGATAGCAC 240

Query:   178 AGAAAAAACAACCTAG-GA-GATTTCCGATTGGTAGTTAACAATGG-ACC-TGAG-GCAT 232
             AG    A    C  A  GA G  T  CGA T GT GTTAA  ATGG A   TG G GCA 
Sbjct:   241 AGGCCCAGGGTCTGAAAGATGGGTATCGACTTGTGGTTAATGATGGCAAGATGGGCGCAC 300

Query:   233 -GTCAATCCATATACTATTTACATTTACATA 262
              GTC  T  AT  AC  T  ACATT AC TA
Sbjct:   301 AGTCTGTGTATC-ACC-TGCACATTCACGTA 329


>cbil|dbest|879259 AA239915 mx81a10.r1 5' Lib=598[Mus_musculus||Liver|||]
            Length=458 Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C
            INHIBITOR 1 ;
            Length = 458

  Plus Strand HSPs:

 Score = 181 (27.2 bits), Expect = 0.063, P = 0.062
 Identities = 153/262 (58%), Positives = 153/262 (58%), Strand = Plus / Plus

Query:     1 GTTGACGCTGTATATGAAGATGATAAAGT-CATCGCATTTAATGATATATACCCACAAGC 59
             G TGAC  T TATATGAAGAT A  A GT C T G  TT   TGA  TA   CC CA GC
Sbjct:   151 GCTGACATTCTATATGAAGATCAGCA-GTGCCTTGTGTTCCGTGACGTAGCTCCTCAGGC 209

Query:    60 ACCAGTACATATTATAGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGC 119
              CC GT CA  TT T GTCAT CC A   GGA AG    T  T CT G  T AGC AGGC
Sbjct:   210 TCCTGTGCACTTTCTGGTCATTCCTA---GGA-AGCCCAT--TCCTCGAATTAGCCAGGC 263

Query:   120 AGAAGAAAAACATAAAGAAATTTTAGGACATTTAATGTGGGCTGTTGCTGAA-ATTGTA- 177
              GAAGA  A  A  A  A  TT TAGGACA TTA T    G TG     GAA AT G A 
Sbjct:   264 TGAAGAGGACGACCAGCAGCTTCTAGGACACTTACTCCTTG-TGGCCAAGAAGATAGCAC 322

Query:   178 AGAAAAAACAACCTAG-GA-GATTTCCGATTGGTAGTTAACAATGG-ACC-TGAG-GCAT 232
             AG    A    C  A  GA G  T  CGA T GT GTTAA  ATGG A   TG G GCA 
Sbjct:   323 AGGCCCAGGGTCTGAAAGATGGGTATCGACTTGTGGTTAATGATGGCAAGATGGGCGCAC 382

Query:   233 -GTCAATCCATATACTATTTACATTTACATA 262
              GTC  T  AT  AC  T  ACATT AC TA
Sbjct:   383 AGTCTGTGTATC-ACC-TGCACATTCACGTA 411


>cbil|dbest|583863 W75653 me55g06.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=534
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 534

  Minus Strand HSPs:

 Score = 180 (27.0 bits), Expect = 0.093, P = 0.089
 Identities = 86/129 (66%), Positives = 86/129 (66%), Strand = Minus / Plus

Query:   156 CATTAAATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGAC 98
             CATTAAATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G  
Sbjct:   347 CATTAAATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG 399

Query:    97 CATCTCTCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTGTGGGTATATATCATTA 39
              AT T T CTT TTGG TAT  C A AA  TGT  TGGTGCTTG GGG A AT TCAT A
Sbjct:   400 -ATATATGCTTCTTGGGTATCCC-AGAAAGTGTGTTGGTGCTTGAGGGGAAATGTCATGA 457

Query:    38 AATGCGATGAC 28
             AA GC A GAC
Sbjct:   458 AAAGCAA-GAC 467


>cbil|dbest|700621 AA068712 mm60d08.r1 5'
            Lib=500[Mus_musculus||carcinoma|||embryonic] Length=340 Author_cmt:
            TR:G1256265 G1256265 PROTEIN KINASE C INHIBITOR. ;
            Length = 340

  Plus Strand HSPs:

 Score = 172 (25.8 bits), Expect = 0.10, P = 0.095
 Identities = 132/218 (60%), Positives = 132/218 (60%), Strand = Plus / Plus

Query:    28 GTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCATACCAAA- 86
             GTC T GC TTT ATGA AT T CCC CA GCACCA  ACA  T  T GT ATACC A  
Sbjct:    75 GTCTT-GCTTTTCATGACATTTCCCCTCAGGCACCAAGACACTTCCTGGTGATACCCAGG 133

Query:    87 AAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACAT-AAAGAAATTTTAG 145
             AAG A A AT   C  A T   CT  G A  GCAGA GA  A   T AAAG   TT TAG
Sbjct:   134 AAGCATATATCC-CAGATT--TCT--GTA--GCAGATGATGATGTTGAAAGTC-TTCTAG 185

Query:   146 GACATTTAATGTGGGCTGTTGCT-GAAAT-TGTAAGAAAAAACAACCTA--G-GAGATTT 200
             GACATTTAATG   G TG  GC  GAAAT TG    A A      CCTA  G G G  T 
Sbjct:   186 GACATTTAATGATTG-TGG-GCAAGAAATGTGCTGCAGATCTGGGCCTAAAGCGCGGGTA 243

Query:   201 CCGATTGGTAGTTAACAATGGACCT-GAGGCATGTCAATCCATATA 245
             CCG  TGGT GT AA AA GG  C  GA G   G CA TC  T TA
Sbjct:   244 CCGGATGGTGGTGAATAAAGGTGCAAGACGGGGGACAGTCTGTCTA 289


>cbil|dbest|260068 H00188 yj22h07.s1 3'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=299
            Length = 299

  Plus Strand HSPs:

 Score = 172 (25.8 bits), Expect = 0.11, P = 0.11
 Identities = 104/169 (61%), Positives = 104/169 (61%), Strand = Plus / Plus

Query:   111 AAGCAAGGCAGAAGAAAAACATAAAGAAATTTT-AGGA-CATTTAATGTGGGCTGTTGCT 168
             AA  AA  CA  AGAA A  ATAAA A AT  T A  A CA    ATGT  G  GT   T
Sbjct:   121 AACAAATCCATGAGAACAGGATAAAAATATCATGAACAGCAAAATATGTCTGA-GTATTT 179

Query:   169 GAAATTGTA-AGAAAAAACAACCTAG--GAG--ATT-TCCGATTGGTAGTTAACAATGGA 222
              AAA TGTA AGAAAAAA AA  TAG  GA   ATT T   A T   A TTAA AA G A
Sbjct:   180 AAAACTGTATAGAAAAAATAAATTAGATGANCAATTGTGTAAATATAAATTAAAAAAG-A 238

Query:   223 CCTGAGGCATG-TCAATCCA-TATACTATTTACATTTACATATATTAGCCAA 272
                 A  C T  T AAT  A T TACTATTTACATTT  ATATATT GCCAA
Sbjct:   239 TGACATTCTTAATAAATAAAGTTTACTATTTACATTTTTATATATT-GCCAA 289


>cbil|dbest|705915 C18911 C18911 5' Lib=507[Homo_sapiens||placenta|||]
            Length=440
            Length = 440

  Minus Strand HSPs:

 Score = 170 (25.5 bits), Expect = 0.21, P = 0.19
 Identities = 104/169 (61%), Positives = 104/169 (61%), Strand = Minus / Plus

Query:   272 TTGGCTAATATATGTAAATGTAAATAGTATA-TGGATTGAC-ATGCCTCAGGTCCATTGT 215
             TTGGC AATATAT  AAATGTAAATAGTA A T  ATT A  A G  T    TC  TT T
Sbjct:   149 TTGGC-AATATATAAAAATGTAAATAGTAAACTTTATTTATTAAGAATGTCATCTTTT-T 206

Query:   214 TAACTACCAATCGGA-AATC-T-C--CTAGGTTGTTTTTTCT-TACAATTTCAGCAACAG 161
             TAA T   A T   A AAT  T C  CTA  TT TTTTTTCT TACA TTT A   AC  
Sbjct:   207 TAATTTATATTTACACAATTGTTCATCTAATTTATTTTTTCTATACAGTTTTAAATACT- 265

Query:   160 CCCACATTAAATG-TCCTAAA-ATTTCTTTATGTTTTTCTTCTGCCTTGCTT 111
             C  ACAT    TG T  T A  AT T TTTAT  T TTCT  TG  TT  TT
Sbjct:   266 CAGACATATTTTGCTGTTCATGATATTTTTATCCTGTTCTCATGGATTTGTT 317


>cbil|dbest|705033 C18029 C18029 5' Lib=507[Homo_sapiens||placenta|||]
            Length=456
            Length = 456

  Minus Strand HSPs:

 Score = 170 (25.5 bits), Expect = 0.22, P = 0.20
 Identities = 104/169 (61%), Positives = 104/169 (61%), Strand = Minus / Plus

Query:   272 TTGGCTAATATATGTAAATGTAAATAGTATA-TGGATTGAC-ATGCCTCAGGTCCATTGT 215
             TTGGC AATATAT  AAATGTAAATAGTA A T  ATT A  A G  T    TC  TT T
Sbjct:   149 TTGGC-AATATATAAAAATGTAAATAGTAAACTTTATTTATTAAGAATGTCATCTTTT-T 206

Query:   214 TAACTACCAATCGGA-AATC-T-C--CTAGGTTGTTTTTTCT-TACAATTTCAGCAACAG 161
             TAA T   A T   A AAT  T C  CTA  TT TTTTTTCT TACA TTT A   AC  
Sbjct:   207 TAATTTATATTTACACAATTGTTCATCTAATTTATTTTTTCTATACAGTTTTAAATACT- 265

Query:   160 CCCACATTAAATG-TCCTAAA-ATTTCTTTATGTTTTTCTTCTGCCTTGCTT 111
             C  ACAT    TG T  T A  AT T TTTAT  T TTCT  TG  TT  TT
Sbjct:   266 CAGACATATTTTGCTGTTCATGATATTTTTATCCTGTTCTCATGGATTTGTT 317


>cbil|dbest|191250 R21233 yh20d09.r1 5'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=267
            Length = 267

  Minus Strand HSPs:

 Score = 166 (24.9 bits), Expect = 0.24, P = 0.21
 Identities = 100/161 (62%), Positives = 100/161 (62%), Strand = Minus / Plus

Query:   272 TTGGCTAATATATGTAAATGTAAATAGTATA-TGGATTGAC-ATGCCTCAGGTCCATTGT 215
             TTGGC AATATAT  AAATGTAAATAGTA A T  ATT A  A G  T    TC  TT T
Sbjct:     9 TTGGC-AATATATAAAAATGTAAATAGTAAACTTTATTTATTAAGAATGTCATCTTTT-T 66

Query:   214 TAACTACCAATCGGA-AATC-T-C--CTAGGTTGTTTTTTCT-TACAATTTCAGCAACAG 161
             TAA T   A T   A AAT  T C  CTA  TT TTTTTTCT TACA TTT A   AC  
Sbjct:    67 TAATTTATATTTACACAATTGTTCATCTAATTTATTTTTTCTATACAGTTTTAAATACT- 125

Query:   160 CCCACATTAAATG-TCCTAAA-ATTTCTTTATGTTTTTCTTCTG 119
             C  ACAT    TG T  T A  AT T TTTAT  T TTCT  TG
Sbjct:   126 CAGACATATTTTGCTGTTCATGATATTTTTATCCTGTTCTCATG 169


>cbil|dbest|784579 AA146046 mq87f07.r1 5'
            Lib=497[Mus_musculus|skin|melanoma|||M2_cells] Length=325
            Author_cmt: SW:NOP3_YEAST Q01560 NUCLEOLAR PROTEIN 3 ;
            Length = 325

  Plus Strand HSPs:

 Score = 164 (24.6 bits), Expect = 0.24, P = 0.21
 Identities = 102/170 (60%), Positives = 102/170 (60%), Strand = Plus / Plus

Query:    75 AGTCATACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACATAA 134
             AGT AT  CAAA    A AG TG T TT  TA  C AA C  G CA  A    AACA AA
Sbjct:    96 AGTTATGGCAAAGGTAAAAG-TGCTGTTTGTACGC-AACCTTGCCAACACGGTAACAGAA 153

Query:   135 AGAAATTTTAGGACATTTAATGTGGGCTGTTGCTGAAATTGTAA-GAAAAAACAACCTAG 193
              GAAATTTTAG A A T A T T G C GTT   GAAA TG AA GA  AAA AA CTA 
Sbjct:   154 -GAAATTTTAGAAAAGTCATT-TAGTCAGTTTGGGAAACTGGAACGAGTAAAGAAGCTAA 211

Query:   194 GAGATT-TCCGATTGGT-AGTTA-ACAATGGACCTGAGGCATGTCAATCCATAT 244
              AGATT T C  T   T A TT  A  A  GA  TG  GC TGTCAA  C TAT
Sbjct:   212 AAGATTATGCTTTCATTCATTTTGATGAGAGAGATGGTGC-TGTCAAGGC-TAT 263


>cbil|dbest|244144 R67389 yi35f02.s1 3'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=339
            Length = 339

  Plus Strand HSPs:

 Score = 163 (24.5 bits), Expect = 0.26, P = 0.23
 Identities = 103/169 (60%), Positives = 103/169 (60%), Strand = Plus / Plus

Query:   111 AAGCAAGGCAGAAGAAAAACATAAAGAAATTTT-AGGA-CATTTAATGTGGGCTGTTGCT 168
             AA  AA  CA  AGAA A  ATAAA A AT  T A  A CA    ATGT  G  GT   T
Sbjct:   135 AACAAATCCATGAGAACAGGATAAAAATATCATGAACAGCAAAATATGTCTGA-GTATTT 193

Query:   169 GAAATTGTA-AGAAAAAACAACCTAG--GAG--ATT-TCCGATTGGTAGTTAACAATGGA 222
              AAA TGTA AGAAAAAA AA  TAG  GA   ATT T   A T   A TTAA AA G A
Sbjct:   194 AAAACTGTATAGAAAAAATAAATTAGATGAACAATTGTGTAAATATAAATTAAAAAAG-A 252

Query:   223 CCTGAGGCATG-TCAATCCA-TATACTATTTACATTTACATATATTAGCCAA 272
                 A  C T  T AAT    T TACTATTTACATTT  ATATATT GCCAA
Sbjct:   253 TGACATTCTTAATAAATAANGTTTACTATTTACATTTTTATATATT-GCCAA 303


>cbil|dbest|517675 W10428 ma39b07.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=390
            Author_cmt: SW:IPK1_BOVIN P16436 PROTEIN KINASE C INHIBITOR 1 ;
            Length = 390

  Minus Strand HSPs:

 Score = 165 (24.8 bits), Expect = 0.28, P = 0.25
 Identities = 129/211 (61%), Positives = 129/211 (61%), Strand = Minus / Plus

Query:   265 ATATATGTAAATGTAAATAGTATATGGATTGACATGCCTCAGGTCCATTGTTAACTACCA 206
             AT  A GT AATGT A TAG A A G A TG C   C TC G  CC T  TT AC ACCA
Sbjct:   187 ATGGAGGTGAATGTGA-TAG-ACA-G-ACTGTCCCCCGTCTGCACCTTCATTCACCACCA 242

Query:   205 ATCGGAAATCTC-CT--AGGTTGTTTTTTCTTACA-ATTTCA-GCAACAGCCCACATTAA 151
               CGG A  C C CT  AGG      T T    CA ATTTC  GC A A C   CATTAA
Sbjct:   243 TCCGGTACCCGCGCTTCAGGCCCAGATCTGCAGCACATTTCTTGCCA-A-CAATCATTAA 300

Query:   150 ATGTCCTAAAATTTCTTT-ATGTTTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTC 92
             ATGTCCTA AA   CTTT AT  T  TC TCTGC T  C  AG   A T  G   AT T 
Sbjct:   301 ATGTCCTAGAAGA-CTTTCATCATCATCATCTGC-TA-C--AGAA-A-TCTGGG-ATATA 352

Query:    91 TCCTTTTTGG-TATGACTATAATATGTACTGGTGCTTG 55
             T CTT TTGG TAT AC A AA  TGT  TGGTGCTTG
Sbjct:   353 TGCTTCTTGGGTATCACCAGAAAGTGTGTTGGTGCTTG 390


>cbil|dbest|881978 AA242157 my30d01.r1 5'
            Lib=609[Mus_musculus|pooled|pooled_organs|||7_day] Length=448
            Author_cmt: SW:NOP3_YEAST Q01560 NUCLEOLAR PROTEIN 3 ;
            Length = 448

  Minus Strand HSPs:

 Score = 164 (24.6 bits), Expect = 0.43, P = 0.35
 Identities = 102/170 (60%), Positives = 102/170 (60%), Strand = Minus / Plus

Query:   244 ATATGGATTGACATGCCTCAGGTCCATTGTTAAC-T-ACCAATCGGA-AATCTCCTAGGT 188
             ATA G  TTGACA GC  CA  TC  T  T AA  T A   A  G A AATCT  TAG T
Sbjct:    69 ATA-GCCTTGACA-GCACCATCTCTCTCATCAAAATGAATGAAAGCATAATCTTTTAGCT 126

Query:   187 TGTTTTTTC-TTACAATTTCAGCAACAGCCCACATTAAATGTCCTAAAATTTCTTTATGT 129
             T TTT  TC TT CA TTTC   AAC G C A AT A  T TC TAAAATTTCTT  TGT
Sbjct:   127 TCTTTACTCGTTCCAGTTTCCCAAACTGACTAAATGACTTTTC-TAAAATTTCTTC-TGT 184

Query:   128 TTTTCTTCTGCCTTGCTTAGNCTAGTAAGACCATCTCTCCTTTTTGGTATGACT 75
             T    T  TG C  G TT G  TA  AA A CA  T T C TTT G  AT ACT
Sbjct:   185 TACCGTGTTGGCAAGGTT-GCGTACAAACAGCACTTTTACCTTT-GCCATAACT 236


>cbil|dbest|262935 H03055 yj46e09.s1 3'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=285
            Length = 285

  Plus Strand HSPs:

 Score = 158 (23.7 bits), Expect = 0.51, P = 0.40
 Identities = 102/168 (60%), Positives = 102/168 (60%), Strand = Plus / Plus

Query:   111 AAGCAAGGCAGAAGAAAAACATAAAGAAATTTT-AGGA-CATTTAATGTGGGCTGTTGCT 168
             AA  AA  CA  AGAA A  ATAAA A AT  T A  A CA    ATGT  G  GT   T
Sbjct:   118 AACAAATCCATGAGAACAGGATAAAAATATCATGAACAGCAAAATATGTCTGA-GTATTT 176

Query:   169 GAAATTGTA-AGAAAAAACAACCTAG--GAG--ATT-TCCGATTGGTAGTTAACAATGGA 222
              AAA TGTA AGAAAAAA AA  TAG  GA   ATT T   A T   A TTAA AA G A
Sbjct:   177 AAAACTGTATAGAAAAAATAAATTAGATGAACAATTGTGTAAATATAAATTAAAAAAG-A 235

Query:   223 CCTGAGGCATG-TCAATCCA-TATACTATTTACATTTACATATATTAGCCA 271
                 A  C T  T AAT    T TACTATTTACATTT  ATATATT GCCA
Sbjct:   236 TGACATTCTTAATAAATAANGTTTACTATTTACATTTTTATATATT-GCCA 285


>cbil|dbest|412404 D61436 HUM401G09B 5' Lib=318[Homo_sapiens|||||] Length=345
            Length = 345

  Minus Strand HSPs:

 Score = 154 (23.1 bits), Expect = 3.8, P = 0.98
 Identities = 80/127 (62%), Positives = 80/127 (62%), Strand = Minus / Plus

Query:   139 TTTCTTTATGTTTTTCTTCTGCCTTGCTTAGN-CTAGTAAGACCATCTCTCCTTTTTGGT 81
             TTTC  TA  TTTT  TTCTG  TT CT     CT   AA A CAT TCTC T TT   T
Sbjct:   138 TTTCAGTAATTTTTGATTCTGTATTACTACCCACTTAAAAAATCAT-TCTC-TGTTAATT 195

Query:    80 AT-GACTATAATATGTACTGG-TGCTTGTGGGTATATATCATTAAATGC-GATG-ACTTT 25
             AT GACTAT  T T  ACT   TG TT T   TATATATCATTAAAT   G T  A TTT
Sbjct:   196 ATTGACTATGTTTTA-ACTTTCTGGTTTTACATATATATCATTAAATATAGTTTTAGTTT 254

Query:    24 ATCATCTTCA 15
             A CA  TT A
Sbjct:   255 AACACATTAA 264


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      273       272      10. 115 11 N/A 73   0.022 75
                                                  81   0.023 104
   -1      0      273       272      10. 115 11 N/A 73   0.022 75
                                                  81   0.023 104


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  dbEST
    Release date:  unknown
    Posted date:  9:10 AM EST Dec 21, 1997
    Format:  BLAST
  # of letters in database:  500,351,318
  # of sequences in database:  1,352,941
  # of database sequences satisfying E:  70
  No. of states in DFA:  198 (198 KB)
  Total size of DFA:  205 KB (256 KB)
  Time to generate neighborhood:  0.00u 0.02s 0.02t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  14.04u 0.73s 14.77t  Elapsed: 00:00:05
  Total cpu time:  14.16u 0.79s 14.95t  Elapsed: 00:00:05
  Start:  Sat Feb  7 21:46:57 1998   End:  Sat Feb  7 21:47:02 1998

Date: 17:29:59 on Mon 18 Dec 117.