blastn_dbest_files/752260_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  752260
        (343 letters)

Database:  dbEST
           1,352,941 sequences; 500,351,318 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|752260 AA114374 MBAFCE3A08T3 5' Lib=531[Brugi...  1715  2.0e-71   1
A cbil|dbest|504578 N97744 1186C3  Lib=114[Plasmo...   270  4.5e-06   1
A cbil|dbest|560011 W52385 zc48a10.s1 3' Lib=423[Homo_sapi...   260  8.0e-06   1
A cbil|dbest|504799 N97949 1710C3  Lib=114[Plasmo...   228  0.00026   1
A cbil|dbest|1148783 AA504130 aa59c07.s1 3' Lib=595[Homo_sa...   226  0.00027   1
A cbil|dbest|1083347 AA439050 LD13488.5prime 5' Lib=594[Dro...   219  0.00065   1
A cbil|dbest|1084310 AA440156 LD14756.5prime 5' Lib=594[Dro...   218  0.00067   1
A cbil|dbest|1084754 AA440457 LD15308.5prime 5' Lib=594[Dro...   218  0.00068   1
A cbil|dbest|1184896 AA539551 LD17735.5prime 5' Lib=594[Dro...   218  0.00069   1
A cbil|dbest|1085763 AA441469 LD16416.5prime 5' Lib=594[Dro...   218  0.00071   1
A cbil|dbest|772344 AA132477 zo17a07.s1 3' Lib=486[Homo_sa...   218  0.00085   1
A cbil|dbest|1085603 AA441309 LD16194.5prime 5' Lib=594[Dro...   218  0.00089   1
A cbil|dbest|1034217 AA392869 LD12007.5prime 5' Lib=594[Dro...   216  0.00095   1
A cbil|dbest|1185178 AA538607 LD18175.5prime 5' Lib=594[Dro...   215  0.0010    1
A cbil|dbest|1185452 AA538881 LD18523.5prime 5' Lib=594[Dro...   213  0.0013    1
A cbil|dbest|1185936 AA539888 LD19180.5prime 5' Lib=594[Dro...   218  0.0013    1
A cbil|dbest|1114052 C24389 C24389  Lib=635[Dictyo...   217  0.0013    1
A cbil|dbest|1179186 AA534546 nf77a07.s1  Lib=882[...   216  0.0016    1
A cbil|dbest|1185823 AA539367 LD19020.5prime 5' Lib=594[Dro...   209  0.0017    1
A cbil|dbest|1085261 AA440967 LD12786.5prime 5' Lib=594[Dro...   209  0.0017    1
A cbil|dbest|1084648 AA440096 LD15177.5prime 5' Lib=594[Dro...   209  0.0017    1
A cbil|dbest|1033387 AA392038 LD10986.5prime 5' Lib=594[Dro...   209  0.0017    1
A cbil|dbest|1185686 AA539186 LD18840.5prime 5' Lib=594[Dro...   209  0.0017    1
A cbil|dbest|1082909 AA438612 LD12929.5prime 5' Lib=594[Dro...   209  0.0017    1
A cbil|dbest|1185669 AA539105 LD18820.5prime 5' Lib=594[Dro...   209  0.0018    1
A cbil|dbest|1186906 AA540858 LD20685.5prime 5' Lib=594[Dro...   209  0.0018    1
A cbil|dbest|1085358 AA441064 LD15842.5prime 5' Lib=594[Dro...   209  0.0018    1
A cbil|dbest|1085791 AA441497 LD16454.5prime 5' Lib=594[Dro...   209  0.0018    1
A cbil|dbest|1181943 AA536338 LD16901.5prime 5' Lib=594[Dro...   209  0.0018    1
A cbil|dbest|1185443 AA538872 LD18510.5prime 5' Lib=594[Dro...   209  0.0018    1
A cbil|dbest|1084641 AA440089 LD15170.5prime 5' Lib=594[Dro...   215  0.0018    1
A cbil|dbest|841861 AA202803 LD03121.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|1031997 AA390659 LD09620.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|1186134 AA540086 LD19444.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|1182260 AA536570 LD17330.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|1185524 AA538953 LD18632.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|1033921 AA392428 LD12810.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|1085436 AA441142 LD16036.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|1185525 AA538954 LD18633.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|840919 AA201799 LD03726.5prime 5' Lib=594[Dro...   209  0.0019    1
A cbil|dbest|1083871 AA439574 LD14180.5prime 5' Lib=594[Dro...   209  0.0020    1
A cbil|dbest|1084626 AA440074 LD15155.5prime 5' Lib=594[Dro...   209  0.0020    1
A cbil|dbest|1182249 AA536559 LD17318.5prime 5' Lib=594[Dro...   209  0.0020    1
A cbil|dbest|1185620 AA539056 LD18753.5prime 5' Lib=594[Dro...   209  0.0020    1
A cbil|dbest|1186912 AA540864 LD20693.5prime 5' Lib=594[Dro...   209  0.0020    1
A cbil|dbest|905376 AA264405 LD08046.5prime 5' Lib=594[Dro...   209  0.0020    1
A cbil|dbest|1185455 AA538884 LD18528.5prime 5' Lib=594[Dro...   209  0.0021    1
A cbil|dbest|1084021 AA439724 LD14363.5prime 5' Lib=594[Dro...   209  0.0021    1
A cbil|dbest|1084696 AA440304 LD15232.5prime 5' Lib=594[Dro...   209  0.0021    1
A cbil|dbest|1085714 AA441420 LD16344.5prime 5' Lib=594[Dro...   209  0.0021    1
A cbil|dbest|1182308 AA536618 LD17390.5prime 5' Lib=594[Dro...   209  0.0021    1
A cbil|dbest|1185599 AA539028 LD18729.5prime 5' Lib=594[Dro...   207  0.0021    1
A cbil|dbest|1084612 AA440060 LD15139.5prime 5' Lib=594[Dro...   209  0.0021    1
A cbil|dbest|1186594 AA540546 LD20265.5prime 5' Lib=594[Dro...   209  0.0021    1
A cbil|dbest|1085619 AA441325 LD16218.5prime 5' Lib=594[Dro...   209  0.0022    1
A cbil|dbest|1085926 AA441632 LD16629.5prime 5' Lib=594[Dro...   209  0.0022    1
A cbil|dbest|1083216 AA438919 LD13316.5prime 5' Lib=594[Dro...   209  0.0022    1
A cbil|dbest|1082675 AA438378 LD12644.5prime 5' Lib=594[Dro...   209  0.0022    1
A cbil|dbest|1085228 AA440934 LD12746.5prime 5' Lib=594[Dro...   209  0.0022    1
A cbil|dbest|1182109 AA536504 LD17141.5prime 5' Lib=594[Dro...   209  0.0022    1
A cbil|dbest|1184892 AA539547 LD17731.5prime 5' Lib=594[Dro...   207  0.0023    1
A cbil|dbest|1185593 AA539022 LD18722.5prime 5' Lib=594[Dro...   209  0.0023    1
A cbil|dbest|1186204 AA540156 LD19545.5prime 5' Lib=594[Dro...   209  0.0023    1
A cbil|dbest|1185084 AA539739 LD18059.5prime 5' Lib=594[Dro...   209  0.0023    1
A cbil|dbest|1075777 AA431206 zw76h01.s1 3' Lib=628[Homo_sa...   208  0.0023    1
A cbil|dbest|1186276 AA540228 LD19642.5prime 5' Lib=594[Dro...   210  0.0023    1
A cbil|dbest|1186456 AA540408 LD19891.5prime 5' Lib=594[Dro...   209  0.0023    1
A cbil|dbest|1085104 AA440810 LD15692.5prime 5' Lib=594[Dro...   207  0.0023    1
A cbil|dbest|1085190 AA440896 LD15988.5prime 5' Lib=594[Dro...   209  0.0023    1
A cbil|dbest|1085764 AA441470 LD16418.5prime 5' Lib=594[Dro...   209  0.0023    1
A cbil|dbest|1186750 AA540702 LD20478.5prime 5' Lib=594[Dro...   209  0.0023    1
A cbil|dbest|1031780 AA390421 LD09350.5prime 5' Lib=594[Dro...   207  0.0024    1
A cbil|dbest|1185654 AA539090 LD18793.5prime 5' Lib=594[Dro...   209  0.0024    1
A cbil|dbest|841925 AA202867 LD03211.5prime 5' Lib=594[Dro...   209  0.0024    1
A cbil|dbest|1085639 AA441345 LD16242.5prime 5' Lib=594[Dro...   209  0.0025    1
A cbil|dbest|1085934 AA441640 LD16639.5prime 5' Lib=594[Dro...   209  0.0025    1
A cbil|dbest|1033037 AA391687 LD11620.5prime 5' Lib=594[Dro...   209  0.0025    1
A cbil|dbest|1082704 AA438407 LD12681.5prime 5' Lib=594[Dro...   209  0.0025    1
A cbil|dbest|1084647 AA440095 LD15176.5prime 5' Lib=594[Dro...   209  0.0025    1
A cbil|dbest|1181967 AA536362 LD16941.5prime 5' Lib=594[Dro...   209  0.0025    1
A cbil|dbest|1085700 AA441406 LD16327.5prime 5' Lib=594[Dro...   209  0.0025    1
A cbil|dbest|1082872 AA438575 LD12382.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1084460 AA440375 LD14958.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1181951 AA536346 LD16915.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1184798 AA539453 LD17584.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|841206 AA202132 LD02231.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1181830 AA536225 LD16708.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1181889 AA536284 LD16807.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1184902 AA539557 LD17745.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1402440 AA696165 GM05207.5prime 5prime Lib=105...   209  0.0026    1
A cbil|dbest|1186124 AA540076 LD19429.5prime 5' Lib=594[Dro...   207  0.0026    1
A cbil|dbest|1033761 AA392421 LD11275.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1084312 AA440158 LD14758.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1085611 AA441317 LD16207.5prime 5' Lib=594[Dro...   209  0.0026    1
A cbil|dbest|1082690 AA438393 LD12666.5prime 5' Lib=594[Dro...   209  0.0027    1
A cbil|dbest|1032360 AA391011 LD09916.5prime 5' Lib=594[Dro...   209  0.0027    1
A cbil|dbest|1084142 AA439845 LD14521.5prime 5' Lib=594[Dro...   209  0.0027    1
A cbil|dbest|1184939 AA539594 LD17796.5prime 5' Lib=594[Dro...   209  0.0027    1
A cbil|dbest|1083160 AA438863 LD13236.5prime 5' Lib=594[Dro...   209  0.0027    1
A cbil|dbest|1184744 AA539399 LD17502.5prime 5' Lib=594[Dro...   209  0.0027    1
A cbil|dbest|1185576 AA539005 LD18702.5prime 5' Lib=594[Dro...   209  0.0028    1
A cbil|dbest|1085344 AA441050 LD15822.5prime 5' Lib=594[Dro...   209  0.0028    1
A cbil|dbest|1185541 AA538970 LD18650.5prime 5' Lib=594[Dro...   209  0.0028    1
A cbil|dbest|1084369 AA440215 LD14833.5prime 5' Lib=594[Dro...   209  0.0029    1
A cbil|dbest|1184917 AA539572 LD17767.5prime 5' Lib=594[Dro...   208  0.0029    1
A cbil|dbest|1184695 AA539330 LD17408.5prime 5' Lib=594[Dro...   211  0.0029    1
A cbil|dbest|841509 AA202434 LD02620.5prime 5' Lib=594[Dro...   209  0.0029    1
A cbil|dbest|1182132 AA536527 LD17174.5prime 5' Lib=594[Dro...   209  0.0029    1
A cbil|dbest|1085823 AA441529 LD16504.5prime 5' Lib=594[Dro...   209  0.0029    1
A cbil|dbest|1402574 AA696299 GM05489.5prime 5prime Lib=105...   209  0.0029    1
A cbil|dbest|250621 R73763 yi55g01.r1 5' Lib=271[Homo_sapi...   204  0.0029    1
A cbil|dbest|841307 AA202214 LD02346.5prime 5' Lib=594[Dro...   204  0.0030    1
A cbil|dbest|1185766 AA539266 LD18947.5prime 5' Lib=594[Dro...   207  0.0030    1
A cbil|dbest|1184875 AA539530 LD17708.5prime 5' Lib=594[Dro...   209  0.0030    1
A cbil|dbest|1186026 AA539978 LD19290.5prime 5' Lib=594[Dro...   209  0.0030    1
A cbil|dbest|1185596 AA539025 LD18726.5prime 5' Lib=594[Dro...   207  0.0031    1
A cbil|dbest|1083459 AA439162 LD13643.5prime 5' Lib=594[Dro...   209  0.0031    1
A cbil|dbest|1184934 AA539589 LD17791.5prime 5' Lib=594[Dro...   209  0.0031    1
A cbil|dbest|1185466 AA538895 LD18545.5prime 5' Lib=594[Dro...   209  0.0031    1
A cbil|dbest|1185645 AA539081 LD18782.5prime 5' Lib=594[Dro...   209  0.0031    1
A cbil|dbest|1185200 AA538629 LD18205.5prime 5' Lib=594[Dro...   209  0.0031    1
A cbil|dbest|1185768 AA539268 LD18950.5prime 5' Lib=594[Dro...   209  0.0031    1
A cbil|dbest|1085900 AA441606 LD16588.5prime 5' Lib=594[Dro...   209  0.0032    1
A cbil|dbest|841216 AA202122 LD02242.5prime 5' Lib=594[Dro...   209  0.0032    1
A cbil|dbest|1082717 AA438420 LD12696.5prime 5' Lib=594[Dro...   209  0.0032    1
A cbil|dbest|1084590 AA440038 LD15113.5prime 5' Lib=594[Dro...   209  0.0032    1
A cbil|dbest|1085754 AA441460 LD16405.5prime 5' Lib=594[Dro...   209  0.0032    1
A cbil|dbest|1033916 AA392423 LD12805.5prime 5' Lib=594[Dro...   209  0.0032    1
A cbil|dbest|1033361 AA392021 LD10956.5prime 5' Lib=594[Dro...   209  0.0032    1
A cbil|dbest|1082999 AA438702 LD13035.5prime 5' Lib=594[Dro...   209  0.0033    1
A cbil|dbest|1186749 AA540701 LD20477.5prime 5' Lib=594[Dro...   209  0.0033    1
A cbil|dbest|1186967 AA540919 LD20110.5prime 5' Lib=594[Dro...   209  0.0033    1
A cbil|dbest|1185085 AA539740 LD18060.5prime 5' Lib=594[Dro...   203  0.0033    1
A cbil|dbest|1083600 AA439303 LD13833.5prime 5' Lib=594[Dro...   209  0.0033    1
A cbil|dbest|1184763 AA539418 LD17532.5prime 5' Lib=594[Dro...   209  0.0034    1
A cbil|dbest|1182030 AA536425 LD17033.5prime 5' Lib=594[Dro...   209  0.0034    1
A cbil|dbest|841821 AA202763 LD03041.5prime 5' Lib=594[Dro...   210  0.0034    1
A cbil|dbest|1084231 AA439934 LD14645.5prime 5' Lib=594[Dro...   209  0.0034    1
A cbil|dbest|1186151 AA540103 LD19468.5prime 5' Lib=594[Dro...   207  0.0034    1
A cbil|dbest|1032318 AA390808 LD09793.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1033896 AA392557 LD11461.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1084412 AA440258 LD14902.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1084414 AA440260 LD14904.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1084970 AA440676 LD15536.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1184871 AA539526 LD17702.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|841406 AA202323 LD02481.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1184914 AA539569 LD17764.5prime 5' Lib=594[Dro...   203  0.0035    1
A cbil|dbest|841614 AA202395 LD02210.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1185078 AA539733 LD18051.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1185801 AA539301 LD18988.5prime 5' Lib=594[Dro...   209  0.0035    1
A cbil|dbest|1034015 AA392665 LD11443.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1083775 AA439478 LD14061.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1084573 AA440021 LD15090.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1085827 AA441533 LD16508.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1084406 AA440252 LD14889.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1184835 AA539490 LD17643.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1185107 AA539762 LD18087.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|841415 AA202341 LD02492.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1084509 AA440424 LD15017.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1033942 AA392583 LD12832.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1084519 AA439967 LD15029.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1085874 AA441580 LD16559.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1032892 AA391554 LD10555.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1185802 AA539302 LD18989.5prime 5' Lib=594[Dro...   209  0.0036    1
A cbil|dbest|1185479 AA538908 LD18564.5prime 5' Lib=594[Dro...   204  0.0036    1
A cbil|dbest|1085872 AA441578 LD16557.5prime 5' Lib=594[Dro...   209  0.0037    1
A cbil|dbest|1184909 AA539564 LD17756.5prime 5' Lib=594[Dro...   209  0.0037    1
A cbil|dbest|1185798 AA539298 LD18984.5prime 5' Lib=594[Dro...   209  0.0037    1
A cbil|dbest|841556 AA202471 LD01933.5prime 5' Lib=594[Dro...   209  0.0037    1
A cbil|dbest|841529 AA202444 LD02641.5prime 5' Lib=594[Dro...   209  0.0037    1
A cbil|dbest|841517 AA202311 LD02628.5prime 5' Lib=594[Dro...   209  0.0037    1
A cbil|dbest|1185933 AA539885 LD19174.5prime 5' Lib=594[Dro...   209  0.0037    1
A cbil|dbest|1402927 AA696652 GM08068.5prime 5prime Lib=105...   209  0.0038    1
A cbil|dbest|1184816 AA539471 LD17619.5prime 5' Lib=594[Dro...   209  0.0038    1
A cbil|dbest|1033023 AA391664 LD11606.5prime 5' Lib=594[Dro...   209  0.0038    1
A cbil|dbest|1084548 AA439996 LD15060.5prime 5' Lib=594[Dro...   209  0.0038    1
A cbil|dbest|1082705 AA438408 LD12682.5prime 5' Lib=594[Dro...   209  0.0038    1
A cbil|dbest|1185906 AA539858 LD19138.5prime 5' Lib=594[Dro...   209  0.0038    1
A cbil|dbest|1032404 AA391073 LD09922.5prime 5' Lib=594[Dro...   209  0.0039    1
A cbil|dbest|841541 AA202371 LD02656.5prime 5' Lib=594[Dro...   209  0.0039    1
A cbil|dbest|1084214 AA439917 LD14621.5prime 5' Lib=594[Dro...   209  0.0039    1
A cbil|dbest|1084468 AA440383 LD14966.5prime 5' Lib=594[Dro...   209  0.0040    1
A cbil|dbest|841538 AA202368 LD02652.5prime 5' Lib=594[Dro...   209  0.0040    1
A cbil|dbest|1185590 AA539019 LD18718.5prime 5' Lib=594[Dro...   209  0.0040    1
A cbil|dbest|1084453 AA440368 LD14949.5prime 5' Lib=594[Dro...   209  0.0040    1
A cbil|dbest|1185658 AA539094 LD18805.5prime 5' Lib=594[Dro...   201  0.0040    1
A cbil|dbest|1084340 AA440186 LD14796.5prime 5' Lib=594[Dro...   209  0.0041    1
A cbil|dbest|1033115 AA391785 LD11515.5prime 5' Lib=594[Dro...   208  0.0041    1
A cbil|dbest|1185714 AA539214 LD18880.5prime 5' Lib=594[Dro...   209  0.0041    1
A cbil|dbest|1033346 AA392007 LD10940.5prime 5' Lib=594[Dro...   209  0.0041    1
A cbil|dbest|1083593 AA439296 LD13826.5prime 5' Lib=594[Dro...   209  0.0041    1
A cbil|dbest|1184930 AA539585 LD17784.5prime 5' Lib=594[Dro...   209  0.0041    1
A cbil|dbest|1185523 AA538952 LD18631.5prime 5' Lib=594[Dro...   209  0.0042    1
A cbil|dbest|1187145 AA541097 LD20891.5prime 5' Lib=594[Dro...   209  0.0042    1
A cbil|dbest|841885 AA202818 LD03150.5prime 5' Lib=594[Dro...   201  0.0042    1
A cbil|dbest|841055 AA201936 LD04065.5prime 5' Lib=594[Dro...   201  0.0042    1
A cbil|dbest|1085477 AA441183 LD16085.5prime 5' Lib=594[Dro...   201  0.0042    1
A cbil|dbest|1181900 AA536295 LD16825.5prime 5' Lib=594[Dro...   205  0.0042    1
A cbil|dbest|1185760 AA539260 LD18941.5prime 5' Lib=594[Dro...   209  0.0042    1
A cbil|dbest|1185544 AA538973 LD18656.5prime 5' Lib=594[Dro...   209  0.0042    1
A cbil|dbest|841539 AA202369 LD02653.5prime 5' Lib=594[Dro...   209  0.0042    1
A cbil|dbest|1186960 AA540912 LD20101.5prime 5' Lib=594[Dro...   209  0.0042    1
A cbil|dbest|1083170 AA438873 LD13252.5prime 5' Lib=594[Dro...   209  0.0043    1
A cbil|dbest|1185772 AA539272 LD18954.5prime 5' Lib=594[Dro...   209  0.0043    1
A cbil|dbest|1084206 AA439909 LD14604.5prime 5' Lib=594[Dro...   204  0.0043    1
A cbil|dbest|1084543 AA439991 LD15054.5prime 5' Lib=594[Dro...   204  0.0043    1
A cbil|dbest|1182085 AA536480 LD17022.5prime 5' Lib=594[Dro...   204  0.0043    1
A cbil|dbest|841515 AA202309 LD02626.5prime 5' Lib=594[Dro...   209  0.0043    1
A cbil|dbest|1082957 AA438660 LD12980.5prime 5' Lib=594[Dro...   209  0.0043    1
A cbil|dbest|1185079 AA539734 LD18052.5prime 5' Lib=594[Dro...   209  0.0043    1
A cbil|dbest|1033373 AA392014 LD10971.5prime 5' Lib=594[Dro...   209  0.0044    1
A cbil|dbest|1083218 AA438921 LD13318.5prime 5' Lib=594[Dro...   209  0.0044    1
A cbil|dbest|1185675 AA539111 LD18828.5prime 5' Lib=594[Dro...   201  0.0045    1
A cbil|dbest|1185805 AA539305 LD18993.5prime 5' Lib=594[Dro...   209  0.0045    1
A cbil|dbest|1185579 AA539008 LD18705.5prime 5' Lib=594[Dro...   209  0.0045    1
A cbil|dbest|1085852 AA441558 LD16535.5prime 5' Lib=594[Dro...   209  0.0045    1
A cbil|dbest|1084157 AA439860 LD14539.5prime 5' Lib=594[Dro...   209  0.0046    1
A cbil|dbest|1187011 AA540963 LD20172.5prime 5' Lib=594[Dro...   209  0.0047    1
A cbil|dbest|1186115 AA540067 LD19417.5prime 5' Lib=594[Dro...   200  0.0047    1
A cbil|dbest|1200110 AA550100 1199m3  Lib=9[Plasmo...   206  0.0048    1
A cbil|dbest|1084488 AA440403 LD14991.5prime 5' Lib=594[Dro...   209  0.0048    1
A cbil|dbest|1085420 AA441126 LD16019.5prime 5' Lib=594[Dro...   204  0.0050    1
A cbil|dbest|1182293 AA536603 LD17367.5prime 5' Lib=594[Dro...   201  0.0050    1
A cbil|dbest|1033396 AA391903 LD10995.5prime 5' Lib=594[Dro...   209  0.0050    1
A cbil|dbest|1082979 AA438682 LD13009.5prime 5' Lib=594[Dro...   209  0.0051    1
A cbil|dbest|1185642 AA539078 LD18778.5prime 5' Lib=594[Dro...   209  0.0051    1
A cbil|dbest|1185588 AA539017 LD18715.5prime 5' Lib=594[Dro...   209  0.0052    1
A cbil|dbest|1033693 AA392218 LD11205.5prime 5' Lib=594[Dro...   201  0.0053    1
A cbil|dbest|1033087 AA391737 LD11675.5prime 5' Lib=594[Dro...   209  0.0054    1
A cbil|dbest|1084335 AA440181 LD14790.5prime 5' Lib=594[Dro...   204  0.0054    1
A cbil|dbest|841871 AA202822 LD03135.5prime 5' Lib=594[Dro...   199  0.0055    1
A cbil|dbest|1085064 AA440770 LD15644.5prime 5' Lib=594[Dro...   201  0.0055    1
A cbil|dbest|1084743 AA440446 LD15292.5prime 5' Lib=594[Dro...   201  0.0055    1
A cbil|dbest|1184626 AA539123 LD17210.5prime 5' Lib=594[Dro...   201  0.0056    1
A cbil|dbest|1185965 AA539917 LD19217.5prime 5' Lib=594[Dro...   201  0.0056    1
A cbil|dbest|1084652 AA440100 LD15181.5prime 5' Lib=594[Dro...   201  0.0057    1
A cbil|dbest|1084971 AA440677 LD15537.5prime 5' Lib=594[Dro...   201  0.0057    1
A cbil|dbest|1185782 AA539282 LD18966.5prime 5' Lib=594[Dro...   204  0.0057    1
A cbil|dbest|1084514 AA440429 LD15022.5prime 5' Lib=594[Dro...   201  0.0057    1
A cbil|dbest|1186056 AA540008 LD19329.5prime 5' Lib=594[Dro...   201  0.0057    1
A cbil|dbest|1033432 AA392064 LD12438.5prime 5' Lib=594[Dro...   204  0.0058    1
A cbil|dbest|1084275 AA440121 LD14712.5prime 5' Lib=594[Dro...   201  0.0058    1
A cbil|dbest|1181869 AA536264 LD16767.5prime 5' Lib=594[Dro...   204  0.0059    1
A cbil|dbest|1034012 AA392662 LD11433.5prime 5' Lib=594[Dro...   204  0.0059    1
A cbil|dbest|1185499 AA538928 LD18601.5prime 5' Lib=594[Dro...   201  0.0059    1
A cbil|dbest|1184635 AA539132 LD17220.5prime 5' Lib=594[Dro...   201  0.0059    1
A cbil|dbest|1185697 AA539197 LD18857.5prime 5' Lib=594[Dro...   202  0.0060    1
A cbil|dbest|1084294 AA440140 LD14735.5prime 5' Lib=594[Dro...   209  0.0061    1
A cbil|dbest|1032719 AA391361 LD10251.5prime 5' Lib=594[Dro...   201  0.0062    1
A cbil|dbest|284552 H24041 ym54a08.s1 3' Lib=263[Homo_sapi...   198  0.0062    1


WARNING:  Descriptions of 215 database sequences were not reported due to the
          limiting value of parameter V = 250.



>cbil|dbest|752260 AA114374 MBAFCE3A08T3 5' Lib=531[Brugia_malayi|||||adult]
            Length=343
            Length = 343

  Plus Strand HSPs:

 Score = 1715 (257.3 bits), Expect = 2.0e-71, P = 2.0e-71
 Identities = 343/343 (100%), Positives = 343/343 (100%), Strand = Plus / Plus

Query:     1 ATTTTTTTTTTATTCCAAACTTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAA 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 ATTTTTTTTTTATTCCAAACTTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAA 60

Query:    61 ACCTATTAATAAATTTAATTACCCCGGCAAAGGCACAAAAAACAACCCTCCCCAACATCA 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 ACCTATTAATAAATTTAATTACCCCGGCAAAGGCACAAAAAACAACCCTCCCCAACATCA 120

Query:   121 TACAACATACCAATTATTTAACAGGTATGGATTTTACAAAAACACGGTATTATTTTTTAT 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 TACAACATACCAATTATTTAACAGGTATGGATTTTACAAAAACACGGTATTATTTTTTAT 180

Query:   181 TTTGTAAAAATATCACATCCCAAAATTTGTTTCTACAAAAAAAATACCACTAAAAAACCC 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 TTTGTAAAAATATCACATCCCAAAATTTGTTTCTACAAAAAAAATACCACTAAAAAACCC 240

Query:   241 TTTTTCAAAACTGTTGCAACATGAAAAAAACCTTAAAAATAAATATTACAAATTTCTGCC 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 TTTTTCAAAACTGTTGCAACATGAAAAAAACCTTAAAAATAAATATTACAAATTTCTGCC 300

Query:   301 CTGCTTCTATCAAAGCAAAAATAATCAATTTTTAAACTGGAAA 343
             |||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 CTGCTTCTATCAAAGCAAAAATAATCAATTTTTAAACTGGAAA 343


>cbil|dbest|504578 N97744 1186C3  Lib=114[Plasmodium_falciparum|||||]
            Length=283
            Length = 283

  Minus Strand HSPs:

 Score = 270 (40.5 bits), Expect = 4.5e-06, P = 4.5e-06
 Identities = 140/225 (62%), Positives = 140/225 (62%), Strand = Minus / Plus

Query:   336 TTTAAAA-ATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTGTAATATTTATT 278
             TTTAAAA A T  TTATTTTT  TTT  TA          A  AA     AA ATT ATT
Sbjct:    60 TTTAAAATAATTTTTATTTTTATTTTT-TATTTTTTTAAAATTAAAAAAAAAAATTAATT 118

Query:   277 TTTAAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTTTTTTAGTGGTATTTTTTT 218
             TTTAA  TTTTT T  T TT  AA A TTT G AAA G  TTTTT   T  TA TTTTT 
Sbjct:   119 TTTAAAATTTTTATTTTTTTTAAA-A-TTTAGTAAA-GAATTTTTCTTTAATAATTTTTA 175

Query:   217 -TGTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAATACCGTGTTTT 159
              T TA A A AA TTTT   AT T A  TTTTTA A AA AA A ATA T  C TGTTTT
Sbjct:   176 ATATATATATAATTTTTTATATAT-ACCTTTTTA-ATAA-AAGATATATTTACTTGTTTT 232

Query:   158 TGTAAAA-TCCATACCTGTTAAATAATTGGTATGTTGTATGATGTTGG 112
             TGTAAAA T  ATA  T TT A TA TT  TAT TT T T  T TTGG
Sbjct:   233 TGTAAAAATAAATAA-TCTTTATTA-TTC-TATCTTATTTTTTATTGG 277


>cbil|dbest|560011 W52385 zc48a10.s1 3'
            Lib=423[Homo_sapiens||senescent_fibroblast|||] Length=449
            Length = 449

  Plus Strand HSPs:

 Score = 260 (39.0 bits), Expect = 8.0e-06, P = 8.0e-06
 Identities = 196/335 (58%), Positives = 196/335 (58%), Strand = Plus / Plus

Query:     2 TTTTTTTTTTATTCCAAACTTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAAA 61
             TTTTTTTTTT TT  AAA  TT  ATTT  T     T   AT  A TA  AAAAT  AAA
Sbjct:     4 TTTTTTTTTTTTTTTAAAAATTATATTTAATACAAATAA-ATAAATTAA-AAAATCTAAA 61

Query:    62 CCTATTAATAAATTTAAT-TACCCCGGCAAAGGCACAAAAAACA-ACCCTCCCCAACATC 119
               TATTA TAAA   AAT TAC C   CAAA   A AA   ACA A       CA  ATC
Sbjct:    62 A-TATTA-TAAAAC-AATATACACAA-CAAATAAATAATTTACACAAAAAAATCAT-ATC 116

Query:   120 ATACA--ACATACCAATTATTTAACAGGTATGGATTTTACAAAAACACGGTATTATTTTT 177
              TACA  ACATA CA T AT TAA A   A   A TT A A AAA  C  TA TA T   
Sbjct:   117 -TACATTACATAACACT-ATCTAATATAAAAATACTTAAAATAAATCCAATAATAATAAA 174

Query:   178 TATTTTGTAAAAATATCACATCCCAAAATTTGTTTCTACAAAAAAAATACCACTA-AAAA 236
              A   T  A AAA AT AC   CC A  TT   TT TA AAAA  A T C A TA AAAA
Sbjct:   175 AAAAATCCATAAAAAT-ACTAACCTATCTTCCCTTATATAAAATTATT-CAAATATAAAA 232

Query:   237 ACCCTTTTTCAAAACTGTTGCAACATGAAAAAAACCTTAAAAATAAATATTACAAATTTC 296
             A CC  T  CAA A T     AA AT  AA   A  TTAAAAATAAA ATTACAAAT T 
Sbjct:   233 ATCCAATA-CAATA-TAAAATAATATTCAATTTAATTTAAAAATAAAAATTACAAATAT- 289

Query:   297 TGCCCTGCTTCTATCAAAGCAAAAATAA-TCAATTTTTAAA 336
             T C  T  TTC A  AAA  AAA  TAA  CAA  TTTAAA
Sbjct:   290 TACAAT--TTCAAAAAAA--AAATNTAAANCAACATTTAAA 326


>cbil|dbest|504799 N97949 1710C3  Lib=114[Plasmodium_falciparum|||||]
            Length=391
            Length = 391

  Plus Strand HSPs:

 Score = 228 (34.2 bits), Expect = 0.00026, P = 0.00026
 Identities = 166/284 (58%), Positives = 166/284 (58%), Strand = Plus / Plus

Query:     2 TTTTTTTTTTATTCCAA-ACTTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAA 60
             TTTTTTTTTTATT  AA A TTTT  TTTTTTCTTTTT CC  C  ATATG A  TAA  
Sbjct:     7 TTTTTTTTTTATTTAAATAATTTTTTTTTTTTCTTTTTACCC-CTTATATGTA--TAAGG 63

Query:    61 ACCTATTAATAAATTTAATTACCCCGGCAAAGGCACAAAAAACAACCCTCCCCAACATCA 120
              C TA T AT A TTT A  A      CAAA   A A   A C A  C     A     A
Sbjct:    64 TCTTAATTATTATTTTTACAAATATATCAAATT-ATATTTACCTATACATAGTATTTAAA 122

Query:   121 TACAA-CATACCAATTATTTAACAGGTATGGATTTTACAAAAACACGGTAT-T-ATTTTT 177
             TA A  CATAC A TTAT T A AG T    ATTTT     A    G TAT T AT  T 
Sbjct:   123 TAGATTCATAC-ATTTATATTA-AGTTTACCATTTTGATTTATTTTGTTATATGATAATA 180

Query:   178 TATTTT-GTAAA-AATATCAC-ATCC-CAAAATTTGTTTCTACAAAAAAA-ATACCACTA 232
             TA T   G AAA AATATC   AT   CA AA TT TTT  AC AAAA   A A  A T 
Sbjct:   181 TAATACAGAAAATAATATCTTTATGAACACAAGTTATTTACACGAAAATCCAGAAGA-TC 239

Query:   233 AAAAACCCTTTTTCAAAACTGTTGCA-ACATGAAAAAAACCTTAAAAATAA 282
             A A AC  T TTT A A   GT GCA A AT AA AAA    TAAAAATAA
Sbjct:   240 ATACACAGTATTTTATAGGAGTAGCATAAATAAATAAATAAATAAAAATAA 290

 Score = 212 (31.8 bits), Expect = 0.0014, P = 0.0014
 Identities = 196/342 (57%), Positives = 196/342 (57%), Strand = Plus / Plus

Query:     2 TTTTTTTTTTATTCCAA-ACTTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAA 60
             TTTTTTTTTTATT  AA A TTTT  TTTTTTCTTTTT CC  C  ATATG A  TAA  
Sbjct:     7 TTTTTTTTTTATTTAAATAATTTTTTTTTTTTCTTTTTACCC-CTTATATGTA--TAAGG 63

Query:    61 ACCTATTAATAAATTTAATTACCCCGGCAAAGGCACAAAAAACAACCCTCCCCAACATCA 120
              C TA T AT A TTT  TTAC      A A  CA A  A A    CCT   CA   T A
Sbjct:    64 TCTTAATTATTA-TTT--TTACAAAT--ATAT-CAAATTATATTTACCTATACATAGT-A 116

Query:   121 TACAACATACCAATTATTTAACAGGTATGGATTTTACAAAAACACGGTATTATTTTTTAT 180
             T  AA ATA   ATT  T  A    TAT  A TTTAC A        TATT T TT TAT
Sbjct:   117 TTTAA-ATAG--ATTCATACATTTATATTAAGTTTACCATTTTGATTTATTTTGTTATAT 173

Query:   181 TTTGTAAAAATATCACATCCCAAAATTTGTTTCTACAAAAAAAATAC-CACTAAAAAACC 239
               T   A AATA CA A    AA AT T T T  ACA AA   AT   CAC AAAA  C 
Sbjct:   174 GATAATATAATA-CAGAAAATAATATCTTTATGAACACAAGTTATTTACACGAAAATCCA 232

Query:   240 CTTTTTCAAA-ACTGT-TGCAACATGAAAAAAACCTTAA-AAATAAATAT-TACAAATTT 295
                  TCA A AC GT T   A A GA  A  A  T AA AAATAAATA  TA AAAT  
Sbjct:   233 GAAGATCATACACAGTATTTTATAGGAGTAGCA--TAAATAAATAAATAAATAAAAATAA 290

Query:   296 CTGCCCTGCTTCTATCAAAGCAAAAATAATCAATTTTTAAAC-TGGAAA 343
              T CC T C  CT T AAAG   A A AAT  ATTT TA A  T GAAA
Sbjct:   291 -TACCGTACCGCTGT-AAAGTGTATA-AATATATTTATATATATAGAAA 336


>cbil|dbest|1148783 AA504130 aa59c07.s1 3'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=455
            Length = 455

  Plus Strand HSPs:

 Score = 226 (33.9 bits), Expect = 0.00027, P = 0.00027
 Identities = 140/236 (59%), Positives = 140/236 (59%), Strand = Plus / Plus

Query:    21 TTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAAACCTATTAATAAATTTAATT 80
             TTTTAATTTTTT TTTTTTC  T  AA AT A  ATA A A  T TTAAT   T TA  T
Sbjct:    10 TTTTAATTTTTTTTTTTTTCATTAAAACATAATTATACAGATATTTTAATTG-TATATAT 68

Query:    81 ACCCCGGCAAA-GGCACAAAAAACA-ACCCTCCCCAACATCATACAACATACCAATTATT 138
             A C  GG A A GG A AAAA  C  AC CTC   AACAT A A   CA A  AAT A  
Sbjct:    69 ATCA-GGTACACGGAATAAAAGTCCTACTCTCTAGAACATGAGAAGTCA-ATAAAT-AGA 125

Query:   139 TAACAGGTATGGATTTTACAAAAACACGGTATTATTTTTTATTTTGTAAAAATATCACAT 198
              AA AG TAT  A   T  AA  A AC   A  AT   T A   TGT A   T TCACAT
Sbjct:   126 -AA-AGATATACAAAGTGGAATGA-ACATAAAAATGACTAAGCATGTGATC-T-TCACAT 180

Query:   199 CCCAAAATTTGTTTCTACAAAAAAAATACCACTAAAAAACCCTTT-TTCAAAACTGTTG 256
              C  A A TT TTTC AC AA     TAC A TAAAAA  C TTT TT  AAACTGT G
Sbjct:   181 TCATACAGTT-TTTCAACTAATCTTTTACAATTAAAAAGTCATTTATTTGAAACTGTAG 238


>cbil|dbest|1083347 AA439050 LD13488.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=397
            Length = 397

  Minus Strand HSPs:

 Score = 219 (32.9 bits), Expect = 0.00065, P = 0.00065
 Identities = 187/320 (58%), Positives = 187/320 (58%), Strand = Minus / Plus

Query:   336 TTTA-AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTA 280
             T TA AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTA
Sbjct:     4 TCTATAAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTA 62

Query:   279 TTTTTAAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTT 221
             TT  TA  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TT
Sbjct:    63 TTAGTATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATT 120

Query:   220 TTTTGTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGT 162
             T  T TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T T
Sbjct:   121 TAATTTATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TAT 174

Query:   161 TTTTGTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTG 103
             TTTT T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT 
Sbjct:   175 TTTTCTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTA 232

Query:   102 TTTTTTGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATT 46
             T  T T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA  
Sbjct:   233 TAATAT-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAG 289

Query:    45 GGATGGAAAAAAGAAA-AAATTAAAAGTTT 17
               AT GA   AA   A AAATTA AA TTT
Sbjct:   290 ACATAGATTTAACTTAGAAATTATAAATTT 319


>cbil|dbest|1084310 AA440156 LD14756.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=448
            Length = 448

  Minus Strand HSPs:

 Score = 218 (32.7 bits), Expect = 0.00067, P = 0.00067
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    18 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 76

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    77 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 134

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   135 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 188

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   189 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 246

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G C  G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   247 T-TATATTAGACATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGACATA 303

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   304 AATTTAATTTAGAAATTATAAATTT 328


>cbil|dbest|1084754 AA440457 LD15308.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=449
            Length = 449

  Minus Strand HSPs:

 Score = 218 (32.7 bits), Expect = 0.00068, P = 0.00068
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    18 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 76

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    77 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 134

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   135 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 188

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   189 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 246

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G C  G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   247 T-TATATTAGACATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGACATA 303

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   304 AATTTAATTTAGAAATTATAAATTT 328


>cbil|dbest|1184896 AA539551 LD17735.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=414
            Length = 414

  Minus Strand HSPs:

 Score = 218 (32.7 bits), Expect = 0.00069, P = 0.00069
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G C  G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGACATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATGTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1085763 AA441469 LD16416.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=400
            Length = 400

  Minus Strand HSPs:

 Score = 218 (32.7 bits), Expect = 0.00071, P = 0.00071
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT      CA  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGACAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|772344 AA132477 zo17a07.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=471 Author_cmt: contains Alu repetitive element;
            Length = 471

  Plus Strand HSPs:

 Score = 218 (32.7 bits), Expect = 0.00085, P = 0.00085
 Identities = 136/215 (63%), Positives = 136/215 (63%), Strand = Plus / Plus

Query:     4 TTTTTTTTATTCCAAACTTTTA-AT-TTTTTCTTTTTTCCATCCAATATGAAAATAA--A 59
             TTTTTTTT TT  AAA TT  A AT TTTTT TTT TT  AT  A TATGAA ATAA  A
Sbjct:     1 TTTTTTTTTTTTTAAAATTCAACATATTTTTATTTGTTAAAT--A-TATGAATATAATTA 57

Query:    60 AACCTATTAATAAATTTAATTACCCCGG-CAAAGGCACAAAAAACA-ACCCTCCCCA-AC 116
             AA  TATT  T  A T AA T   C GG CAAA  C  A A AACA ACC T  CCA AC
Sbjct:    58 AATATATTCCTTCAGTAAACTGAACTGGACAAAA-CT-AGAGAACAGACCTTTTCCATAC 115

Query:   117 ATCATACAACATACCAATTATTTAACAGGTATGGATTTTACAAAAACACGGTATTATTTT 176
              TCAT  AAC T   AAT AT T AC   T TG ATT TAC A A  AC  T TTA  T 
Sbjct:   116 -TCATTTAACTTTAAAATGATATTACT--T-TGAATTCTACTACAT-ACCATCTTAGATC 170

Query:   177 TTATTTTGTAAAAATAT-CACATCCCAAAATTTGTTTCTACAA 218
              T TTTTG AA    AT CACAT  CA     T TT CTA AA
Sbjct:   171 CTGTTTTGAAATTCCATTCACATTACATTCGAT-TTACTAGAA 212


>cbil|dbest|1085603 AA441309 LD16194.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=476
            Length = 476

  Minus Strand HSPs:

 Score = 218 (32.7 bits), Expect = 0.00089, P = 0.00089
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TAC  T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATACT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 239

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   240 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 296

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   297 AATTTAATTTAGAAATTATAAATTT 321


>cbil|dbest|1034217 AA392869 LD12007.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=368
            Length = 368

  Minus Strand HSPs:

 Score = 216 (32.4 bits), Expect = 0.00095, P = 0.00095
 Identities = 182/316 (57%), Positives = 182/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    15 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 73

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    74 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 131

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   132 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 185

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T    A   TT  T  T
Sbjct:   186 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAA-ATTATTTATAAT 242

Query:    97 TGTGCCTTTGCCGGGGTAATTAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
               T   TT G    G TA  T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   243 ACTATATTAGAAATGATATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 301

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   302 ATTTAATTTAGAAATTATAAATTT 325


>cbil|dbest|1185178 AA538607 LD18175.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=454
            Length = 454

  Minus Strand HSPs:

 Score = 215 (32.3 bits), Expect = 0.0010, P = 0.0010
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G     G AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAACATGAAATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1185452 AA538881 LD18523.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=378
            Length = 378

  Minus Strand HSPs:

 Score = 213 (32.0 bits), Expect = 0.0013, P = 0.0013
 Identities = 187/316 (59%), Positives = 187/316 (59%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    35 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 93

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGT-G-GTATTTTTTT 218
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G G ATTT  TT
Sbjct:    94 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAGAATTTAATT 151

Query:   217 TGTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTT 159
             T T G A C    TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTT
Sbjct:   152 TATTGTACC----TT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTT 203

Query:   158 TGTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTT 100
             T T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  
Sbjct:   204 TCTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAA 261

Query:    99 TTTGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGA 43
             T T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    A
Sbjct:   262 TAT-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAA 318

Query:    42 TGGAAAAAAGAAA-AAATTAAAAGTTT 17
             T  A   AA   A AAATTA AA TTT
Sbjct:   319 TAAATTTAATTTAGAAATTATAAATTT 345


>cbil|dbest|1185936 AA539888 LD19180.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=541
            Length = 541

  Minus Strand HSPs:

 Score = 218 (32.7 bits), Expect = 0.0013, P = 0.0013
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    27 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 85

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT T     A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    86 ATTGTATAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 143

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   144 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 197

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   198 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 255

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   256 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 312

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   313 AATTTAATTTAGAAATTATAAATTT 337


>cbil|dbest|1114052 C24389 C24389 
            Lib=635[Dictyostelium_discoideum|||||] Length=241
            Length = 241

  Plus Strand HSPs:

 Score = 217 (32.6 bits), Expect = 0.0013, P = 0.0013
 Identities = 121/208 (58%), Positives = 121/208 (58%), Strand = Plus / Plus

Query:    30 TTTCTTTTTTCCATCCAATATGAAAATAAAA-ACCTATTAATAAATTTAATTACCCCGGC 88
             TTTC   TT  CAT  A TAT A A TA AA A  TATTA TA A T AAT ACC C  C
Sbjct:    15 TTTCACATTCTCATT-ATTATCAGA-TACAACAAATATTACTATAGT-AAT-ACCTCAAC 70

Query:    89 AAAGGCACAAAAAACAACCCTCCCCAACATCATACAACATACCAATTATTTAACAGGTAT 148
             AA  GCA  AA AACAA   T  C AA  T A A   CAT   AATTATTT A A   A 
Sbjct:    71 AACAGCAACAACAACAAGTTTATC-AAGTTTAAATTCCATTGGAATTATTTTAAAAAAAA 129

Query:   149 GGATTTTACAAAAACACGGTATTATTTTTTATTTTGTAAAAATATCACATCCCAAAATTT 208
               A    A AAAA   C  T TTATTTTTTATTT  TAAAAA A  A A    AAAA   
Sbjct:   130 AAAACAAATAAAATTTCTTTTTTATTTTTTATTTATTAAAAAAAAAAAAAAAAAAAAAAA 189

Query:   209 GTTTCTACAAAAAAAATACCACTAAAAAA 237
                   A AAAAAAAA A  A  AAAAAA
Sbjct:   190 AAAAAAAAAAAAAAAAAAAAAAAAAAAAA 218


>cbil|dbest|1179186 AA534546 nf77a07.s1 
            Lib=882[Homo_sapiens||colon|||] Length=223
            Length = 223

  Plus Strand HSPs:

 Score = 216 (32.4 bits), Expect = 0.0016, P = 0.0016
 Identities = 124/198 (62%), Positives = 124/198 (62%), Strand = Plus / Plus

Query:     2 TTTTTTTTTTATTCCAAACTTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAAA 61
             TTTTTTTTTTATT  AAACTT TA  TTTT CTTT  T C T CA  ATG  AATAAAAA
Sbjct:     4 TTTTTTTTTTATT--AAACTTGTACATTTTACTTTCCTTCTTTCAGAATGCTAATAAAAA 61

Query:    62 C-CTATTAATAA-ATTTAATTACCCCGGCAA--AGGCACAAAAAACAACCCTCCCCAACA 117
               CT TT  T A A TTAA  A  CC   AA  AG CA A AAAA AA C    CCAACA
Sbjct:    62 AACTTTTGTTTATACTTAAAAAAACCATAAATCAGACAAACAAAAGAAACGATTCCAACA 121

Query:   118 TCATACAACATACCAATTATTTAACAGGTA-TGGATTTTA-CAAAAACACGGTATTATTT 175
             TCA  C  C T   A T A   AA AGG A TGGA TT A CA AA CA  G A  A T 
Sbjct:   122 TCA--CTTC-TGTGA-TGAGAAAAGAGGCAATGGAATTCAACATAAGCAAAGAAA-ACTC 176

Query:   176 TTTATTTTGTAAAAATATCACATC 199
             T   T   G AAA A ATC  ATC
Sbjct:   177 TACCTGGAGGAAAGAAATCG-ATC 199


>cbil|dbest|1185823 AA539367 LD19020.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=429
            Length = 429

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0017, P = 0.0017
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     3 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 61

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    62 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 119

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   120 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 173

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   174 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 231

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   232 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 288

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   289 AATTTAATTTAGAAATTATAAATTT 313


>cbil|dbest|1085261 AA440967 LD12786.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=428
            Length = 428

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0017, P = 0.0017
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    27 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 85

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    86 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 143

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   144 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 197

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   198 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 255

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   256 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 312

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   313 AATTTAATTTAGAAATTATAAATTT 337


>cbil|dbest|1084648 AA440096 LD15177.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=426
            Length = 426

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0017, P = 0.0017
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    13 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 71

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    72 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 129

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   130 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 183

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   184 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 241

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   242 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 298

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   299 AATTTAATTTAGAAATTATAAATTT 323


>cbil|dbest|1033387 AA392038 LD10986.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=425
            Length = 425

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0017, P = 0.0017
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1185686 AA539186 LD18840.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=431
            Length = 431

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0017, P = 0.0017
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   199 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 256

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   257 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 313

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   314 AATTTAATTTAGAAATTATAAATTT 338


>cbil|dbest|1082909 AA438612 LD12929.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=418
            Length = 418

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0017, P = 0.0017
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTACGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1185669 AA539105 LD18820.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=432
            Length = 432

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0018, P = 0.0018
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1186906 AA540858 LD20685.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=432
            Length = 432

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0018, P = 0.0018
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   262 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 318

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   319 CATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|1085358 AA441064 LD15842.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=434
            Length = 434

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0018, P = 0.0018
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 239

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   240 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 296

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   297 AATTTAATTTAGAAATTATAAATTT 321


>cbil|dbest|1085791 AA441497 LD16454.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=434
            Length = 434

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0018, P = 0.0018
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 239

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   240 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 296

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   297 AATTTAATTTAGAAATTATAAATTT 321


>cbil|dbest|1181943 AA536338 LD16901.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=435
            Length = 435

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0018, P = 0.0018
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    35 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 93

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    94 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 151

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   152 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 205

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   206 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 263

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   264 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 320

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   321 AATTTAATTTAGAAATTATAAATTT 345


>cbil|dbest|1185443 AA538872 LD18510.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=436
            Length = 436

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0018, P = 0.0018
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   262 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 318

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   319 AATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|1084641 AA440089 LD15170.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=543
            Length = 543

  Minus Strand HSPs:

 Score = 215 (32.3 bits), Expect = 0.0018, P = 0.0018
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 257

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G     G AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   258 T-TATATTAGAACATGAAATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|841861 AA202803 LD03121.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=392
            Length = 392

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1031997 AA390659 LD09620.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=391
            Length = 391

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 239

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   240 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 296

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   297 AATTTAATTTAGAAATTATAAATTT 321


>cbil|dbest|1186134 AA540086 LD19444.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=390
            Length = 390

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    25 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 83

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    84 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 141

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   142 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 195

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   196 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 253

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   254 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 310

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   311 AATTTAACTTAGAAATTACAAATTT 335


>cbil|dbest|1182260 AA536570 LD17330.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=385
            Length = 385

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    15 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 73

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    74 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 131

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   132 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 185

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   186 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 243

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   244 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 300

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   301 AATTTAACTTAGAAATTATAAATTT 325


>cbil|dbest|1185524 AA538953 LD18632.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=439
            Length = 439

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    37 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 95

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    96 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 153

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   154 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 207

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   208 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 265

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   266 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 322

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   323 AATTTAATTTAGAAATTATAAATTT 347


>cbil|dbest|1033921 AA392428 LD12810.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=440
            Length = 440

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1085436 AA441142 LD16036.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=440
            Length = 440

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     9 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 67

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    68 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 125

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   126 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 179

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   180 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 237

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   238 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 294

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   295 AATTTAATTTAGAAATTATAAATTT 319


>cbil|dbest|1185525 AA538954 LD18633.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=375
            Length = 375

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|840919 AA201799 LD03726.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=441
            Length = 441

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0019, P = 0.0019
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1083871 AA439574 LD14180.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=372
            Length = 372

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0020, P = 0.0020
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084626 AA440074 LD15155.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=442
            Length = 442

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0020, P = 0.0020
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1182249 AA536559 LD17318.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=366
            Length = 366

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0020, P = 0.0020
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 230

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   231 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 287

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   288 AATTTAATTTAGAAATTATAAATTT 312


>cbil|dbest|1185620 AA539056 LD18753.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=444
            Length = 444

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0020, P = 0.0020
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 239

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   240 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 296

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   297 AATTTAATTTAGAAATTATAAATTT 321


>cbil|dbest|1186912 AA540864 LD20693.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=444
            Length = 444

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0020, P = 0.0020
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    27 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 85

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    86 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 143

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   144 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 197

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   198 TCGATTTTAGAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 255

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   256 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 312

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   313 AATTTAATTTAGAAATTATAAATTT 337


>cbil|dbest|905376 AA264405 LD08046.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=446
            Length = 446

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0020, P = 0.0020
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     1 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 59

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    60 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 117

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   118 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 171

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   172 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 229

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   230 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 286

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   287 AATTTAATTTAGAAATTATAAATTT 311


>cbil|dbest|1185455 AA538884 LD18528.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=447
            Length = 447

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0021, P = 0.0021
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    37 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 95

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    96 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 153

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   154 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 207

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   208 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 265

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   266 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 322

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   323 AATTTAATTTAGAAATTATAAATTT 347


>cbil|dbest|1084021 AA439724 LD14363.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=449
            Length = 449

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0021, P = 0.0021
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084696 AA440304 LD15232.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=450
            Length = 450

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0021, P = 0.0021
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    14 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 72

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    73 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 130

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   131 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 184

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   185 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 242

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   243 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 299

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   300 AATTTAATTTAGAAATTATAAATTT 324


>cbil|dbest|1085714 AA441420 LD16344.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=450
            Length = 450

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0021, P = 0.0021
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    37 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 95

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    96 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 153

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   154 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 207

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   208 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 265

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   266 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 322

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   323 AATTTAATTTAGAAATTATAAATTT 347


>cbil|dbest|1182308 AA536618 LD17390.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=450
            Length = 450

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0021, P = 0.0021
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    81 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 138

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   139 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 192

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   193 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 250

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   251 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 307

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   308 CATTTAATTTAGAAATTATAAATTT 332


>cbil|dbest|1185599 AA539028 LD18729.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=419
            Length = 419

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0021, P = 0.0021
 Identities = 181/316 (57%), Positives = 181/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAATTAAATT--TATTAATAGGTTTTTATTTTCATATTGGATGG 40
             T T   TT G    G  AAT   ATT  T TT A AGGT T TA TTT  TA    AT  
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTCTTTAAAGGTATCTAGTTTTTTAAGACATAA 316

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   317 ATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084612 AA440060 LD15139.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=451
            Length = 451

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0021, P = 0.0021
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   199 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 256

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   257 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 313

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   314 AATTTAATTTAGAAATTATAAATTT 338


>cbil|dbest|1186594 AA540546 LD20265.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=451
            Length = 451

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0021, P = 0.0021
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    19 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 77

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    78 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 135

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   136 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 189

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   190 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 247

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   248 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 304

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   305 AATTTAATTTAGAAATTATAAATTT 329


>cbil|dbest|1085619 AA441325 LD16218.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=452
            Length = 452

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0022, P = 0.0022
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    10 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 68

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    69 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 126

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   127 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 180

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   181 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 238

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   239 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 295

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   296 AATTTAATTTAGAAATTATAAATTT 320


>cbil|dbest|1085926 AA441632 LD16629.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=452
            Length = 452

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0022, P = 0.0022
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    20 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 78

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    79 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 136

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   137 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 190

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   191 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 248

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   249 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 305

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   306 AATTTAATTTAGAAATTATAAATTT 330


>cbil|dbest|1083216 AA438919 LD13316.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=453
            Length = 453

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0022, P = 0.0022
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    81 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 138

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   139 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 192

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   193 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 250

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   251 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGACATA 307

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   308 AATTTAATTTAGAAATTATAAATTT 332


>cbil|dbest|1082675 AA438378 LD12644.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=454
            Length = 454

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0022, P = 0.0022
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1085228 AA440934 LD12746.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=456
            Length = 456

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0022, P = 0.0022
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     8 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 66

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    67 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 124

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   125 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 178

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   179 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 236

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   237 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 293

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   294 AATTTAATTTAGAAATTATAAATTT 318


>cbil|dbest|1182109 AA536504 LD17141.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=456
            Length = 456

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0022, P = 0.0022
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1184892 AA539547 LD17731.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=395
            Length = 395

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0023, P = 0.0023
 Identities = 181/316 (57%), Positives = 181/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAATTAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
             T T   TT G    G  A  T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   259 T-TATATTAGAAATGACATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 316

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   317 ATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1185593 AA539022 LD18722.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=459
            Length = 459

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0023, P = 0.0023
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    15 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 73

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    74 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 131

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   132 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 185

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   186 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 243

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   244 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 300

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   301 AATTTAATTTAGAAATTATAAATTT 325


>cbil|dbest|1186204 AA540156 LD19545.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=459
            Length = 459

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0023, P = 0.0023
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 257

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   258 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 314

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   315 AATTTAATTTAGAAATTATAAATTT 339


>cbil|dbest|1185084 AA539739 LD18059.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=460
            Length = 460

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0023, P = 0.0023
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1075777 AA431206 zw76h01.s1 3' Lib=628[Homo_sapiens|||||]
            Length=446
            Length = 446

  Minus Strand HSPs:

 Score = 208 (31.2 bits), Expect = 0.0023, P = 0.0023
 Identities = 86/128 (67%), Positives = 86/128 (67%), Strand = Minus / Plus

Query:   282 TTATTTTTAAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTTTTTTAGTGGTATT 223
             TT TTTTT    TTTTTTT  T TT  AA A T TT AAA AG  TT TTTAG GGTATT
Sbjct:     1 TTTTTTTTTTTTTTTTTTTTTTTTTTTAA-ACTCTT-AAATAGTTTTATTTAGGGGTATT 58

Query:   222 TTTTTTGTAGAAACAAATTTTGGGATGTGATATTTTTACAAA--ATAAAAAATA-ATACC 166
             TTTTTT T   A     TT TG  A  TGA  TTTTTA AAA  A AAAAAA A AT  C
Sbjct:    59 TTTTTTCTTTCAGGCT-TTCTGCAAAATGAATTTTTTAAAAACAACAAAAAAAAGATTTC 117

Query:   165 GTGTT-TTTGT 156
              TGTT TTTGT
Sbjct:   118 CTGTTGTTTGT 128


>cbil|dbest|1186276 AA540228 LD19642.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=281
            Length = 281

  Minus Strand HSPs:

 Score = 210 (31.5 bits), Expect = 0.0023, P = 0.0023
 Identities = 132/216 (61%), Positives = 132/216 (61%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    32 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 90

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    91 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTACAAGAAAATTTAATT 148

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTAC AAATAAAAAATAA TA   T TTTTT 
Sbjct:   149 TATTGT--ACCTT-GTG-TATCAG-TGTTTACTAAATAAAAAATAAATATT-TATTTTTC 202

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   203 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 244


>cbil|dbest|1186456 AA540408 LD19891.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=461
            Length = 461

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0023, P = 0.0023
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1085104 AA440810 LD15692.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=381
            Length = 381

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0023, P = 0.0023
 Identities = 181/316 (57%), Positives = 181/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAATTAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
             T T   TT G C  G  A  T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   259 T-TATATTAGACATGACATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 316

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   A    A AAATTA AA TTT
Sbjct:   317 ATTTACTTTAGAAATTATAAATTT 340


>cbil|dbest|1085190 AA440896 LD15988.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=462
            Length = 462

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0024, P = 0.0023
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1085764 AA441470 LD16418.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=462
            Length = 462

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0024, P = 0.0023
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    39 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 97

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    98 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 155

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   156 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 209

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   210 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 267

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   268 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 324

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   325 AATTTAATTTAGAAATTATAAATTT 349


>cbil|dbest|1186750 AA540702 LD20478.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=462
            Length = 462

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0024, P = 0.0023
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     1 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 59

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    60 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 117

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   118 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 171

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   172 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 229

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   230 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 286

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   287 AATTTAATTTAGAAATTATAAATTT 311


>cbil|dbest|1031780 AA390421 LD09350.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=378
            Length = 378

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0024, P = 0.0024
 Identities = 181/316 (57%), Positives = 181/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   199 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 256

Query:    97 TGTGCCTTTGCCGGGGTAATTAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
             T T   TT G    G  A  T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   257 T-TATATTAGAAATGACATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 314

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   315 ATTTAATTTAGAAATTATAAATTT 338


>cbil|dbest|1185654 AA539090 LD18793.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=464
            Length = 464

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0024, P = 0.0024
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTACAAGAGTTAATATAATATTTAAGTTA-ATG-TGATACAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|841925 AA202867 LD03211.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=465
            Length = 465

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0024, P = 0.0024
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    35 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 93

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    94 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 151

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   152 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 205

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   206 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 263

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   264 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 320

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   321 AATTTAATTTAGAAATTATAAATTT 345


>cbil|dbest|1085639 AA441345 LD16242.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=469
            Length = 469

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0025, P = 0.0025
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    39 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 97

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    98 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 155

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   156 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 209

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   210 TCGATTTTACAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 267

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   268 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGACATA 324

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   325 AATTTAATTTAGAAATTATAAATTT 349


>cbil|dbest|1085934 AA441640 LD16639.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=470
            Length = 470

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0025, P = 0.0025
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 CATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1033037 AA391687 LD11620.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=472
            Length = 472

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0025, P = 0.0025
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1082704 AA438407 LD12681.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=472
            Length = 472

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0025, P = 0.0025
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    13 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 71

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    72 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 129

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   130 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 183

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   184 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 241

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   242 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 298

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   299 AATTTAATTTAGAAATTATAAATTT 323


>cbil|dbest|1084647 AA440095 LD15176.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=472
            Length = 472

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0025, P = 0.0025
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1181967 AA536362 LD16941.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=472
            Length = 472

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0025, P = 0.0025
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    10 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 68

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    69 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 126

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   127 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 180

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   181 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 238

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   239 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 295

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   296 CATTTAATTTAGAAATTATAAATTT 320


>cbil|dbest|1085700 AA441406 LD16327.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=473
            Length = 473

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0025
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1082872 AA438575 LD12382.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=474
            Length = 474

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   262 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 318

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   319 AATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|1084460 AA440375 LD14958.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=474
            Length = 474

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1181951 AA536346 LD16915.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=474
            Length = 474

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 239

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   240 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 296

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   297 AATTTAATTTAGAAATTATAAATTT 321


>cbil|dbest|1184798 AA539453 LD17584.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=474
            Length = 474

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|841206 AA202132 LD02231.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=476
            Length = 476

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    27 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 85

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    86 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 143

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   144 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 197

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   198 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 255

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   256 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 312

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   313 AATTTAATTTAGAAATTATAAATTT 337


>cbil|dbest|1181830 AA536225 LD16708.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=476
            Length = 476

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1181889 AA536284 LD16807.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=476
            Length = 476

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    26 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 84

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    85 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 142

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   143 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 196

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   197 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 254

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   255 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 311

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   312 AATTTAATTTAGAAATTATAAATTT 336


>cbil|dbest|1184902 AA539557 LD17745.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=476
            Length = 476

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 CATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1402440 AA696165 GM05207.5prime 5prime
            Lib=1058[Drosophila_melanogaster|ovary||||newly_eclosed_females:_ge
            rmarium-stage_6] Length=476 Author_cmt: U37541: Drosophila
            melanogaster mitochondrial genome, complete sequence.
            Length = 476

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 257

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   258 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 314

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   315 AATTTAATTTAGAAATTATAAATTT 339


>cbil|dbest|1186124 AA540076 LD19429.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=445
            Length = 445

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0026, P = 0.0026
 Identities = 181/316 (57%), Positives = 181/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAATTAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
             T T   TT G    G  A  T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   259 T-TATATTAGAAATGACATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 316

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   317 ATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1033761 AA392421 LD11275.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=477
            Length = 477

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084312 AA440158 LD14758.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=477
            Length = 477

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    44 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 102

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:   103 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 160

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   161 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 214

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   215 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 272

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   273 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 329

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   330 AATTTAATTTAGAAATTATAAATTT 354


>cbil|dbest|1085611 AA441317 LD16207.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=478
            Length = 478

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0026, P = 0.0026
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1082690 AA438393 LD12666.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=479
            Length = 479

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0027, P = 0.0027
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1032360 AA391011 LD09916.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=480
            Length = 480

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0027, P = 0.0027
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084142 AA439845 LD14521.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=480
            Length = 480

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0027, P = 0.0027
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    19 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 77

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    78 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 135

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   136 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 189

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   190 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 247

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   248 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 304

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   305 AATTTAATTTAGAAATTATAAATTT 329


>cbil|dbest|1184939 AA539594 LD17796.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=480
            Length = 480

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0027, P = 0.0027
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     8 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 66

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    67 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 124

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   125 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 178

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   179 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 236

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   237 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 293

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   294 AATTTAATTTAGAAATTATAAATTT 318


>cbil|dbest|1083160 AA438863 LD13236.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=481
            Length = 481

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0027, P = 0.0027
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    21 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 79

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    80 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 137

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   138 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 191

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   192 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 249

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   250 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 306

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   307 AATTTAATTTAGAAATTATAAATTT 331


>cbil|dbest|1184744 AA539399 LD17502.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=483
            Length = 483

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0027, P = 0.0027
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    21 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 79

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    80 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 137

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   138 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 191

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   192 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 249

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   250 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 306

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   307 AATTTAATTTAGAAATTATAAATTT 331


>cbil|dbest|1185576 AA539005 LD18702.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=486
            Length = 486

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0028, P = 0.0028
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    36 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 94

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    95 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 152

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   153 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 206

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   207 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 264

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   265 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 321

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   322 AATTTAATTTAGAAATTATAAATTT 346


>cbil|dbest|1085344 AA441050 LD15822.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=487
            Length = 487

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0028, P = 0.0028
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    15 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 73

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    74 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 131

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   132 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 185

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   186 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 243

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   244 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 300

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   301 AATTTAATTTAGAAATTATAAATTT 325


>cbil|dbest|1185541 AA538970 LD18650.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=490
            Length = 490

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0028, P = 0.0028
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084369 AA440215 LD14833.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=491
            Length = 491

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0029, P = 0.0029
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGACATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1184917 AA539572 LD17767.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=472
            Length = 472

  Minus Strand HSPs:

 Score = 208 (31.2 bits), Expect = 0.0029, P = 0.0029
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA  G A  
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTACAGAAAT 315

Query:    40 GAAAA-AAGAAA-AAATTAAAAGTTT 17
              AA   AA   A AAATTA AA TTT
Sbjct:   316 AAATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1184695 AA539330 LD17408.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=540
            Length = 540

  Minus Strand HSPs:

 Score = 211 (31.7 bits), Expect = 0.0029, P = 0.0029
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTANAAGAACATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   199 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 256

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   257 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 313

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   314 AATTTAATTTAGAAATTATAAATTT 338


>cbil|dbest|841509 AA202434 LD02620.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=492
            Length = 492

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0029, P = 0.0029
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1182132 AA536527 LD17174.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=493
            Length = 493

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0029, P = 0.0029
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 230

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   231 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 287

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   288 AATTTAATTTAGAAATTATAAATTT 312


>cbil|dbest|1085823 AA441529 LD16504.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=494
            Length = 494

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0029, P = 0.0029
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   262 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 318

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   319 AATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|1402574 AA696299 GM05489.5prime 5prime
            Lib=1058[Drosophila_melanogaster|ovary||||newly_eclosed_females:_ge
            rmarium-stage_6] Length=494 Author_cmt: U37541: Drosophila
            melanogaster mitochondrial genome, complete sequence.
            Length = 494

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0029, P = 0.0029
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|250621 R73763 yi55g01.r1 5'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=417
            Length = 417

  Plus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0029, P = 0.0029
 Identities = 186/315 (59%), Positives = 186/315 (59%), Strand = Plus / Plus

Query:     2 TTTTTTTTTTATTCCAAACTTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAAA 61
             TTTTTTTTTTATT  AAA   TT ATTTT  CTTT     A C A TAT  AA T A  A
Sbjct:    10 TTTTTTTTTTATTTAAAAAACTTTATTTTG-CTTTAAAAAAACAATTATTCAATTCATGA 68

Query:    62 CCTATTAATAAATTTAATTACCCCGGCAAAGGCACAAAAAACAACCCTCCCCAACAT--C 119
                ATTAA  AA  TA   ACCCC  CAAAG      A AA AA C T C  AA AT  C
Sbjct:    69 AG-ATTAACCAAAATACAAACCCCATCAAAGTTTATTACAATAATCTTTCATAAAATAGC 127

Query:   120 ATACAACATACCAATTATTTAACAGGTATGGATTTTACAAAAACACGGTATTATTTTTTA 179
             AT  AA A A   A TATTT A A GTA   AT   ACAA    A   TA  A  TTT  
Sbjct:   128 ATTAAAAAAAGTTAATATTTTA-ATGTAAAAATC--ACAATGTAAAAATAAAAACTTTAG 184

Query:   180 TTTT-GT-A--AAAATATCA-CATCCCAA-AATTTGTTTCTACAA--AAAAAATACC--A 229
             TTTT GT A  AAAATA  A CA    AA AAT T  TTC ACA   AAAAAATAC   A
Sbjct:   185 TTTTAGTGACTAAAATAAAAGCAGATAAATAATCTTCTTC-ACAGGGAAAAAATACTTGA 243

Query:   230 CTAAAAAACCCTTTTTCAAAAC-TGTTGCAACATGAAAAAAACCTTAAAAATAAA-T-A- 285
                AAAAA C  T  T A AAC TGT G AA A G A  A A  TTAAA AT A  T A 
Sbjct:   244 GGGAAAAAACAATGGT-ATAACATGT-GTAA-A-GCAGGANAT-TTAAATATCAGCTTAG 298

Query:   286 TTACAAATTTCTGCCCTG-CTTCTAT 310
             TT C  ATT C   C TG C T TAT
Sbjct:   299 TTCCTCATTGCCAACATGGCATTTAT 324


>cbil|dbest|841307 AA202214 LD02346.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=410
            Length = 410

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0030, P = 0.0030
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|1185766 AA539266 LD18947.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=461
            Length = 461

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0030, P = 0.0030
 Identities = 181/316 (57%), Positives = 181/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    20 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 78

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    79 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 136

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   137 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 190

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   191 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 248

Query:    97 TGTGCCTTTGCCGGGGTAATTAAATT--TATTAATAGGTTTTTATTTTCATATTGGATGG 40
             T T   TT G    G  AAT   ATT  T TT A AGGT T TA TTT  TA    AT  
Sbjct:   249 T-TATATTAGAAATGA-AATGTTATTCGTTTTTACAGGTATCTAGTTTTTTAAGAAATAA 306

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   307 ATTTAATTTAGAAATTATAAATTT 330


>cbil|dbest|1184875 AA539530 LD17708.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=500
            Length = 500

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0030, P = 0.0030
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 230

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   231 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 287

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   288 AATTTAATTTAGAAATTATAAATTT 312


>cbil|dbest|1186026 AA539978 LD19290.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=501
            Length = 501

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0030, P = 0.0030
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 257

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   258 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 314

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   315 AATTTAATTTAGAAATTATAAATTT 339


>cbil|dbest|1185596 AA539025 LD18726.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=464
            Length = 464

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0031, P = 0.0031
 Identities = 181/316 (57%), Positives = 181/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAATTAAATT--TATTAATAGGTTTTTATTTTCATATTGGATGG 40
             T T   TT G    G  AAT   ATT  T TT A AGGT T TA TTT  TA    AT  
Sbjct:   262 T-TATATTAGAAATGA-AATGCTATTCGTTTTTAAAGGTATCTAGTTTTTTAAGAAATAA 319

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   320 ATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|1083459 AA439162 LD13643.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=504
            Length = 504

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0031, P = 0.0031
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     1 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 59

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    60 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 117

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   118 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 171

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   172 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 229

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   230 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 286

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   287 AATTTAATTTAGAAATTATAAATTT 311


>cbil|dbest|1184934 AA539589 LD17791.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=505
            Length = 505

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0031, P = 0.0031
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 257

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   258 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGACATA 314

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   315 AATTTAATTTAGAAATTATAAATTT 339


>cbil|dbest|1185466 AA538895 LD18545.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=505
            Length = 505

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0031, P = 0.0031
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     1 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 59

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    60 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 117

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   118 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 171

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   172 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 229

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   230 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 286

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   287 AATTTAATTTAGAAATTATAAATTT 311


>cbil|dbest|1185645 AA539081 LD18782.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=505
            Length = 505

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0031, P = 0.0031
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    43 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 101

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:   102 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 159

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   160 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 213

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   214 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 271

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   272 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 328

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   329 AATTTAATTTAGAAATTATAAATTT 353


>cbil|dbest|1185200 AA538629 LD18205.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=506
            Length = 506

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0031, P = 0.0031
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     1 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 59

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    60 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 117

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   118 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 171

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   172 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 229

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   230 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 286

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   287 AATTTAATTTAGAAATTATAAATTT 311


>cbil|dbest|1185768 AA539268 LD18950.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=508
            Length = 508

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0031, P = 0.0031
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 257

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   258 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 314

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   315 AATTTAATTTAGAAATTATAAATTT 339


>cbil|dbest|1085900 AA441606 LD16588.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=510
            Length = 510

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0032, P = 0.0032
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|841216 AA202122 LD02242.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=511
            Length = 511

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0032, P = 0.0032
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 230

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   231 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 287

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   288 AATTTAATTTAGAAATTATAAATTT 312


>cbil|dbest|1082717 AA438420 LD12696.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=512
            Length = 512

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0032, P = 0.0032
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084590 AA440038 LD15113.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=512
            Length = 512

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0032, P = 0.0032
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    13 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 71

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    72 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 129

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   130 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 183

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   184 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 241

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   242 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 298

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   299 AATTTAATTTAGAAATTATAAATTT 323


>cbil|dbest|1085754 AA441460 LD16405.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=514
            Length = 514

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0032, P = 0.0032
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 230

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   231 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 287

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   288 AATTTAATTTAGAAATTATAAATTT 312


>cbil|dbest|1033916 AA392423 LD12805.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=516
            Length = 516

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0033, P = 0.0032
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    26 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 84

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    85 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 142

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   143 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 196

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   197 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 254

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   255 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 311

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   312 AATTTAATTTAGAAATTATAAATTT 336


>cbil|dbest|1033361 AA392021 LD10956.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=516
            Length = 516

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0033, P = 0.0032
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    21 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 79

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    80 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 137

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   138 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 191

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   192 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 249

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   250 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 306

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   307 AATTTAATTTAGAAATTATAAATTT 331


>cbil|dbest|1082999 AA438702 LD13035.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=517
            Length = 517

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0033, P = 0.0033
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    23 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 81

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    82 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 139

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   140 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 193

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   194 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 251

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   252 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 308

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   309 AATTTAATTTAGAAATTATAAATTT 333


>cbil|dbest|1186749 AA540701 LD20477.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=517
            Length = 517

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0033, P = 0.0033
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    26 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 84

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    85 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 142

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   143 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 196

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   197 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 254

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   255 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 311

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   312 AATTTAATTTAGAAATTATAAATTT 336


>cbil|dbest|1186967 AA540919 LD20110.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=517
            Length = 517

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0033, P = 0.0033
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    39 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 97

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    98 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 155

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   156 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 209

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   210 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 267

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   268 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 324

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   325 AATTTAATTTAGAAATTATAAATTT 349


>cbil|dbest|1185085 AA539740 LD18060.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=419
            Length = 419

  Minus Strand HSPs:

 Score = 203 (30.5 bits), Expect = 0.0033, P = 0.0033
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTGTAATATTTATTTTTAA 273
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT TAATA T  TTT T A
Sbjct:    10 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAA-TTT-TAATAATAGTTTATTA 66

Query:   272 GGTTTTTTTCATG---TTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTT 217
             G T TT T  A G   TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T
Sbjct:    67 G-TATTGTAAAAGAAATTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAAT 124

Query:   216 GTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTT 158
              TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT
Sbjct:   125 TTATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTT 178

Query:   157 GTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTT 99
              T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T
Sbjct:   179 CTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAAT 236

Query:    98 TTGTGCCTTTGCCGGGGTAATTAAATT--TATTAATAGGTTTTTATTTTCATATTGGATG 41
              T T   TT G    G  AAT   ATT  T TT A AGGT T TA TTT  TA    AT 
Sbjct:   237 AT-TATATTAGAAATGA-AATGTTATTCGTTTTTACAGGTATCTAGTTTTTTAAGACATA 294

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   295 AATTTAATTTAGAAATTATAAATTT 319


>cbil|dbest|1083600 AA439303 LD13833.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=518
            Length = 518

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0033, P = 0.0033
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1184763 AA539418 LD17532.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=523
            Length = 523

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0034, P = 0.0034
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 230

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   231 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 287

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   288 AATTTAATTTAGAAATTATAAATTT 312


>cbil|dbest|1182030 AA536425 LD17033.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=526
            Length = 526

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0034, P = 0.0034
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   262 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 318

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   319 AATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|841821 AA202763 LD03041.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=558
            Length = 558

  Minus Strand HSPs:

 Score = 210 (31.5 bits), Expect = 0.0034, P = 0.0034
 Identities = 184/318 (57%), Positives = 184/318 (57%), Strand = Minus / Plus

Query:   334 TAAAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTT 277
             TAAAAATT A   TTT  G  TTG T  AAG A    A AA TTT  TAATA TTTATT 
Sbjct:     1 TAAAAATTAAAAGTTTAAGAATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTA 59

Query:   276 TTAAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTT 218
              TA  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  
Sbjct:    60 GTATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAA 117

Query:   217 TGTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTT 159
             T TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTT
Sbjct:   118 TTTATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTT 171

Query:   158 TGTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTT 100
             T T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  
Sbjct:   172 TCTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAA 229

Query:    99 TTTGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGA 43
             T T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    A
Sbjct:   230 TAT-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAA 286

Query:    42 TGGAAAAAAGAAA-AAATTAAAAGTTT 17
             T  A   AA   A AAATTA AA TTT
Sbjct:   287 TAAATTTAATTTAGAAATTATAAATTT 313


>cbil|dbest|1084231 AA439934 LD14645.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=528
            Length = 528

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0034, P = 0.0034
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    38 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 96

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    97 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 154

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   155 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 208

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   209 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 266

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   267 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 323

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   324 AATTTAATTTAGAAATTATAAATTT 348


>cbil|dbest|1186151 AA540103 LD19468.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=482
            Length = 482

  Minus Strand HSPs:

 Score = 207 (31.1 bits), Expect = 0.0034, P = 0.0034
 Identities = 181/316 (57%), Positives = 181/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAATTAAATT--TATTAATAGGTTTTTATTTTCATATTGGATGG 40
             T T   TT G    G  AAT   ATT  T TT A AGGT T TA TTT  TA    AT  
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTACAGGTATCTAGTTTTTTACGAAATAA 316

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   317 ATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1032318 AA390808 LD09793.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=531
            Length = 531

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    19 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 77

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    78 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 135

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   136 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 189

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   190 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 247

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   248 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 304

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   305 AATTTAATTTAGAAATTATAAATTT 329


>cbil|dbest|1033896 AA392557 LD11461.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=533
            Length = 533

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084412 AA440258 LD14902.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=533
            Length = 533

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    20 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 78

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    79 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 136

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   137 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 190

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   191 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 248

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   249 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 305

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   306 AATTTAATTTAGAAATTATAAATTT 330


>cbil|dbest|1084414 AA440260 LD14904.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=533
            Length = 533

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084970 AA440676 LD15536.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=533
            Length = 533

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    20 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 78

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    79 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 136

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   137 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 190

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   191 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 248

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   249 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 305

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   306 AATTTAATTTAGAAATTATAAATTT 330


>cbil|dbest|1184871 AA539526 LD17702.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=533
            Length = 533

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    18 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 76

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    77 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 134

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   135 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 188

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   189 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 246

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   247 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 303

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   304 AATTTAATTTAGAAATTATAAATTT 328


>cbil|dbest|841406 AA202323 LD02481.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=534
            Length = 534

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    21 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 79

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    80 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 137

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   138 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 191

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   192 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 249

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   250 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 306

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   307 AATTTAATTTAGAAATTATAAATTT 331


>cbil|dbest|1184914 AA539569 LD17764.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=425
            Length = 425

  Minus Strand HSPs:

 Score = 203 (30.5 bits), Expect = 0.0035, P = 0.0035
 Identities = 185/322 (57%), Positives = 185/322 (57%), Strand = Minus / Plus

Query:   338 AGTTTAAAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTT 281
             A T TAAAA TT A   TTT  G  TTG T  AAG A    A AA TTT  TAATA TTT
Sbjct:     6 ACTATAAAATTTAAAGGTTTAAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTT 64

Query:   280 ATTTTTAAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTT 222
             ATT  TA  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  T
Sbjct:    65 ATTAGTATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAAT 122

Query:   221 TTTTTGTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTG 163
             TT  T TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T 
Sbjct:   123 TTAATTTATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TA 176

Query:   162 TTTTTGTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTT 104
             TTTTT T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT
Sbjct:   177 TTTTTCTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTT 234

Query:   103 GTTTTTTGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATAT 47
              T  T T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA 
Sbjct:   235 ATAATAT-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAA 291

Query:    46 TGGATGGAAAAAAGAAA-AAATTAAAAGTTT 17
                AT  A   AA   A AAATTA AA TTT
Sbjct:   292 GAAATAAATTTAATTTAGAAATTATAAATTT 322


>cbil|dbest|841614 AA202395 LD02210.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=536
            Length = 536

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    24 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 82

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    83 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 140

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   141 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 194

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   195 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 252

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   253 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 309

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   310 AATTTAATTTAGAAATTATAAATTT 334


>cbil|dbest|1185078 AA539733 LD18051.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=536
            Length = 536

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1185801 AA539301 LD18988.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=536
            Length = 536

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0035, P = 0.0035
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     4 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 62

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    63 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 120

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   121 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 174

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   175 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 232

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   233 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 289

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   290 AATTTAATTTAGAAATTATAAATTT 314


>cbil|dbest|1034015 AA392665 LD11443.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=537
            Length = 537

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   262 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 318

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   319 AATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|1083775 AA439478 LD14061.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=537
            Length = 537

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    25 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 83

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    84 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 141

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   142 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 195

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   196 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 253

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   254 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 310

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   311 AATTTAATTTAGAAATTATAAATTT 335


>cbil|dbest|1084573 AA440021 LD15090.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=537
            Length = 537

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1085827 AA441533 LD16508.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=537
            Length = 537

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084406 AA440252 LD14889.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=540
            Length = 540

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    10 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 68

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    69 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 126

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   127 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 180

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   181 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 238

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   239 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 295

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   296 AATTTAATTTAGAAATTATAAATTT 320


>cbil|dbest|1184835 AA539490 LD17643.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=540
            Length = 540

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   199 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 256

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   257 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 313

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   314 AATTTAATTTAGAAATTATAAATTT 338


>cbil|dbest|1185107 AA539762 LD18087.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=540
            Length = 540

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|841415 AA202341 LD02492.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=541
            Length = 541

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    27 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 85

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    86 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 143

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   144 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 197

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   198 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 255

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   256 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 312

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   313 AATTTAATTTAGAAATTATAAATTT 337


>cbil|dbest|1084509 AA440424 LD15017.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=541
            Length = 541

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1033942 AA392583 LD12832.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=542
            Length = 542

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 239

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   240 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 296

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   297 AATTTAATTTAGAAATTATAAATTT 321


>cbil|dbest|1084519 AA439967 LD15029.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=542
            Length = 542

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1085874 AA441580 LD16559.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=542
            Length = 542

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 CATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1032892 AA391554 LD10555.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=543
            Length = 543

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 239

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   240 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 296

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   297 AATTTAATTTAGAAATTATAAATTT 321


>cbil|dbest|1185802 AA539302 LD18989.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=543
            Length = 543

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0036, P = 0.0036
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     1 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 59

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    60 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 117

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   118 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 171

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   172 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 229

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   230 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 286

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   287 AATTTAATTTAGAAATTATAAATTT 311


>cbil|dbest|1185479 AA538908 LD18564.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=441
            Length = 441

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0036, P = 0.0036
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|1085872 AA441578 LD16557.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=545
            Length = 545

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0037, P = 0.0037
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1184909 AA539564 LD17756.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=545
            Length = 545

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0037, P = 0.0037
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 CATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1185798 AA539298 LD18984.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=545
            Length = 545

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0037, P = 0.0037
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|841556 AA202471 LD01933.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=546
            Length = 546

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0037, P = 0.0037
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   262 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 318

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   319 AATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|841529 AA202444 LD02641.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=546
            Length = 546

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0037, P = 0.0037
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    32 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 90

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    91 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 148

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   149 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 202

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   203 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 260

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   261 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 317

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   318 AATTTAATTTAGAAATTATAAATTT 342


>cbil|dbest|841517 AA202311 LD02628.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=546
            Length = 546

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0037, P = 0.0037
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    43 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 101

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:   102 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 159

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   160 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 213

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   214 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 271

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   272 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 328

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   329 AATTTAATTTAGAAATTATAAATTT 353


>cbil|dbest|1185933 AA539885 LD19174.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=548
            Length = 548

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0037, P = 0.0037
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    15 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 73

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    74 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 131

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   132 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 185

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   186 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 243

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   244 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 300

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   301 AATTTAATTTAGAAATTATAAATTT 325


>cbil|dbest|1402927 AA696652 GM08068.5prime 5prime
            Lib=1058[Drosophila_melanogaster|ovary||||newly_eclosed_females:_ge
            rmarium-stage_6] Length=553 Author_cmt: U37541: Drosophila
            melanogaster mitochondrial genome, complete sequence.
            Length = 553

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0038, P = 0.0038
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1184816 AA539471 LD17619.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=554
            Length = 554

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0038, P = 0.0038
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    39 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 97

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    98 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 155

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   156 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 209

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   210 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 267

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   268 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 324

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   325 AATTTAATTTAGAAATTATAAATTT 349


>cbil|dbest|1033023 AA391664 LD11606.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=555
            Length = 555

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0038, P = 0.0038
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    44 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 102

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:   103 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 160

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   161 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 214

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   215 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 272

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   273 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 329

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   330 AATTTAATTTAGAAATTATAAATTT 354


>cbil|dbest|1084548 AA439996 LD15060.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=555
            Length = 555

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0038, P = 0.0038
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1082705 AA438408 LD12682.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=556
            Length = 556

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0038, P = 0.0038
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     9 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 67

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    68 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 125

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   126 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 179

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   180 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 237

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   238 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 294

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   295 AATTTAATTTAGAAATTATAAATTT 319


>cbil|dbest|1185906 AA539858 LD19138.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=558
            Length = 558

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0038, P = 0.0038
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 230

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   231 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 287

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   288 AATTTAATTTAGAAATTATAAATTT 312


>cbil|dbest|1032404 AA391073 LD09922.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=562
            Length = 562

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0039, P = 0.0039
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    23 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 81

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    82 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 139

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   140 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 193

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   194 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 251

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   252 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 308

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   309 AATTTAATTTAGAAATTATAAATTT 333


>cbil|dbest|841541 AA202371 LD02656.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=565
            Length = 565

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0039, P = 0.0039
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1084214 AA439917 LD14621.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=565
            Length = 565

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0039, P = 0.0039
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1084468 AA440383 LD14966.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=568
            Length = 568

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0040, P = 0.0040
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|841538 AA202368 LD02652.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=571
            Length = 571

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0040, P = 0.0040
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    15 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 73

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    74 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 131

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   132 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 185

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   186 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 243

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   244 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 300

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   301 AATTTAATTTAGAAATTATAAATTT 325


>cbil|dbest|1185590 AA539019 LD18718.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=572
            Length = 572

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0040, P = 0.0040
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    39 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 97

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    98 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 155

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   156 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 209

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   210 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 267

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   268 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 324

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   325 AATTTAATTTAGAAATTATAAATTT 349


>cbil|dbest|1084453 AA440368 LD14949.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=575
            Length = 575

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0040, P = 0.0040
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 257

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   258 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 314

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   315 AATTTAATTTAGAAATTATAAATTT 339


>cbil|dbest|1185658 AA539094 LD18805.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=412
            Length = 412

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0041, P = 0.0040
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 245


>cbil|dbest|1084340 AA440186 LD14796.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=576
            Length = 576

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0041, P = 0.0041
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1033115 AA391785 LD11515.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=543
            Length = 543

  Minus Strand HSPs:

 Score = 208 (31.2 bits), Expect = 0.0041, P = 0.0041
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTA-TTTTCATATTGGAT 42
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTTT  TA    AT
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTTAAGAAAT 315

Query:    41 GGAAAAAAGAAA-AAATTAAAAGTTT 17
               A   AA   A AAATTA AA TTT
Sbjct:   316 AAATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1185714 AA539214 LD18880.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=578
            Length = 578

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0041, P = 0.0041
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    81 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 138

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   139 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 192

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   193 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 250

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   251 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 307

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   308 AATTTAATTTAGAAATTATAAATTT 332


>cbil|dbest|1033346 AA392007 LD10940.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=579
            Length = 579

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0041, P = 0.0041
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    81 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 138

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   139 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 192

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   193 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 250

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   251 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 307

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   308 AATTTAATTTAGAAATTATAAATTT 332


>cbil|dbest|1083593 AA439296 LD13826.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=579
            Length = 579

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0041, P = 0.0041
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1184930 AA539585 LD17784.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=582
            Length = 582

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0041, P = 0.0041
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    35 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 93

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    94 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 151

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   152 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 205

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   206 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 263

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   264 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 320

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   321 AATTTAATTTAGAAATTATAAATTT 345


>cbil|dbest|1185523 AA538952 LD18631.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=588
            Length = 588

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0042, P = 0.0042
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1187145 AA541097 LD20891.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=589
            Length = 589

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0042, P = 0.0042
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    42 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 100

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:   101 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 158

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   159 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 212

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   213 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 270

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   271 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 327

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   328 AATTTAATTTAGAAATTATAAATTT 352


>cbil|dbest|841885 AA202818 LD03150.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=396
            Length = 396

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0042, P = 0.0042
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    15 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 73

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    74 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 131

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   132 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 185

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   186 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 227


>cbil|dbest|841055 AA201936 LD04065.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=396
            Length = 396

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0042, P = 0.0042
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 243


>cbil|dbest|1085477 AA441183 LD16085.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=396
            Length = 396

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0042, P = 0.0042
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    26 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 84

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    85 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 142

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   143 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 196

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   197 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 238


>cbil|dbest|1181900 AA536295 LD16825.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=477
            Length = 477

  Minus Strand HSPs:

 Score = 205 (30.8 bits), Expect = 0.0042, P = 0.0042
 Identities = 185/319 (57%), Positives = 185/319 (57%), Strand = Minus / Plus

Query:   335 TTAAAAATTGATTATTTTTGCT-TTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTAT 279
             T AAAAATT A  A TTT   T TTG T  AAG A    A AA TTT  TAATA TTTAT
Sbjct:    12 TAAAAAATTTAAAAGTTTAAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTAT 70

Query:   278 TTTTAAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTT 220
             T  TA  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT
Sbjct:    71 TAGTATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTT 128

Query:   219 TTTGTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTT 161
               T TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TT
Sbjct:   129 AATTTATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATT 182

Query:   160 TTTGTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGT 102
             TTT T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T
Sbjct:   183 TTTCTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTACTTAT 240

Query:   101 TTTTTGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTG 45
               T T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA   
Sbjct:   241 AATAT-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGA 297

Query:    44 GATGGAAAAAAGAAA-AAATTAAAAGTTT 17
              AT  A   AA   A AAATTA AA TTT
Sbjct:   298 AATAAATTTAATTTAGAAATTATAAATTT 326


>cbil|dbest|1185760 AA539260 LD18941.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=590
            Length = 590

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0042, P = 0.0042
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     1 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 59

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    60 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 117

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   118 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 171

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   172 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 229

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   230 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 286

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   287 AATTTAATTTAGAAATTATAAATTT 311


>cbil|dbest|1185544 AA538973 LD18656.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=591
            Length = 591

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0042, P = 0.0042
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    39 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 97

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    98 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 155

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   156 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 209

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   210 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 267

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   268 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 324

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   325 AATTTAATTTAGAAATTATAAATTT 349


>cbil|dbest|841539 AA202369 LD02653.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=592
            Length = 592

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0042, P = 0.0042
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    45 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 103

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:   104 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 161

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   162 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 215

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   216 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 273

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   274 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 330

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   331 AATTTAATTTAGAAATTATAAATTT 355


>cbil|dbest|1186960 AA540912 LD20101.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=593
            Length = 593

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0043, P = 0.0042
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    23 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 81

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    82 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 139

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   140 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 193

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   194 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 251

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   252 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 308

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   309 AATTTAATTTAGAAATTATAAATTT 333


>cbil|dbest|1083170 AA438873 LD13252.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=594
            Length = 594

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0043, P = 0.0043
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1185772 AA539272 LD18954.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=595
            Length = 595

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0043, P = 0.0043
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 230

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   231 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 287

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   288 AATTTAATTTAGAAATTATAAATTT 312


>cbil|dbest|1084206 AA439909 LD14604.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=461
            Length = 461

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0043, P = 0.0043
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|1084543 AA439991 LD15054.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=462
            Length = 462

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0043, P = 0.0043
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|1182085 AA536480 LD17022.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=462
            Length = 462

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0043, P = 0.0043
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|841515 AA202309 LD02626.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=600
            Length = 600

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0043, P = 0.0043
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 257

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   258 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 314

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   315 AATTTAATTTAGAAATTATAAATTT 339


>cbil|dbest|1082957 AA438660 LD12980.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=601
            Length = 601

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0043, P = 0.0043
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     9 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 67

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    68 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 125

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   126 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 179

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   180 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 237

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   238 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 294

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   295 AATTTAATTTAGAAATTATAAATTT 319


>cbil|dbest|1185079 AA539734 LD18052.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=602
            Length = 602

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0044, P = 0.0043
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    23 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 81

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    82 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 139

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   140 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 193

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   194 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 251

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   252 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 308

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   309 AATTTAATTTAGAAATTATAAATTT 333


>cbil|dbest|1033373 AA392014 LD10971.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=610
            Length = 610

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0044, P = 0.0044
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    40 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 98

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    99 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 156

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   157 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 210

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   211 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 268

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   269 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 325

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   326 AATTTAATTTAGAAATTATAAATTT 350


>cbil|dbest|1083218 AA438921 LD13318.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=610
            Length = 610

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0044, P = 0.0044
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1185675 AA539111 LD18828.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=374
            Length = 374

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0045, P = 0.0045
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 241


>cbil|dbest|1185805 AA539305 LD18993.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=613
            Length = 613

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0045, P = 0.0045
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    26 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 84

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    85 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 142

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   143 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 196

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   197 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 254

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   255 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 311

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   312 AATTTAATTTAGAAATTATAAATTT 336


>cbil|dbest|1185579 AA539008 LD18705.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=615
            Length = 615

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0045, P = 0.0045
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    81 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 138

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   139 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 192

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   193 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 250

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   251 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 307

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   308 AATTTAATTTAGAAATTATAAATTT 332


>cbil|dbest|1085852 AA441558 LD16535.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=616
            Length = 616

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0045, P = 0.0045
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   316 AATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084157 AA439860 LD14539.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=624
            Length = 624

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0046, P = 0.0046
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     8 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 66

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    67 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 124

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   125 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 178

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   179 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 236

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   237 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 293

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   294 AATTTAATTTAGAAATTATAAATTT 318


>cbil|dbest|1187011 AA540963 LD20172.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=631
            Length = 631

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0047, P = 0.0047
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    81 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 138

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   139 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 192

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   193 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 250

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   251 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 307

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   308 AATTTAATTTAGAAATTATAAATTT 332


>cbil|dbest|1186115 AA540067 LD19417.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=396
            Length = 396

  Minus Strand HSPs:

 Score = 200 (30.0 bits), Expect = 0.0047, P = 0.0047
 Identities = 182/316 (57%), Positives = 182/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G   TG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTACTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   201 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 258

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G C  G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   259 T-TATATTAGACATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 315

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATT  AA TTT
Sbjct:   316 AATTTAATTTAGAAATTCTAAATTT 340


>cbil|dbest|1200110 AA550100 1199m3  Lib=9[Plasmodium_falciparum|||||]
            Length=526
            Length = 526

  Plus Strand HSPs:

 Score = 206 (30.9 bits), Expect = 0.0048, P = 0.0048
 Identities = 202/342 (59%), Positives = 202/342 (59%), Strand = Plus / Plus

Query:     2 TTTTTTTTTTATTCCAAACTTTTAATTTTTTCTTTTTTCC-ATCCAATATGA-AAAT-AA 58
             TTTTTTTTTTATTC   A T T AATT TT   T TTT   ATCCA T T A AAAT AA
Sbjct:   150 TTTTTTTTTTATTCTTTA-TATAAATTCTTCAATATTTGTTATCCATTCTTATAAATTAA 208

Query:    59 AA-ACCTATTAATAAATTTAATTACCCCGGCAAAGGCACAAAAAACAACCCTCCCCAACA 117
             AA AC TAT    A AT TA TT     G  AAA   A A     CA C  TC   AA A
Sbjct:   209 AATACATATGTC-ACATATATTTTTTTAGATAAAAATATATTCCCCA-CATTCTTTAA-A 265

Query:   118 TCATACA-ACATACCAATTATTTA-ACAGGTATGGATTT-TACAAAAACACG-GTAT-TA 172
             T ATAC  A A A  AATT  TTA A A  TA   AT T TA A A A A   GTAT TA
Sbjct:   266 T-ATACCTATACATTAATTCGTTATAAACATAAATATGTATATATATATATATGTATGTA 324

Query:   173 TTTTT-TATTTTGTAAAAATATCACATCCCAAAATTTGTTTCTACAA-A-A--AAAATAC 227
             T T T TAT T G A    TAT AC T C A A TT  TTTC   AA A A  AAAATA 
Sbjct:   325 TATATGTATAT-GCATTTTTAT-ACGTAC-ATATTTCTTTTCGTTAATATATCAAAATAA 381

Query:   228 CA-C-TAAAAAACCCTTTTTCAAAACTGTTGCAACATGAAAAAAACCTTAAAAATAAATA 285
              A C T AA AA    T TT AA A T  T C A ATG AA A A    AAAAA AAATA
Sbjct:   382 AAACATTAACAATATATATT-AACATTTCTCCCA-ATGTAACATAAAAAAAAAA-AAATA 438

Query:   286 T-TACAAATTTCTGCCCTGCTTCTATCAAAGCAAA-AATAATCAATTTT-TAAAC 337
             T TA A AT T T    T   T TAT A A CA   AATA  CAATTT  TA AC
Sbjct:   439 TGTATATATATATATA-TATATATAT-ATATCAGTGAATATACAATTTAGTATAC 491


>cbil|dbest|1084488 AA440403 LD14991.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=651
            Length = 651

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0049, P = 0.0048
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   199 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 256

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   257 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 313

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   314 AATTTAATTTAGAAATTATAAATTT 338


>cbil|dbest|1085420 AA441126 LD16019.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=485
            Length = 485

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0050, P = 0.0050
 Identities = 186/316 (58%), Positives = 186/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGT--ATTTTTTT 218
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G   ATTT  TT
Sbjct:    81 ATTGTAAAAGA-ACATTGAAATAATTT-GAAAAAATTTTATTTTAAAAGACAATTTAATT 138

Query:   217 TGTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTT 159
             T T G A C    TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTT
Sbjct:   139 TATTGTACC----TT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTT 190

Query:   158 TGTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTT 100
             T T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  
Sbjct:   191 TCTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAA 248

Query:    99 TTTGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGA 43
             T T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    A
Sbjct:   249 TAT-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAA 305

Query:    42 TGGAAAAAAGAAA-AAATTAAAAGTTT 17
             T  A   AA   A AAATTA AA TTT
Sbjct:   306 TAAATTTAATTTAGAAATTATAAATTT 332


>cbil|dbest|1182293 AA536603 LD17367.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=333
            Length = 333

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0050, P = 0.0050
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    35 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 93

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    94 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 151

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   152 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 205

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   206 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 247


>cbil|dbest|1033396 AA391903 LD10995.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=670
            Length = 670

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0050, P = 0.0050
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    33 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 91

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    92 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 149

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   150 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 203

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   204 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 261

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   262 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 318

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   319 AATTTAATTTAGAAATTATAAATTT 343


>cbil|dbest|1082979 AA438682 LD13009.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=674
            Length = 674

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0051, P = 0.0051
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    26 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 84

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    85 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 142

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   143 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 196

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   197 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 254

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   255 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 311

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   312 AATTTAATTTAGAAATTATAAATTT 336


>cbil|dbest|1185642 AA539078 LD18778.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=682
            Length = 682

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0051, P = 0.0051
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    81 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 138

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   139 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 192

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   193 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 250

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   251 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 307

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   308 AATTTAATTTAGAAATTATAAATTT 332


>cbil|dbest|1185588 AA539017 LD18715.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=688
            Length = 688

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0052, P = 0.0052
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    37 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 95

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    96 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 153

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   154 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 207

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   208 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 265

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   266 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 322

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   323 AATTTAATTTAGAAATTATAAATTT 347


>cbil|dbest|1033693 AA392218 LD11205.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=315
            Length = 315

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0053, P = 0.0053
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    11 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 69

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    70 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 127

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   128 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 181

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   182 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 223


>cbil|dbest|1033087 AA391737 LD11675.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=713
            Length = 713

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0054, P = 0.0054
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    15 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 73

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    74 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 131

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   132 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 185

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   186 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 243

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   244 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 300

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   301 AATTTAATTTAGAAATTATAAATTT 325


>cbil|dbest|1084335 AA440181 LD14790.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=500
            Length = 500

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0054, P = 0.0054
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|841871 AA202822 LD03135.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=419
            Length = 419

  Minus Strand HSPs:

 Score = 199 (29.9 bits), Expect = 0.0055, P = 0.0055
 Identities = 181/314 (57%), Positives = 181/314 (57%), Strand = Minus / Plus

Query:   330 AATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTAA 273
             AATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA 
Sbjct:     1 AATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTAT 59

Query:   272 GGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGTA 214
              GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T TA
Sbjct:    60 TGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTTA 117

Query:   213 GAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGTA 155
                   A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T 
Sbjct:   118 TTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCTC 171

Query:   154 AAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTTG 96
              A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T 
Sbjct:   172 GATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT- 228

Query:    95 TGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGGA 39
             T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  A
Sbjct:   229 TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAAA 286

Query:    38 AAAAAGAAA-AAATTAAAAGTTT 17
                AA   A AAATTA AA TTT
Sbjct:   287 TTTAATTTAGAAATTATAAATTT 309


>cbil|dbest|1085064 AA440770 LD15644.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=304
            Length = 304

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0055, P = 0.0055
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 241


>cbil|dbest|1084743 AA440446 LD15292.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=302
            Length = 302

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0055, P = 0.0055
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    22 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 80

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    81 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 138

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   139 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 192

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   193 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 234


>cbil|dbest|1184626 AA539123 LD17210.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=299
            Length = 299

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0056, P = 0.0056
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:     2 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 60

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    61 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 118

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   119 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 172

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   173 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 214


>cbil|dbest|1185965 AA539917 LD19217.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=299
            Length = 299

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0056, P = 0.0056
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATATT-TATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA T TATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTCTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATA-ATACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATA ATA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAGATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A TC A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   199 TCGACTCTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 240


>cbil|dbest|1084652 AA440100 LD15181.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=293
            Length = 293

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0057, P = 0.0057
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   199 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 240


>cbil|dbest|1084971 AA440677 LD15537.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=291
            Length = 291

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0057, P = 0.0057
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    29 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 87

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    88 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 145

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   146 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 199

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   200 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 241


>cbil|dbest|1185782 AA539282 LD18966.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=514
            Length = 514

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0057, P = 0.0057
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|1084514 AA440429 LD15022.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=452
            Length = 452

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0057, P = 0.0057
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    24 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 82

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    83 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 140

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   141 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 194

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   195 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 236


>cbil|dbest|1186056 AA540008 LD19329.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=452
            Length = 452

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0057, P = 0.0057
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    23 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 81

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    82 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 139

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   140 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 193

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   194 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 235


>cbil|dbest|1033432 AA392064 LD12438.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=515
            Length = 515

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0058, P = 0.0058
 Identities = 186/316 (58%), Positives = 186/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    20 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 78

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGT--ATTTTTTT 218
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G   ATTT  TT
Sbjct:    79 ATTGTACAAGA-ACATTGAAATAATTT-GAAAAAATTTTATTTTACAAGACAATTTAATT 136

Query:   217 TGTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTT 159
             T T G A C    TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTT
Sbjct:   137 TATTGTACC----TT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTT 188

Query:   158 TGTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTT 100
             T T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  
Sbjct:   189 TCTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAA 246

Query:    99 TTTGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGA 43
             T T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    A
Sbjct:   247 TAT-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAA 303

Query:    42 TGGAAAAAAGAAA-AAATTAAAAGTTT 17
             T  A   AA   A AAATTA AA TTT
Sbjct:   304 TAAATTTAATTTAGAAATTATAAATTT 330


>cbil|dbest|1084275 AA440121 LD14712.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=289
            Length = 289

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0058, P = 0.0058
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    39 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 97

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    98 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 155

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   156 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 209

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   210 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 251


>cbil|dbest|1181869 AA536264 LD16767.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=519
            Length = 519

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0059, P = 0.0059
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|1034012 AA392662 LD11433.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=520
            Length = 520

  Minus Strand HSPs:

 Score = 204 (30.6 bits), Expect = 0.0059, P = 0.0059
 Identities = 182/315 (57%), Positives = 182/315 (57%), Strand = Minus / Plus

Query:   331 AAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTTA 274
             AAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  TA
Sbjct:     1 AAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGTA 59

Query:   273 AGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTGT 215
               GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T T
Sbjct:    60 TTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATTT 117

Query:   214 AGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTGT 156
             A      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT T
Sbjct:   118 ATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTCT 171

Query:   155 AAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTTT 97
               A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T T
Sbjct:   172 CGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATAT 229

Query:    96 GTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATGG 40
              T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT  
Sbjct:   230 -TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATAA 286

Query:    39 AAAAAAGAAA-AAATTAAAAGTTT 17
             A   AA   A AAATTA AA TTT
Sbjct:   287 ATTTAATTTAGAAATTATAAATTT 310


>cbil|dbest|1185499 AA538928 LD18601.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=457
            Length = 457

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0060, P = 0.0059
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    24 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 82

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    83 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 140

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   141 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 194

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   195 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 236


>cbil|dbest|1184635 AA539132 LD17220.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=280
            Length = 280

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0060, P = 0.0059
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 88

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    89 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 146

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   147 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 200

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   201 TCGATTTTACAAGAGTTAATATAATATTTAAGTTAATGTGAT 242


>cbil|dbest|1185697 AA539197 LD18857.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=476
            Length = 476

  Minus Strand HSPs:

 Score = 202 (30.3 bits), Expect = 0.0060, P = 0.0060
 Identities = 184/316 (58%), Positives = 184/316 (58%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGAT-AGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTT 276
             AAAATT A   TTTT G  TTG T AGA G A    A AA TTT  TAATA TTTATT  
Sbjct:    30 AAAATTTAAAGTTTTAGTATTGTTTAGA-GAAAAA-ATAATTTTAATAATAGTTTATTAG 87

Query:   275 TAAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTT 217
             TA  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T
Sbjct:    88 TATTGTAGAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAAT 145

Query:   216 GTAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTT 158
              TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT
Sbjct:   146 TTATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTT 199

Query:   157 GTAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTT 99
              T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T
Sbjct:   200 CTCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAAT 257

Query:    98 TTGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGAT 42
              T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT
Sbjct:   258 AT-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAAT 314

Query:    41 GGAAAAAAGAAA-AAATTAAAAGTTT 17
               A   AA   A AAATTA AA TTT
Sbjct:   315 AAATTTAATTTAGAAATTATAAATTT 340


>cbil|dbest|1084294 AA440140 LD14735.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=825
            Length = 825

  Minus Strand HSPs:

 Score = 209 (31.4 bits), Expect = 0.0061, P = 0.0061
 Identities = 183/316 (57%), Positives = 183/316 (57%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    31 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 89

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    90 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 147

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   148 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 201

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTGTATGATGTTGGGGAGGGTTGTTTTT 98
             T  A T  A A   GTTAA ATAAT   TA GTT  ATG TG T        TT T  T 
Sbjct:   202 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTA-ATG-TGATAAAATTATTTATAATA 259

Query:    97 TGTGCCTTTGCCGGGGTAAT-TAAAT--TTATTAATAGGTTTTTATTTTCATATTGGATG 41
             T T   TT G    G  AAT T A T  TT TTAA AGGT T TA TTT  TA    AT 
Sbjct:   260 T-TATATTAGAAATGA-AATGTTATTCGTTTTTAA-AGGTATCTAGTTTTTTAAGAAATA 316

Query:    40 GAAAAAAGAAA-AAATTAAAAGTTT 17
              A   AA   A AAATTA AA TTT
Sbjct:   317 AATTTAATTTAGAAATTATAAATTT 341


>cbil|dbest|1032719 AA391361 LD10251.5prime 5'
            Lib=594[Drosophila_melanogaster|embryo||||0_to_24_hours_mixed_stage
            _embryonic] Length=462
            Length = 462

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 0.0062, P = 0.0062
 Identities = 131/216 (60%), Positives = 131/216 (60%), Strand = Minus / Plus

Query:   332 AAAATTGATTATTTTTGCTTTGATAGAAGCAGGGCAGAAATTTG-TAATA-TTTATTTTT 275
             AAAATT A   TTTT G  TTG T  AAG A    A AA TTT  TAATA TTTATT  T
Sbjct:    28 AAAATTTAAAGTTTTAGTATTGTTTAAAGAAAAA-ATAATTTTAATAATAGTTTATTAGT 86

Query:   274 AAGGTTTTTTTCATGTTGCAACAGTTTTGAAAAAGGGTT-TTTTAGTGGTATTTTTTTTG 216
             A  GT       A  TTG AA A TTT GAAAAA   TT TTTTA   G A  TTT  T 
Sbjct:    87 ATTGTAAAAGAAAA-TTGAAATAATTT-GAAAAAATTTTATTTTAAAAGAAAATTTAATT 144

Query:   215 TAGAAACAAATTTTGGGATGTGATATTTTTACAAAATAAAAAATAA-TACCGTGTTTTTG 157
             TA      A  TT G G T T A  T TTTA  AAATAAAAAATAA TA   T TTTTT 
Sbjct:   145 TATTGT--ACCTT-GTG-TATCAG-TGTTTATTAAATAAAAAATAAATATT-TATTTTTC 198

Query:   156 TAAAATCCATACCTGTTAA-ATAATTGGTATGTTG-TATGAT 117
             T  A T  A A   GTTAA ATAAT   TA GTT  T TGAT
Sbjct:   199 TCGATTTTAAAAGAGTTAATATAATATTTAAGTTAATGTGAT 240


>cbil|dbest|284552 H24041 ym54a08.s1 3'
            Lib=263[Homo_sapiens|whole_brain||||73_days_post_natal] Length=420
            Length = 420

  Plus Strand HSPs:

 Score = 198 (29.7 bits), Expect = 0.0062, P = 0.0062
 Identities = 122/207 (58%), Positives = 122/207 (58%), Strand = Plus / Plus

Query:     2 TTTTTTTTTTATTCCAAACTTTTAATTTTTTCTTTTTTCCATCCAATATGAAAATAAAAA 61
             TTTTTTTTTT TT    ACT TTAA  T TT T  T TC AT  AA ATGA A  A A  
Sbjct:     1 TTTTTTTTTTTTTTTTTACTGTTAAAATGTTTTAATATCAATGTAAAATGAGATGAGAGT 60

Query:    62 CCTATTAATAAATTTAATTACCCCGGCAAAGGCA-CAAAAAACAACCCTC-CCCAA-CAT 118
               TA  A  A ATTT A  AC CC  CA  G    C AA A  A   CTC CCC   CA 
Sbjct:    61 TTTACAAGCAGATTTCAGAACACCAACACTGATTTCCAATATGATTTCTCTCCCTTTCAG 120

Query:   119 CATACAACATACCAAT-TATTTAACAGGTATGGATTTT-ACAAAAA-CACGGTATTATTT 175
              A  C A A A  AA  TAT  AA    TA GG TTTT ACAAAAA CA G T TT TTT
Sbjct:   121 AAGCCTAAAGATGAACATATACAAATCTTAGGGGTTTTTACAAAAAGCATGTT-TT-TTT 178

Query:   176 TTTATTTTGTAAAAATAT-CACATCCCAAA 204
             T TATTTT  A A ATAT CA  T  CAAA
Sbjct:   179 TCTATTTTC-ATACATATACAGTTGACAAA 207


WARNING:  HSPs involving 215 database sequences were not reported due to the
          limiting value of parameter B = 250.


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      343       343      10. 117 11 N/A 73   0.024 76
                                                  83   0.023 109
   -1      0      343       343      10. 117 11 N/A 73   0.024 76
                                                  83   0.023 109


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  dbEST
    Release date:  unknown
    Posted date:  9:10 AM EST Dec 21, 1997
    Format:  BLAST
  # of letters in database:  500,351,318
  # of sequences in database:  1,352,941
  # of database sequences satisfying E:  465
  No. of states in DFA:  166 (166 KB)
  Total size of DFA:  174 KB (192 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  21.10u 1.07s 22.17t  Elapsed: 00:00:05
  Total cpu time:  21.54u 1.17s 22.71t  Elapsed: 00:00:05
  Start:  Thu Feb  5 21:19:51 1998   End:  Thu Feb  5 21:19:56 1998

WARNINGS ISSUED:  2

Date: 16:17:21 on Sun 17 Dec 117.