blastn_dbest_files/636455_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  636455
        (391 letters)

Database:  dbEST
           1,352,941 sequences; 500,351,318 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|636455 AA022438 SWMFCA688SK 5' Lib=283[Brugia...  1913  2.0e-80   1
A cbil|dbest|705917 C18913 C18913 5' Lib=507[Homo_sapiens|...   633  2.0e-34   2
A cbil|dbest|863821 AA224502 zr16f06.r1 5' Lib=536[Homo_sa...   724  2.8e-34   2
A cbil|dbest|390009 H87700 yw15h03.r1 5' Lib=368[Homo_sapi...   607  4.4e-33   2
A cbil|dbest|1142802 AA498116 vh33e08.r1 5' Lib=609[Mus_mus...   839  7.8e-32   1
A cbil|dbest|682152 AA056375 zl65a06.s1 3' Lib=486[Homo_sa...   772  6.9e-29   1
A cbil|dbest|666292 AA050629 mj18d05.r1 5' Lib=437[Mus_mus...   751  5.6e-28   1
A cbil|dbest|694798 AA066641 ml74h10.r1 5' Lib=482[Mus_mus...   734  6.8e-27   1
A cbil|dbest|152953 T82832 yd38f05.r1 5' Lib=262[Homo_sapi...   722  1.1e-26   1
A cbil|dbest|245370 R68512 yh98b07.r1 5' Lib=271[Homo_sapi...   450  5.0e-26   2
A cbil|dbest|866703 AA227362 zr17b06.r1 5' Lib=536[Homo_sa...   663  7.4e-24   1
A cbil|dbest|487299 N80960 za12c01.r1 5' Lib=262[Homo_sapi...   663  8.1e-24   1
A cbil|dbest|975114 AA333877 EST38024 5'-end Lib=702[Homo_...   623  4.9e-22   1
A cbil|dbest|635927 AA021919 mh86g04.r1 5' Lib=470[Mus_mus...   402  2.9e-16   2
A cbil|dbest|192009 R21992 yh24e10.r1 5' Lib=271[Homo_sapi...   468  4.1e-15   1
A cbil|dbest|86652 D21662 MUS77G02  Lib=240[Mus_...   421  8.2e-13   1
A cbil|dbest|637484 AA023619 mh76g06.r1 5' Lib=470[Mus_mus...   402  2.8e-12   1
A cbil|dbest|642278 AA028230 mi18d10.r1 5' Lib=431[Mus_mus...   402  3.1e-12   1
A cbil|dbest|674848 W82760 mf01g11.r1 5' Lib=431[Mus_muscu...   391  1.1e-11   1
A cbil|dbest|1397610 AA691433 vs11f12.r1 5' Lib=909[Mus_mus...   369  1.3e-10   1
A cbil|dbest|574942 W66835 me15b11.r1 5' Lib=437[Mus_muscu...   343  1.4e-09   1
A cbil|dbest|519814 W12624 ma54d12.r1 5' Lib=431[Mus_muscu...   290  4.1e-07   1
A cbil|dbest|941897 AA300568 EST13422 5'-end Lib=707[Homo_...   273  3.5e-06   1
A cbil|dbest|653492 AA037822 zf03f10.r1 5' Lib=424[Homo_sa...   259  1.2e-05   1
A cbil|dbest|637990 AA023904 mh95c01.r1 5' Lib=470[Mus_mus...   249  3.1e-05   1
A cbil|dbest|802576 AA163954 ms40e12.r1 5' Lib=532[Mus_mus...   197  0.010     1
A cbil|dbest|1340063 AA636627 vr19f09.r1 5' Lib=916[Mus_mus...   196  0.13      1
A cbil|dbest|807509 AA168646 mr30c07.r1 5' Lib=553[Mus_mus...   204  0.17      1
A cbil|dbest|542651 W34835 mc60e07.r1 5' Lib=437[Mus_muscu...   205  0.26      1
A cbil|dbest|665494 AA049833 mj09c09.r1 5' Lib=437[Mus_mus...   196  0.69      1



>cbil|dbest|636455 AA022438 SWMFCA688SK 5' Lib=283[Brugia_malayi|||||]
            Length=391
            Length = 391

  Plus Strand HSPs:

 Score = 1913 (287.0 bits), Expect = 2.0e-80, P = 2.0e-80
 Identities = 385/391 (98%), Positives = 385/391 (98%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTC 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTC 120

Query:   121 ACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGANAGTGACTCANCC 180
             |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||
Sbjct:   121 ACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGANAGTGACTCANCC 180

Query:   181 AAGGGCAGGGANAANGAGGAGTACTTCATCTAGTCCCCAGCACTAATGCTGCAGTTAGGG 240
             ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 AAGGGCAGGGANAANGAGGAGTACTTCATCTAGTCCCCAGCACTAATGCTGCAGTTAGGG 240

Query:   241 AACATCCGCCCTGAAGCCATGAGTGGCGTTGANTGACATGGGCAAATCCGCTTGCCTCCC 300
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct:   241 AACATCCGCCCTGAAGCCATGAGTGGCGTTGANTGACATGGGCAAATCCGCTTGCCTCCC 300

Query:   301 AGGACACGGCCCCCAATACCAGCATCACCAACTCCAGGGTCCAGGGACATGAACAGTAAA 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 AGGACACGGCCCCCAATACCAGCATCACCAACTCCAGGGTCCAGGGACATGAACAGTAAA 360

Query:   361 ACTGGGCCTTGGTAAGGACAGTGCTCACAGC 391
             |||||||||||||||||||||||||||||||
Sbjct:   361 ACTGGGCCTTGGTAAGGACAGTGCTCACAGC 391


>cbil|dbest|705917 C18913 C18913 5' Lib=507[Homo_sapiens||placenta|||]
            Length=438
            Length = 438

  Plus Strand HSPs:

 Score = 633 (95.0 bits), Expect = 2.0e-34, Sum P(2) = 2.0e-34
 Identities = 155/187 (82%), Positives = 155/187 (82%), Strand = Plus / Plus

Query:    46 GTGGTGTTTCTCACCCTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAAC 105
             GT GT TT CTCACCCTGCTCTC GT GTGA C TGATCTTCTT TACCTGTACAAGAAC
Sbjct:     1 GTTGTCTTCCTCACCCTGCTCTCGGTCGTGATCTTGATCTTCTTTTACCTGTACAAGAAC 60

Query:   106 AAAGGCAGCTACGTCACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATG 165
             AAAGGCAGCTACGTCACCTA GA CCT CAGAAGG GAGCCCAG GCC TC TCCAGATG
Sbjct:    61 AAAGGCAGCTACGTCACCTATGAACCTACAGAAGGTGAGCCCAGTGCCATCGTCCAGATG 120

Query:   166 GANAGTGACTCANCCAAGGGCAGGGANAANGAGGAGTACTTCATCTAGT--C-CCCAG-C 221
             GA AGTGACT   CCAAGGGCAG GA AA GAGGA TA TTCATCTA T  C CCCAG C
Sbjct:   121 GAGAGTGACTTGGCCAAGGGCAGCGAGAAAGAGGAATATTTCATCTAATGACTCCCAGGC 180

Query:   222 ACTAATG 228
              C AA G
Sbjct:   181 CCCAAGG 187

 Score = 298 (44.7 bits), Expect = 2.0e-34, Sum P(2) = 2.0e-34
 Identities = 104/149 (69%), Positives = 104/149 (69%), Strand = Plus / Plus

Query:   209 TCTAGTCCCCAGCACTAATG-CTGCAG-TTA-GGGAACATCCGCCCTGAAGCCATG-AGT 264
             TC A TC C A CAC   TG CTGC   TTA GGGAA  T   C CTGAAGCCA G AG 
Sbjct:   202 TCCA-TCGCTAACACGT-TGACTGCTTATTATGGGAAAGTTTTCTCTGAAGCCAGGGAGA 259

Query:   265 GGCGTTGANTGACATGGGCAAATCCGCTTGCCTCCCAGGACACGGCCCCCAATACCAGCA 324
              GC TTGA TGA  TGGGCAAATCC     CC  CCAGG C C G CCC AAT CC  CA
Sbjct:   260 AGCATTGATTGATGTGGGCAAATCCAAGCTCCAGCCAGGTCGCAGTCCCAAATGCCGACA 319

Query:   325 TCACCAACTCCAGGGTCCAGGGACATGAACA 355
             TCAC  ACTCCAGGG CCAGGGACATG A A
Sbjct:   320 TCACTTACTCCAGGGACCAGGGACATGGAGA 350


>cbil|dbest|863821 AA224502 zr16f06.r1 5'
            Lib=536[Homo_sapiens|brain|neuroepithelial_cells|||Ntera-2_neuroepi
            thelial_cells] Length=511
            Length = 511

  Plus Strand HSPs:

 Score = 724 (108.6 bits), Expect = 2.8e-34, Sum P(2) = 2.8e-34
 Identities = 180/219 (82%), Positives = 180/219 (82%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGC-TCATTGCAGTTGTCATCACCGTGGTGTTTCTCAC 59
             C AG  GA G  GCCAGCACAGC C TCATTGCAGTTGT ATCACCGT GT TT CTCAC
Sbjct:   132 CCAGAAGATGGAGCCAGCACAGCACCTCATTGCAGTTGTTATCACCGTTGTCTTCCTCAC 191

Query:    60 CCTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAA-GGCAGCTACG 118
             CCTGCTCTC GT GTGA C TGATCTTCTT TACCTGTACAAGAACAAA GGCAGCTACG
Sbjct:   192 CCTGCTCTCGGTCGTGATCTTGATCTTCTTTTACCTGTACAAGAACAAAAGGCAGCTACG 251

Query:   119 TCACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGAN-AGTGACTCA 177
             TCACCTA GA CCT CAGAAGG GAGCCCAG GCC TC TCCAGATGGA  AGTGACT  
Sbjct:   252 TCACCTATGAACCTACAGAAGGTGAGCCCAGTGCCATCGTCCAGATGGAAGAGTGACTTT 311

Query:   178 N-CCAAGGGCAGG-GANAANGAGGAGTACTTCATCTAGT 214
               CCAAGGG AG  GA AA GAGGA TA TTCATCTA T
Sbjct:   312 GGCCAAGGGAAGCCGAGAAAGAGGAATATTTCATCTAAT 350

 Score = 202 (30.3 bits), Expect = 2.8e-34, Sum P(2) = 2.8e-34
 Identities = 76/112 (67%), Positives = 76/112 (67%), Strand = Plus / Plus

Query:   225 AATGCTGCAGT-TAGGGAACATCCGCCCTGAAGCCATG-AGTGGCGTTGANTGACATGGG 282
             A TGCT  A T T GGGAA  T   C CTGAAGCCA G AG  GC TTGA TGA  TGGG
Sbjct:   401 ACTGCTT-ATTATGGGGAAAGTTTTCTCTGAAGCCAGGGAGAAGCATTGATTGATGTGGG 459

Query:   283 CAAATCCGCTTGCCTCCCAGGACACGGCCCCCAATACCAGCATCACCAACTCCA 336
             CAAATCC     CC  CCAGG C C G CC  AAT CC GCATCAC  ACT CA
Sbjct:   460 CAAATCCAAGCTCCAGCCAGGTCGCAGTCCN-AATGCC-GCATCACTGACTTCA 511


>cbil|dbest|390009 H87700 yw15h03.r1 5'
            Lib=368[Homo_sapiens|placenta||||two_placentae:_one_from_8_weeks_an
            d_another_from_9_weeks_post_conception] Length=477
            Length = 477

  Plus Strand HSPs:

 Score = 607 (91.1 bits), Expect = 4.4e-33, Sum P(2) = 4.4e-33
 Identities = 149/180 (82%), Positives = 149/180 (82%), Strand = Plus / Plus

Query:    53 TTCTCACCCTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCA 112
             T CTCACCCTGCTCTC GT GTGA C  GATCTTCTT TACCTGTACAAGAACAAAGGCA
Sbjct:    27 TCCTCACCCTGCTCTCGGTCGTGATCTCGATCTTCTTTTACCTGTACAAGAACAAAGGCA 86

Query:   113 GCTACGTCACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGANAGTG 172
             GCTACGTCACCTA GA CCT CAGAAGG GAGCCCAG GCC TC TCCAGATGGA AGTG
Sbjct:    87 GCTACGTCACCTATGAACCTACAGAAGGTGAGCCCAGTGCCATCGTCCAGATGGAGAGTG 146

Query:   173 ACTCANCCAAGGGCAGGGANAANGAGGAGTACTTCATCTAGT--C-CCCAG-CACTAATG 228
             ACT   CCAAGGGCAG GA AA GAGGA TA TTCATCTA T  C CCCAG C C AA G
Sbjct:   147 ACTTGGCCAAGGGCAGCGAGAAAGAGGAATATTTCATCTAATGACTCCCAGGCCCCAAGG 206

 Score = 293 (44.0 bits), Expect = 4.4e-33, Sum P(2) = 4.4e-33
 Identities = 115/166 (69%), Positives = 115/166 (69%), Strand = Plus / Plus

Query:   209 TCTAGTCCCCAGCACTAATG-CTGCAG-TTA-GGGAACATCCGCCCTGAAGCCATG-AGT 264
             TC A TC C A CAC   TG CTGC   TTA GGGAA  T   C CTGAAGCCA G AG 
Sbjct:   221 TCCA-TCGCTAACACGT-TGACTGCTTATTATGGGAAAGTTTTCTCTGAAGCCAGGGAGA 278

Query:   265 GGCGTTGANTGACATGGGCAAATCCGCTTGCCTCCCAGGACACGGCCCCCAATACCAG-C 323
              GC TTGA TGA  TGGGCAAATCC     CC  CCAGG C C G CCC AAT  C G C
Sbjct:   279 AGCATTGATTGATGTGGGCAAATCCAAGCTCCAGCCAGGTCGCAGTCCCAAATTGCCGAC 338

Query:   324 ATCACCAACTCCAGGGTCCAGGGACATGAACAGTAAAACTGGGCCTTGGTA 374
             ATCAC  ACTCCAGGG CCAGGGACATG A  G AAA CTG    TTG TA
Sbjct:   339 ATCACTGACTCCAGGGACCAGGGACATGGA--G-AAAGCTGTTTATTGATA 386


>cbil|dbest|1142802 AA498116 vh33e08.r1 5'
            Lib=609[Mus_musculus|pooled|pooled_organs|||7_day] Length=329
            Length = 329

  Plus Strand HSPs:

 Score = 839 (125.9 bits), Expect = 7.8e-32, P = 7.8e-32
 Identities = 195/219 (89%), Positives = 195/219 (89%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             CAAGCTGAA AGGCCAGCACAGCGCTCATTGCAGTTGT ATCACCGTGGTGTT CTCACC
Sbjct:    36 CAAGCTGAACAGGCCAGCACAGCGCTCATTGCAGTTGTTATCACCGTGGTGTTCCTCACC 95

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACG-- 118
             CTGCTCTC GTGGTGACC TGATCTTCTT  AC TGTACAAGAACAAAGGCAGCTACG  
Sbjct:    96 CTGCTCTCGGTGGTGACCTTGATCTTCTTTCACTTGTACAAGAACAAAGGCAGCTACGGG 155

Query:   119 --TCACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGANAGTGACTC 176
               TCACCTA GA CCTGCAGAAGGGGA CCCAGCGCC TCCTCCAGATGGA A TGACTC
Sbjct:   156 GGTCACCTATGAGCCTGCAGAAGGGGA-CCCAGCGCCATCCTCCAGATGGAGACTGACTC 214

Query:   177 ANCCAAGGGCAGG-GANAANGAGGAGTACTTCATCTAGTCC 216
             A CCAAGG CAGG GA AA GA GAGTACTTCATCTA T C
Sbjct:   215 AGCCAAGG-CAGGAGAGAAGGAAGAGTACTTCATCTAATGC 254


>cbil|dbest|682152 AA056375 zl65a06.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=392
            Length = 392

  Plus Strand HSPs:

 Score = 772 (115.8 bits), Expect = 6.9e-29, P = 6.9e-29
 Identities = 182/216 (84%), Positives = 182/216 (84%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             C AG  GA G  GCCAGCACAGC CTCATTGCAGTTGT ATCACCGT GT TT CTCACC
Sbjct:   134 CCAGAAGATGGAGCCAGCACAGCACTCATTGCAGTTGTTATCACCGTTGTCTTCCTCACC 193

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTC 120
             CTGCTCTC GT GTGA C TGATCTTCTT TACCTGTACAAGAACAAAGGCAGCTACGTC
Sbjct:   194 CTGCTCTCGGTCGTGATCTTGATCTTCTTTTACCTGTACAAGAACAAAGGCAGCTACGTC 253

Query:   121 ACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGANAGTGACTCAN-C 179
             ACCTA GA CCT CAGAAGG GAGCCCAG GCC TC TCCAGATGGA AGTGACT    C
Sbjct:   254 ACCTATGAACCTACAGAAGGTGAGCCCAGTGCCATCGTCCAGATGGAGAGTGACTTTGGC 313

Query:   180 CAAGGGCAGG-GANAANGAGGAGTACTTCATCTAGT 214
             CAAGGGCAGG GA AA GAGGA TA TTCATCTA T
Sbjct:   314 CAAGGGCAGGCGAGAAAGAGGAATATTTCATCTAAT 349


>cbil|dbest|666292 AA050629 mj18d05.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=426
            Length = 426

  Plus Strand HSPs:

 Score = 751 (112.7 bits), Expect = 5.6e-28, P = 5.6e-28
 Identities = 161/174 (92%), Positives = 161/174 (92%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGT ATCACCGTGGTGTT CTCACC
Sbjct:   254 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTTATCACCGTGGTGTTCCTCACC 313

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTC 120
             CTGCTCTC GTGGTGACC TGATCTTCTT  AC TGTACAAGAACAAAGGCAGCTACGTC
Sbjct:   314 CTGCTCTCGGTGGTGACCTTGATCTTCTTTCACTTGTACAAGAACAAAGGCAGCTACGTC 373

Query:   121 ACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGANAGTGAC 174
             ACCTA GA CCTGCAGAAGGGGAGCC AGCGCC TCCTCCAGATGGA A TGAC
Sbjct:   374 ACCTATGAGCCTGCAGAAGGGGAGCC-AGCGCCATCCTCCAGATGGAGACTGAC 426


>cbil|dbest|694798 AA066641 ml74h10.r1 5'
            Lib=482[Mus_musculus|kidney|kidney|||4_weeks] Length=206
            Length = 206

  Plus Strand HSPs:

 Score = 734 (110.1 bits), Expect = 6.8e-27, P = 6.8e-27
 Identities = 158/169 (93%), Positives = 158/169 (93%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGT ATCACCGTGGTGTT CTCACC
Sbjct:    37 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTTATCACCGTGGTGTTCCTCACC 96

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCT-TCTACCTGTACAAGAACAAAGGCAGCTACGT 119
             CTGCTCTC GTGGTGACC TGATCTTCT TC AC TGTACAA AACAAAGGCAGCTACGT
Sbjct:    97 CTGCTCTCGGTGGTGACCTTGATCTTCTGTC-ACTTGTACAACAACAAAGGCAGCTACGT 155

Query:   120 CACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGANA 169
             CACCTA GA CCTGCAGAAGGGGAGCCCAGCGCC TCCTCCAGATGGA A
Sbjct:   156 CACCTATGAGCCTGCAGAAGGGGAGCCCAGCGCCATCCTCCAGATGGAGA 205


>cbil|dbest|152953 T82832 yd38f05.r1 5'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=457
            Length = 457

  Plus Strand HSPs:

 Score = 722 (108.3 bits), Expect = 1.1e-26, P = 1.1e-26
 Identities = 178/216 (82%), Positives = 178/216 (82%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             C AG  GA G  GCCAGCACAGC CTCATTGCAGTTGT ATCACCGT GT TT CTCACC
Sbjct:   129 CCAGAAGATGGAGCCAGCACAGCACTCATTGCAGTTGTTATCACCGTTGTCTTCCTCACC 188

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTC 120
             CTGCTCT  GT GTGA C TGATCTTCTT TACCTGTACAAGAACAAAGGCAGCTACGTC
Sbjct:   189 CTGCTCTNGGTCGTGATCTTGATCTTCTTTTACCTGTACAAGAACAAAGGCAGCTACGTC 248

Query:   121 ACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGAN-AGTGACTCAN- 178
             ACCTA GA CCT CAGAAGG GAGCCCAG GCC TC TCCAGATGGA  AGTGACT    
Sbjct:   249 ACCTATGAACCTACAGAAGGTGAGCCCAGTGCCATCGTCCAGATGGAGGAGTGACTTNGG 308

Query:   179 CCAAGGGCAGG-GAN-AANGAGG-AGTACTTCATCT 211
             CCAAGGGCAGG GA  AA GAGG A T  TTCATCT
Sbjct:   309 CCAAGGGCAGGCGAGGAAAGAGGGATTTTTTCATCT 344


>cbil|dbest|245370 R68512 yh98b07.r1 5'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=351
            Length = 351

  Plus Strand HSPs:

 Score = 450 (67.5 bits), Expect = 5.0e-26, Sum P(2) = 5.0e-26
 Identities = 114/138 (82%), Positives = 114/138 (82%), Strand = Plus / Plus

Query:    94 CTGTACAAGAACAAAGGCAGCTACGTCACCTACGANCCTGCAGAAGGGGAGCCCAGCGCC 153
             CTGTACAAGAACAAAGGCAGCTACGTCACCTA GA CCT CAGAAGG GAGCCCAG GCC
Sbjct:     1 CTGTACAAGAACAAAGGCAGCTACGTCACCTATGAACCTACAGAAGGTGAGCCCAGTGCC 60

Query:   154 GTCCTCCAGATGGANAGTGACTCANCCAAGGGCAGGGANAANGAGGAGTACTTCATCTAG 213
              TC TCCAGATGGA AGTGACT   CCAAGGG AG GA AA GAGGA TA TTCATCTA 
Sbjct:    61 ATCGTCCAGATGGAGAGTGACTTGGCCAAGGG-AGCGAGAAAGAGGAATATTTCATCTAA 119

Query:   214 T--C-CCCAG-CACTAATG 228
             T  C CCCAG C C AA G
Sbjct:   120 TGACTCCCAGGCCCCAAGG 138

 Score = 295 (44.3 bits), Expect = 5.0e-26, Sum P(2) = 5.0e-26
 Identities = 115/168 (68%), Positives = 115/168 (68%), Strand = Plus / Plus

Query:   209 TCTAGTCCCCAGCACTAATG-CTGCAG-TTA-GGGAACATCCGCCCTGAAGCCATG-AGT 264
             TC A TC C A CAC   TG CTGC   TTA GGGAA  T   C CTGAAGCCA G AG 
Sbjct:   153 TCCA-TCGCTAACACGT-TGACTGCTTATTATGGGAAAGTTTTCTCTGAAGCCAGGGAGA 210

Query:   265 GGCGTTGANTGACATGGGCAAATCCGCTTGCCTCCCAGGACACGGCCCCCAATACCAGCA 324
              GC TTGA TGA  TGGGCAAATCC     CC  CCAGG C C G CCC AAT CC  CA
Sbjct:   211 AGCATTGATTGATGTGGGCAAATCCAAGCTCCAGCCAGGTCGCAGTCCCAAATGCCGACA 270

Query:   325 TCACCAACTCCAGGGT-CCAGGGACATGAACAGTAAAACTGGGCCTTGGTAA 375
             TCAC  ACTCCAGGG  CCAGGGACATG   AG AAA CTG    TTG T A
Sbjct:   271 TCACTGACTCCAGGGGACCAGGGACATGGG-AG-AAAGCTGTTTATTGATTA 320


>cbil|dbest|866703 AA227362 zr17b06.r1 5'
            Lib=536[Homo_sapiens|brain|neuroepithelial_cells|||Ntera-2_neuroepi
            thelial_cells] Length=308
            Length = 308

  Plus Strand HSPs:

 Score = 663 (99.5 bits), Expect = 7.4e-24, P = 7.4e-24
 Identities = 151/175 (86%), Positives = 151/175 (86%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             | ||  || |  ||||||||||| |||||||||||||| |||||||| || || ||||||
Sbjct:   130 CCAGAAGATGGAGCCAGCACAGCACTCATTGCAGTTGTTATCACCGTTGTCTTCCTCACC 189

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTC 120
             |||||||| || |||| | |||||||||| ||||||||||||||||||||||||||||||
Sbjct:   190 CTGCTCTCGGTCGTGATCTTGATCTTCTTTTACCTGTACAAGAACAAAGGCAGCTACGTC 249

Query:   121 ACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGANAGTGACT 175
             ||||| || ||| ||||||| |||||||| ||| || |||||||||| |||||||
Sbjct:   250 ACCTATGAACCTACAGAAGGTGAGCCCAGTGCCATCGTCCAGATGGAGAGTGACT 304


>cbil|dbest|487299 N80960 za12c01.r1 5'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=280
            Length = 280

  Plus Strand HSPs:

 Score = 663 (99.5 bits), Expect = 8.1e-24, P = 8.1e-24
 Identities = 155/183 (84%), Positives = 155/183 (84%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             C AG  GA G  GCCAGCACAGC CTCATTGCAGTTGT ATCACCGT GT TT CTCACC
Sbjct:    98 CCAGAAGATGGAGCCAGCACAGCACTCATTGCAGTTGTTATCACCGTTGTCTTCCTCACC 157

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTC 120
             CTGCTCTC GT GTGA C TGATCTTCTT TACCTGTACAAGAACAAAGGCAGCTACGTC
Sbjct:   158 CTGCTCTCGGTCGTGATCTTGATCTTCTTTTACCTGTACAAGAACAAAGGCAGCTACGTC 217

Query:   121 ACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCA-GATGGANAGTGACTCANC 179
             ACCTA GA CCT CAGAAGG GAGCCCAG GCC TC TCCA GATGGA AGTGACT   C
Sbjct:   218 ACCTATGAACCTACAGAAGGTGAGCCCAGTGCCATCGTCCANGATGGAGAGTGACTTGGC 277

Query:   180 CAA 182
             CAA
Sbjct:   278 CAA 280


>cbil|dbest|975114 AA333877 EST38024 5'-end
            Lib=702[Homo_sapiens|||||embryo,_9_wks] Length=298
            Length = 298

  Plus Strand HSPs:

 Score = 623 (93.5 bits), Expect = 4.9e-22, P = 4.9e-22
 Identities = 143/167 (85%), Positives = 143/167 (85%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             | ||  || |  ||||||||||| |||||||||||||| |||||||| || || ||||||
Sbjct:   131 CCAGAAGATGGAGCCAGCACAGCACTCATTGCAGTTGTTATCACCGTTGTCTTCCTCACC 190

Query:    61 CTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTC 120
             |||||||| || |||| | |||||||||| ||||||||||||||||||||||||||||||
Sbjct:   191 CTGCTCTCGGTCGTGATCTTGATCTTCTTTTACCTGTACAAGAACAAAGGCAGCTACGTC 250

Query:   121 ACCTACGANCCTGCAGAAGGGGAGCCCAGCGCCGTCCTCCAGATGGA 167
             | ||| || ||| ||||||| |||||||| ||| || ||||||||||
Sbjct:   251 ANCTATGAACCTACAGAAGGTGAGCCCAGTGCCATCGTCCAGATGGA 297


>cbil|dbest|635927 AA021919 mh86g04.r1 5'
            Lib=470[Mus_musculus|placenta|placenta|||adult] Length=504
            Length = 504

  Minus Strand HSPs:

 Score = 402 (60.3 bits), Expect = 2.9e-16, Sum P(2) = 2.9e-16
 Identities = 102/128 (79%), Positives = 102/128 (79%), Strand = Minus / Plus

Query:   355 TGTTCATGTCCCTGGACCCTGGAGTTGGTGATGCTGGTATTGGGGGCCGTGTCCTGGGAG 296
             T T C TGTC CTGGACCCTGGAGT  GTGAT C GGTATTGGGGGC GTGTCCTGGGAG
Sbjct:   293 TCTCCGTGTCTCTGGACCCTGGAGTCAGTGATTCCGGTATTGGGGGCTGTGTCCTGGGAG 352

Query:   295 GCAAGCGGATTTGCCCATGTCANTCAACGCCACTCA-TGGCTTCAGGGCGGATGTTCCCT 237
             G  AG GGAT TGCC  T TCA  CAACGCCACTC  TGGCTT AG GC  A GTTCCCT
Sbjct:   353 GTGAGTGGATGTGCCAGTATCACCCAACGCCACTCCCTGGCTTTAGAGCAAACGTTCCCT 412

Query:   236 AACTGCAG 229
             AACT CAG
Sbjct:   413 AACTACAG 420

 Score = 120 (18.0 bits), Expect = 2.9e-16, Sum P(2) = 2.9e-16
 Identities = 28/34 (82%), Positives = 28/34 (82%), Strand = Minus / Plus

Query:   216 GGACTAGATGAAGTACTCCTCNTTNTCCCTGCCC 183
             | | |||||||||||||| || || || ||||||
Sbjct:   471 GCATTAGATGAAGTACTCTTCCTTCTCTCTGCCC 504


>cbil|dbest|192009 R21992 yh24e10.r1 5'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=352
            Length = 352

  Plus Strand HSPs:

 Score = 468 (70.2 bits), Expect = 4.1e-15, P = 4.1e-15
 Identities = 126/155 (81%), Positives = 126/155 (81%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACC 60
             C AG  GA G  GCCAGCACAGC CTCATTGCAGTTGT ATCACCGT GT TT CTCACC
Sbjct:   138 CCAGAAGATGGAGCCAGCACAGCACTCATTGCAGTTGTTATCACCGTTGTCTTCCTCACC 197

Query:    61 CTGCTCTCAGTGGTGACCCTG-ATCTTCTTCTACCTGT-ACAAG-AACAAAGG-CAGCT- 115
             CTGCTCTC GT GTGA C TG ATCTTCTT TACCTGT ACAAG AACAAAGG CAG T 
Sbjct:   198 CTGCTCTCGGTCGTGATCTTGGATCTTCTTTTACCTGTTACAAGGAACAAAGGGCAGGTT 257

Query:   116 ACGTCACCTACG-ANCCTGCAG-AAGGG-GAGCCC 147
             ACGTCACCTA G A CCT CAG AAGGG GAG CC
Sbjct:   258 ACGTCACCTATGGAACCTACAGGAAGGGTGAGGCC 292


>cbil|dbest|86652 D21662 MUS77G02  Lib=240[Mus_musculus|||||]
            Length=235
            Length = 235

  Plus Strand HSPs:

 Score = 421 (63.2 bits), Expect = 8.2e-13, P = 8.2e-13
 Identities = 101/113 (89%), Positives = 101/113 (89%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGC-TCATTGCAGTTGTCATCACCGTGGTGTTTCTCAC 59
             CAAGCTGAAGAGGCCAGCACAGCGC TCATTGCAGTTGT ATCACCGTGGTGTT CT AC
Sbjct:   124 CAAGCTGAAGAGGCCAGCACAGCGCGTCATTGCAGTTGTTATCACCGTGGTGTTCCT-AC 182

Query:    60 CCTGCTCTCAGTGGTGACCCTGATCTTCTTCTACCTGTACAAGAAC-AAAGGCAG 113
             CCTGCT TC GTGGTGACC TGAT TT TT TAC TGTACAAG AC AAAGG AG
Sbjct:   183 CCTGCTNTCGGTGGTGACCTTGATTTT-TT-TACTTGTACAAGGACCAAAGGGAG 235


>cbil|dbest|637484 AA023619 mh76g06.r1 5'
            Lib=470[Mus_musculus|placenta|placenta|||adult] Length=493
            Length = 493

  Minus Strand HSPs:

 Score = 402 (60.3 bits), Expect = 2.8e-12, P = 2.8e-12
 Identities = 102/128 (79%), Positives = 102/128 (79%), Strand = Minus / Plus

Query:   355 TGTTCATGTCCCTGGACCCTGGAGTTGGTGATGCTGGTATTGGGGGCCGTGTCCTGGGAG 296
             T T C TGTC CTGGACCCTGGAGT  GTGAT C GGTATTGGGGGC GTGTCCTGGGAG
Sbjct:   300 TCTCCGTGTCTCTGGACCCTGGAGTCAGTGATTCCGGTATTGGGGGCTGTGTCCTGGGAG 359

Query:   295 GCAAGCGGATTTGCCCATGTCANTCAACGCCACTCA-TGGCTTCAGGGCGGATGTTCCCT 237
             G  AG GGAT TGCC  T TCA  CAACGCCACTC  TGGCTT AG GC  A GTTCCCT
Sbjct:   360 GTGAGTGGATGTGCCAGTATCACCCAACGCCACTCCCTGGCTTTAGAGCAAACGTTCCCT 419

Query:   236 AACTGCAG 229
             AACT CAG
Sbjct:   420 AACTACAG 427


>cbil|dbest|642278 AA028230 mi18d10.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=454
            Length = 454

  Minus Strand HSPs:

 Score = 402 (60.3 bits), Expect = 3.1e-12, P = 3.1e-12
 Identities = 102/128 (79%), Positives = 102/128 (79%), Strand = Minus / Plus

Query:   355 TGTTCATGTCCCTGGACCCTGGAGTTGGTGATGCTGGTATTGGGGGCCGTGTCCTGGGAG 296
             T T C TGTC CTGGACCCTGGAGT  GTGAT C GGTATTGGGGGC GTGTCCTGGGAG
Sbjct:   299 TCTCCGTGTCTCTGGACCCTGGAGTCAGTGATTCCGGTATTGGGGGCTGTGTCCTGGGAG 358

Query:   295 GCAAGCGGATTTGCCCATGTCANTCAACGCCACTCA-TGGCTTCAGGGCGGATGTTCCCT 237
             G  AG GGAT TGCC  T TCA  CAACGCCACTC  TGGCTT AG GC  A GTTCCCT
Sbjct:   359 GTGAGTGGATGTGCCAGTATCACCCAACGCCACTCCCTGGCTTTAGAGCAAACGTTCCCT 418

Query:   236 AACTGCAG 229
             AACT CAG
Sbjct:   419 AACTACAG 426


>cbil|dbest|674848 W82760 mf01g11.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=412
            Length = 412

  Plus Strand HSPs:

 Score = 391 (58.7 bits), Expect = 1.1e-11, P = 1.1e-11
 Identities = 99/124 (79%), Positives = 99/124 (79%), Strand = Plus / Plus

Query:   233 AGTTAGGGAACATCCGCCCTGAAGCCATG-AGTGGCGTTGANTGACATGGGCAAATCCGC 291
             AGTTAGGGAAC T  GC CT AAGCCA G AGTGGCGTTG  TGA A  GGCA ATCC C
Sbjct:     1 AGTTAGGGAACGTTTGCTCTAAAGCCAGGGAGTGGCGTTGGGTGATACTGGCACATCCAC 60

Query:   292 TTGCCTCCCAGGACACGGCCCCCAATACCAGCATCACCAACTCCAGGGTCCAGGGACATG 351
             T  CCTCCCAGGACAC GCCCCCAATACC G ATCAC  ACTCCAGGGTCCAG GACA G
Sbjct:    61 TCACCTCCCAGGACACAGCCCCCAATACCGGAATCACTGACTCCAGGGTCCAGAGACACG 120

Query:   352 AACA 355
              A A
Sbjct:   121 GAGA 124


>cbil|dbest|1397610 AA691433 vs11f12.r1 5' Lib=909[Mus_musculus|||||8_weeks]
            Length=340
            Length = 340

  Plus Strand HSPs:

 Score = 369 (55.4 bits), Expect = 1.3e-10, P = 1.3e-10
 Identities = 79/84 (94%), Positives = 79/84 (94%), Strand = Plus / Plus

Query:     1 CAAGCTGAAGAGGCCAGCACAGCGCT-CATTGCAGTTGTCATCACCGTGGTGTTTCTCAC 59
             CAAGCTGAAGAGGCCAGCACAGCGCT CATTGCAGTTGT ATCACCGTGGTGTT CTCAC
Sbjct:   257 CAAGCTGAAGAGGCCAGCACAGCGCTGCATTGCAGTTGTTATCACCGTGGTGTTCCTCAC 316

Query:    60 CCTGCTCTCAGTGGTGACCCTGAT 83
             CCTGCTCTC GTGGTGACC TGAT
Sbjct:   317 CCTGCTCTCGGTGGTGACCTTGAT 340


>cbil|dbest|574942 W66835 me15b11.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=455
            Length = 455

  Minus Strand HSPs:

 Score = 343 (51.5 bits), Expect = 1.4e-09, P = 1.4e-09
 Identities = 87/109 (79%), Positives = 87/109 (79%), Strand = Minus / Plus

Query:   355 TGTTCATGTCCCTGGACCCTGGAGTTGGTGATGCTGGTATTGGGGGCCGTGTCCTGGGAG 296
             T T C TGTC CTGGACCCTGGAGT  GTGAT C GGTATTGGGGGC GTGTCCTGGGAG
Sbjct:   342 TCTCCGTGTCTCTGGACCCTGGAGTCAGTGATTCCGGTATTGGGGGCTGTGTCCTGGGAG 401

Query:   295 GCAAGCGGATTTGCCCATGTCANTCAACGCCACTCA-TGGCTTCAGGGC 248
             G  AG GGAT TGCC  T TCA  CAACGCCACTC  TGGCTT AG GC
Sbjct:   402 GTGAGTGGATGTGCCAGTATCACCCAACGCCACTCCCTGGCTTTAGAGC 450


>cbil|dbest|519814 W12624 ma54d12.r1 5'
            Lib=431[Mus_musculus|||||19.5_dpc_total_fetus] Length=388
            Length = 388

  Minus Strand HSPs:

 Score = 290 (43.5 bits), Expect = 4.1e-07, P = 4.1e-07
 Identities = 72/90 (80%), Positives = 72/90 (80%), Strand = Minus / Plus

Query:   355 TGTTCATGTCCCTGGACCCTGGAGTTGGTGATGCTGGTATTGGGGGCCGTGTCCTGGGAG 296
             | | | |||| ||||||||||||||  ||||| | |||||||||||| ||||||||||||
Sbjct:   299 TCTCCGTGTCTCTGGACCCTGGAGTCAGTGATTCCGGTATTGGGGGCTGTGTCCTGGGAG 358

Query:   295 GCAAGCGGATTTGCCCATGTCANTCAACGC 266
             |  || |||| ||||  | |||  ||||||
Sbjct:   359 GTGAGTGGATGTGCCAGTATCACCCAACGC 388


>cbil|dbest|941897 AA300568 EST13422 5'-end
            Lib=707[Homo_sapiens|testis||||adult] Length=270
            Length = 270

  Plus Strand HSPs:

 Score = 273 (41.0 bits), Expect = 3.5e-06, P = 3.5e-06
 Identities = 83/119 (69%), Positives = 83/119 (69%), Strand = Plus / Plus

Query:   238 GGGAACATCCGCCCTGAAGCCATG-AGTGGCGTTGANTGACATGGGCAAATCCGCTTGCC 296
             GGGAA  T      TGAAGCCA G AG  GC TTGA TGA  TGGGCAAATCC     CC
Sbjct:    20 GGGAAANTTTTNTNTGAAGCCAGGGAGAAGCATTGATTGATGTGGGCAAATCCAAGCTCC 79

Query:   297 TCCCAGGACACGGCCCCCAATACCAGCATCACCAACTCCAGGGTCCAGGGACATGAACA 355
               CCAGG C C G CCC AAT CC  CATCAC  ACTCCAGGG CCAGGGACATG A A
Sbjct:    80 AGCCAGGTCGCAGTCCCAAATGCCGACATCACTGACTCCAGGGACCAGGGACATGGAGA 138


>cbil|dbest|653492 AA037822 zf03f10.r1 5'
            Lib=424[Homo_sapiens|heart||||19_weeks] Length=343
            Length = 343

  Plus Strand HSPs:

 Score = 259 (38.9 bits), Expect = 1.2e-05, P = 1.2e-05
 Identities = 77/106 (72%), Positives = 77/106 (72%), Strand = Plus / Plus

Query:   252 TGAAGCCATG-AGTG-GCGTTGANTGACATGGGCAAATCCGCTTGCCTCCCAGGACACGG 309
             TGAAGCCA G AG   GC TTGA TGA  TGGGCAAATCC     CC  CCAGG C C G
Sbjct:     2 TGAAGCCAGGGAGAAAGCATTGATTGATGTGGGCAAATCCAAGCTCCAGCCAGGTCGCAG 61

Query:   310 CCCCCAATACCAGCATCACCAACTCCAGGGTCCAGGGACATGAACA 355
              CCC AAT CC  CATCAC  ACTCCAGGG CCAGGGACATG A A
Sbjct:    62 TCCCAAATGCCGACATCACTGACTCCAGGGACCAGGGACATGGAGA 107


>cbil|dbest|637990 AA023904 mh95c01.r1 5'
            Lib=470[Mus_musculus|placenta|placenta|||adult] Length=371
            Length = 371

  Minus Strand HSPs:

 Score = 249 (37.4 bits), Expect = 3.1e-05, P = 3.1e-05
 Identities = 61/75 (81%), Positives = 61/75 (81%), Strand = Minus / Plus

Query:   355 TGTTCATGTCCCTGGACCCTGGAGTTGGTGATGCTGGTATTGGGGGCCGTGTCCTGGGAG 296
             | | | |||| |||||| |||||||  ||||| | |||||||||||| ||||||||||||
Sbjct:   295 TCTCCGTGTCTCTGGACTCTGGAGTCAGTGATTCCGGTATTGGGGGCTGTGTCCTGGGAG 354

Query:   295 GCAAGCGGATTTGCC 281
             |  || |||| ||||
Sbjct:   355 GTGAGTGGATGTGCC 369


>cbil|dbest|802576 AA163954 ms40e12.r1 5'
            Lib=532[Mus_musculus|whole_embryo|embryo|||13.5dpc_embryos]
            Length=244 Author_cmt: gb:M36284 GLYCOPHORIN C (HUMAN);
            Length = 244

  Plus Strand HSPs:

 Score = 197 (29.6 bits), Expect = 0.010, P = 0.010
 Identities = 69/102 (67%), Positives = 69/102 (67%), Strand = Plus / Plus

Query:    22 GCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACCCTGCTCTCAGTGGTGACCCTG 81
             GC  TCATTGCAG TGT ATCAC G  GTG    T   CCTG TCT   T GTG   CT 
Sbjct:    12 GCCGTCATTGCAGCTGTGATCACTGCTGTGGCCTTGGTCCTGGTCTGCCTCGTGTTTCTC 71

Query:    82 AT-CTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTCACC 123
             AT CTTC  CTACCTGTACA G ACA  GG A CTAC  CACC
Sbjct:    72 ATGCTTCG-CTACCTGTACAGGCACAGGGGTACCTACCACACC 113


>cbil|dbest|1340063 AA636627 vr19f09.r1 5' Lib=916[Mus_musculus||||C2C12|]
            Length=367 Author_cmt: gb:M36284 GLYCOPHORIN C (HUMAN);
            Length = 367

  Plus Strand HSPs:

 Score = 196 (29.4 bits), Expect = 0.14, P = 0.13
 Identities = 102/165 (61%), Positives = 102/165 (61%), Strand = Plus / Plus

Query:    22 GCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACCCTGCTCTCAGTGGTGACCCTG 81
             GC  TCATTGCAG TGT ATCAC G  GTG    T   CCTG TCT   T  T    CT 
Sbjct:   117 GCCATCATTGCAGCTGTGATCACTGCTGTGGCCTTGGTCCTGGTCTGCCTCCTCTTTCTC 176

Query:    82 AT-CTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTCACCTACGAN-CCT--GCAGA 137
             AT CTTC  CTACCTGTACA G ACAA GG A CTAC  CACC A GA  CC   GC GA
Sbjct:   177 ATGCTTCG-CTACCTGTACAGGCACAAGGGTACCTACCACACCAATGAGGCCAAAGC-GA 234

Query:   138 -AGGGGA-GCCCAGCGCCGTCCTCCAGA--TGGANAGTGACTCANCC 180
              AG G   GC  AG G   T  T CAG   TG A AGTGAC C  CC
Sbjct:   235 CAGAGTTTGCAGAGAGTGCTGATGCAGCCCTGCAAAGTGACCCTGCC 281


>cbil|dbest|807509 AA168646 mr30c07.r1 5'
            Lib=553[Mus_musculus||Spleen|||4_weeks] Length=519 Author_cmt:
            gb:M36284 GLYCOPHORIN C (HUMAN);
            Length = 519

  Plus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.18, P = 0.17
 Identities = 100/164 (60%), Positives = 100/164 (60%), Strand = Plus / Plus

Query:    22 GCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACCCTGCTCTCAGTGGTGACCCTG 81
             GC  TCATTGCAG TGT ATCAC G  GTG    T   CCTG TCT   T  T    CT 
Sbjct:   242 GCCATCATTGCAGCTGTGATCACTGCTGTGGCCTTGGTCCTGGTCTGCCTCCTCTTTCTC 301

Query:    82 AT-CTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTCACCTACGANCCTGCAG-A-A 138
             AT CTTC  CTACCTGTACA G ACAA GG A CTAC  CACC A GA  C   AG A A
Sbjct:   302 ATGCTTCG-CTACCTGTACAGGCACAAGGGTACCTACCACACCAATGAGGCCAAAGCACA 360

Query:   139 GGGGA-GCCCAGCGCCGTCCTCCAGA--TGGANAGTGACTCANCC 180
             G G   GC  AG G   T  T CAG   TG A AGTGAC C  CC
Sbjct:   361 GAGTTTGCAGAGAGTGCTGATGCAGCCCTGCAAAGTGACCCTGCC 405


>cbil|dbest|542651 W34835 mc60e07.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=965
            Author_cmt: gb:M36284 GLYCOPHORIN C (HUMAN);
            Length = 965

  Plus Strand HSPs:

 Score = 205 (30.8 bits), Expect = 0.30, P = 0.26
 Identities = 79/123 (64%), Positives = 79/123 (64%), Strand = Plus / Plus

Query:    22 GCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACCCTGCTCTCAGTGGTGACCCTG 81
             GC  TCATTGCAG TGT ATCAC G  GTG    T   CCTG TCT   T  T    CT 
Sbjct:   199 GCCATCATTGCAGCTGTGATCACTGCTGTGGCCTTGGTCCTGGTCTGCCTCCTCTTTCTC 258

Query:    82 AT-CTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTCACCTACGANCCTGCAGAAGG 140
             AT CTTC  CTACCTGTACA G ACAA GG A CTAC  CACC A GA  C   AG A G
Sbjct:   259 ATGCTTCG-CTACCTGTACAGGCACAAGGGTACCTACCACACCAATGAGGCCAAAGGACG 317

Query:   141 GGAG 144
              GAG
Sbjct:   318 AGAG 321


>cbil|dbest|665494 AA049833 mj09c09.r1 5'
            Lib=437[Mus_musculus||embryo|||13.5-14.5dpc_total_fetus] Length=871
            Author_cmt: gb:M36284 GLYCOPHORIN C (HUMAN);
            Length = 871

  Plus Strand HSPs:

 Score = 196 (29.4 bits), Expect = 1.2, P = 0.69
 Identities = 78/123 (63%), Positives = 78/123 (63%), Strand = Plus / Plus

Query:    22 GCGCTCATTGCAGTTGTCATCACCGTGGTGTTTCTCACCCTGCTCTCAGTGGTGACCCTG 81
             GC  TCATTGCAG TGT ATCAC G  GTG    T   CCTG TCT   T  T    CT 
Sbjct:   213 GCCATCATTGCAGCTGTGATCACTGCTGTGGCCTTGGTCCTGGTCTGCCTCCTCTTTCTC 272

Query:    82 AT-CTTCTTCTACCTGTACAAGAACAAAGGCAGCTACGTCACCTACGANCCTGCAGAAGG 140
             AT CTTC  CTACCTGTACA G ACAA GG A CTAC  CACC A GA  C   AG A  
Sbjct:   273 ATGCTTCG-CTACCTGTACAGGCACAAGGGTACCTACCACACCAATGAGGCCAAAGGACT 331

Query:   141 GGAG 144
              GAG
Sbjct:   332 AGAG 335


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      391       385      10. 118 11 N/A 73   0.022 77
                                                  84   0.023 111
   -1      0      391       385      10. 118 11 N/A 73   0.022 77
                                                  84   0.023 111


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  dbEST
    Release date:  unknown
    Posted date:  9:10 AM EST Dec 21, 1997
    Format:  BLAST
  # of letters in database:  500,351,318
  # of sequences in database:  1,352,941
  # of database sequences satisfying E:  30
  No. of states in DFA:  216 (216 KB)
  Total size of DFA:  225 KB (256 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  13.00u 1.06s 14.06t  Elapsed: 00:00:03
  Total cpu time:  13.06u 1.08s 14.14t  Elapsed: 00:00:03
  Start:  Thu Feb  5 20:50:19 1998   End:  Thu Feb  5 20:50:22 1998

Date: 17:11:18 on Mon 18 Dec 117.