blastn_dbest_files/764186_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  764186
        (325 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|764186 AA125683 MLLG0239.M1F 3'-end Lib=558[Sc...  1625  3.4e-67   1



>cbil|dbest|764186 AA125683 MLLG0239.M1F 3'-end
            Lib=558[Schistosoma_mansoni|||||Lung] Length=325 Author_cmt: E.
            coli hypothetical 53.1 KD protein
            Length = 325

  Plus Strand HSPs:

 Score = 1625 (243.8 bits), Expect = 3.4e-67, P = 3.4e-67
 Identities = 325/325 (100%), Positives = 325/325 (100%), Strand = Plus / Plus

Query:     1 TCTGGTCATTTTCTTATGTGGCAATCGTCATTTCACTCATACCCGCGGCGTTAACAAAAA 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 TCTGGTCATTTTCTTATGTGGCAATCGTCATTTCACTCATACCCGCGGCGTTAACAAAAA 60

Query:    61 AGTACTGCGTGCGACAAACTTTCTCCTGCCGAACTGGGGATGGCTGCTGGTTCTGCTGGT 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AGTACTGCGTGCGACAAACTTTCTCCTGCCGAACTGGGGATGGCTGCTGGTTCTGCTGGT 120

Query:   121 TGGCAACGCCTGCACTGATTACCATACTGTTCTGGAAAGAGTGGTCGGTATACGCCTTAA 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 TGGCAACGCCTGCACTGATTACCATACTGTTCTGGAAAGAGTGGTCGGTATACGCCTTAA 180

Query:   181 TTGTCGCGACTATTATTGGCCTGGGTGTACTGGCAAAAATTTATCGCAAAGCAGAAAACC 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 TTGTCGCGACTATTATTGGCCTGGGTGTACTGGCAAAAATTTATCGCAAAGCAGAAAACC 240

Query:   241 AGAAACAGCGGAAGGAGCTGGGGCTGATTGTGACGCTCACCTTCTTCAGTATGTTGGTTC 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 AGAAACAGCGGAAGGAGCTGGGGCTGATTGTGACGCTCACCTTCTTCAGTATGTTGGTTC 300

Query:   301 TCGGGCCTTCGCACAACAGGGCGGT 325
             |||||||||||||||||||||||||
Sbjct:   301 TCGGGCCTTCGCACAACAGGGCGGT 325


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      325       325      10. 118 11 N/A 73   0.023 76
                                                  82   0.022 108
   -1      0      325       325      10. 118 11 N/A 73   0.023 76
                                                  82   0.022 108


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  /usr/local/db/others/blast/dbEST
    Release date:  unknown
    Posted date:  10:29 AM EDT Sep 6, 1998
    Format:  BLAST
  # of letters in database:  680,019,941
  # of sequences in database:  1,803,623
  # of database sequences satisfying E:  1
  No. of states in DFA:  221 (221 KB)
  Total size of DFA:  229 KB (256 KB)
  Time to generate neighborhood:  0.00u 0.01s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  18.74u 2.29s 21.03t  Elapsed: 00:00:04
  Total cpu time:  18.74u 2.49s 21.23t  Elapsed: 00:00:04
  Start:  Sat Sep 26 12:32:52 1998   End:  Sat Sep 26 12:32:56 1998

Date: 17:16:22 on Mon 18 Dec 117.