blastn_dbest_files/824906_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  824906
        (284 letters)

Database:  dbEST
           1,352,941 sequences; 500,351,318 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|824906 AA185847 SW3ICA1946SK 5' Lib=282[Brugi...  1413  1.1e-57   1
A cbil|dbest|829323 AA190252 SWWb1A280SK 5' Lib=518[Wucher...  1129  7.3e-45   1
A cbil|dbest|813613 AA174605 ms76h03.r1 5' Lib=553[Mus_mus...   184  0.032     1
A cbil|dbest|370383 H68979 yr85h03.r1 5' Lib=262[Homo_sapi...   182  0.049     1
A cbil|dbest|1200439 AA550429 1580m3  Lib=9[Plasmo...   177  0.059     1
A cbil|dbest|504790 N97716 1701C3  Lib=114[Plasmo...   177  0.072     1
A cbil|dbest|1199977 AA549967 1044m3  Lib=9[Plasmo...   176  0.14      1
A cbil|dbest|2953 T02771 0110M3  Lib=9[Plasmodi...   168  0.17      1
A cbil|dbest|1249493 C42086 C42086 5' Lib=162[Caenorhabditi...   166  0.20      1
A cbil|dbest|967686 AA326462 EST29641 5'-end Lib=742[Homo_...   169  0.21      1
A cbil|dbest|1387092 AA681027 ET5 5' Lib=1038[Trypanosoma_b...   164  0.21      1
A cbil|dbest|456915 N51386 yz16f05.s1 3' Lib=390[Homo_sapi...   164  0.41      1
A cbil|dbest|455786 N50257 yy84e03.r1 5' Lib=390[Homo_sapi...   157  0.48      1
A cbil|dbest|447819 D79714 HUM312C11B 5' Lib=395[Homo_sapi...   157  0.48      1
A cbil|dbest|588993 W80781 zd83d03.s1 3' Lib=424[Homo_sapi...   162  0.63      1
A cbil|dbest|989796 AA348571 EST55040 5'-end Lib=806[Homo_...   152  0.69      1
A cbil|dbest|51840 T23044 AB211C8R 5' Lib=125[Homo_sapien...   150  0.80      1
A cbil|dbest|127243 F08259 HSCZOH041  Lib=186[Hom...   150  0.80      1
A cbil|dbest|201715 R31670 yh63a09.s1 3' Lib=271[Homo_sapi...   160  0.96      1
A cbil|dbest|851740 AA212447 mw76f12.r1 5' Lib=598[Mus_mus...   144  0.96      1
A cbil|dbest|504716 N97882 1440C3  Lib=114[Plasmo...   159  0.97      1
A cbil|dbest|100695 F02439 HSC0ZC072 3' Lib=186[Homo_sapie...   150  0.98      1
A cbil|dbest|151582 F12687 HSC3DA061  Lib=186[Hom...   155  0.98      1
A cbil|dbest|873723 AA234196 zr54a01.r1 5' Lib=589[Homo_sa...   144  0.99      1
A cbil|dbest|504402 N97552 0443C3  Lib=114[Plasmo...   143  0.997     1
A cbil|dbest|921682 AA280658 zs96d07.r1 5' Lib=595[Homo_sa...   158  0.999     1
A cbil|dbest|442446 N40996 yy80f04.s1 3' Lib=390[Homo_sapi...   137  0.9997    1
A cbil|dbest|469477 N63726 za24h09.s1 3' Lib=262[Homo_sapi...   133  0.99995   1



>cbil|dbest|824906 AA185847 SW3ICA1946SK 5' Lib=282[Brugia_malayi|||||]
            Length=284
            Length = 284

  Plus Strand HSPs:

 Score = 1413 (212.0 bits), Expect = 1.1e-57, P = 1.1e-57
 Identities = 283/284 (99%), Positives = 283/284 (99%), Strand = Plus / Plus

Query:     1 CTGTATTCATTTTNCTTTTCTTTGCAAACATCATCACTGTGTTCAAACACCTGATAATAT 60
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CTGTATTCATTTTNCTTTTCTTTGCAAACATCATCACTGTGTTCAAACACCTGATAATAT 60

Query:    61 TGTTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTATAACTTTCGTC 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 TGTTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTATAACTTTCGTC 120

Query:   121 GTTGTTTTAATATTAGATAATTGACATTTGTGTAAAATCTTAGTAGTTGTTGCTACTGCT 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GTTGTTTTAATATTAGATAATTGACATTTGTGTAAAATCTTAGTAGTTGTTGCTACTGCT 180

Query:   181 GAAATCTTGGATGTGAAAATCTTCAGACGCAGTGTCTGGATGTTTTGAATGTTGTAAAGA 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 GAAATCTTGGATGTGAAAATCTTCAGACGCAGTGTCTGGATGTTTTGAATGTTGTAAAGA 240

Query:   241 TACTAAATGATTCTGTTCAGCTGATAAACTTTTGATAGTTCAAA 284
             ||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 TACTAAATGATTCTGTTCAGCTGATAAACTTTTGATAGTTCAAA 284


>cbil|dbest|829323 AA190252 SWWb1A280SK 5'
            Lib=518[Wuchereria_bancrofti|||||microfilaria] Length=279
            Length = 279

  Plus Strand HSPs:

 Score = 1129 (169.4 bits), Expect = 7.3e-45, P = 7.3e-45
 Identities = 249/281 (88%), Positives = 249/281 (88%), Strand = Plus / Plus

Query:     1 CTGTATTCATTTTNCTTTTCTTTGCAAACATCATCACTGTGTTCAAACACCTGATAATAT 60
             CTGTATTCA TTT C TTTCTT GC   CATCATCACTGTGTTCAAACACCTGA AATAT
Sbjct:     1 CTGTATTCANTTTCCNTTTCTTNGCNNNCATCATCACTGTGTTCAAACACCTGANAATAT 60

Query:    61 TGTTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTATAACTTTCGTC 120
             TGTTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTATAAC TTCGTC
Sbjct:    61 TGTTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTATAACNTTCGTC 120

Query:   121 GTTGTTTTAATATTAGATAATTGACATTTGTGTAAAATCTTAGTAGTTGTTGCTACTGCT 180
             GTTGT T AATATTA ATAATTGACATTTGTGT AAATCTTAG AGTTGT GCTACTGCT
Sbjct:   121 GTTGTNTNAATATTANATAATTGACATTTGTGTNAAATCTTAGNAGTTGTNGCTACTGCT 180

Query:   181 GAAATCTTGGATGTGAAAATCTTCAGACGCAGTGTCTGGATGTTTTGAATGTTGTAAAGA 240
             GAAATCT GGATGTGAAAATCT CA AC CA TGTCTGGATGTTT GAATGTTGTA AGA
Sbjct:   181 GAAATCTGGGATGTGAAAATCTACANACNCACTGTCTGGATGTTT-GAATGTTGTATAGA 239

Query:   241 TACTAAATGATTCTGTTCAGCTGATAAACTTTTGATAGTTC 281
             TAC AAATGA  CTGT CAGCT AT AACTT  GAT GT C
Sbjct:   240 TACCAAATGAA-CTGT-CAGCTNATCAACTTC-GATTGTCC 277


>cbil|dbest|813613 AA174605 ms76h03.r1 5'
            Lib=553[Mus_musculus||Spleen|||4_weeks] Length=303
            Length = 303

  Plus Strand HSPs:

 Score = 184 (27.6 bits), Expect = 0.032, P = 0.032
 Identities = 160/257 (62%), Positives = 160/257 (62%), Strand = Plus / Plus

Query:     2 TGTATTCATTTTNCTTTTCTTTGCAAACATCATCACT-GTGTTCAAACACCTGATAATAT 60
             TG  TT A   T CTT   T T CAA  A CA C  T GTGTT  AA A  T ATAA A 
Sbjct:     7 TGCTTTTAAAATGCTTAATTATTCAATTAACACCGTTTGTGTTATAATATAT-ATAAAAC 65

Query:    61 TGTTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTATAACTTTCGTC 120
             TG  AT TA AA T GTT     T TC A A  ATTTC  TTA ATGTATA CT TC T 
Sbjct:    66 TGACATGTAGAAGT-GTT-----TGTCCAGAACATTTC--TTAAATGTATA-CTGTCTTT 116

Query:   121 GTTGT-TTTAATATTAG-ATAA--TTGACATTTGTGTAAAATCTTAGTAGTTGTT-GC-- 173
                G  TTTAATAT AG AT    TT  CA      TAA  T T  GT G TG   GC  
Sbjct:   117 AGAGAGTTTAATAT-AGCATGTCTTTTGCAACATACTAACTTTTGTGTTGGTGCGAGCAA 175

Query:   174 TACTGC-T-GAAATCTTGGATGTGAAA-ATCTTCAGACGCAGTGTCTGGATGTTTTGAAT 230
             TA TG  T G  AT TTG A G GA   AT TTCA A G AGTGTC G  TGTTTTGAAT
Sbjct:   176 TATTGTGTAGTCATTTTGAAAG-GAGTCAT-TTCA-ATG-AGTGTCAGATTGTTTTGAAT 231

Query:   231 GTTGTA-AAGATACTAAATG-ATTCT-GTTC 258
             GTT T  AA AT  TAAATG A  CT GTTC
Sbjct:   232 GTTATTGAACATTTTAAATGCAGACTTGTTC 262


>cbil|dbest|370383 H68979 yr85h03.r1 5'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=437
            Length = 437

  Minus Strand HSPs:

 Score = 182 (27.3 bits), Expect = 0.050, P = 0.049
 Identities = 86/136 (63%), Positives = 86/136 (63%), Strand = Minus / Plus

Query:   188 AAGATTTCAGCAGTAGCAAC-AACTACTAAGATTTTACACAAATGTCAATTA-TCTAATA 131
             AAGATTTCAGCA   G AA  AA TA TAA ATTTT C  A  T T AATTA T  AA A
Sbjct:    83 AAGATTTCAGCATCCGAAATGAAGTA-TAAAATTTTCCTAATGTATAAATTAATGGAACA 141

Query:   130 TTAAAACAACGACGAAAGTTATACATATAATGGAAATACTGTAGAAATATGGAACAATTT 71
             TT   A A   AC AAAGT  TAC TAT  T  AAA A T TAGA A  T  AA  A TT
Sbjct:   142 TTCTCAAATTTAC-AAAGTAGTACTTATGTTTTAAA-AGTATAGAGACTTACAATGACTT 199

Query:    70 TTATAT-AACAATATTATC 53
                TAT AA AA ATT TC
Sbjct:   200 AAGTATGAAAAAAATTGTC 218


>cbil|dbest|1200439 AA550429 1580m3  Lib=9[Plasmodium_falciparum|||||]
            Length=332
            Length = 332

  Plus Strand HSPs:

 Score = 177 (26.6 bits), Expect = 0.061, P = 0.059
 Identities = 105/173 (60%), Positives = 105/173 (60%), Strand = Plus / Plus

Query:     4 TATTCATTTTNCTTTTCTTTGCAAACATCATCACTGTGTTCAA-AC-ACCTGATAATATT 61
             T TTCA TT   T     TT  A  CATC   A T TGTTC A A  A  T  TAAT TT
Sbjct:    47 TCTTCACTTGAATAGAAATTATAGTCATCGAAATTTTGTTCCACATTATTTTCTAAT-TT 105

Query:    62 GTTATATAAAAATTG-TTC-CAT-ATTTCTACAGTATTTCCATTATATGTATA-ACTTTC 117
             GTTAT    A  TTG TT  CAT ATT  T   G ATT CC  T T T TAT  AC    
Sbjct:   106 GTTATCCCCATTTTGATTATCATTATTATTTTTGAATTCCCCATCTTT-TATTGACGGCT 164

Query:   118 GTCGTTGTTTTAATAT-TAGATAATTGACATTTGTGTAAAATCTTAG-TAGTTGTT 171
             GT G TG TTTAATAT T GAT ATTGACATTTGTGT A  T T AG T  TT TT
Sbjct:   165 GT-GATGATTTAATATCTTGATTATTGACATTTGTGTTATTTGTAAGATCATTATT 219


>cbil|dbest|504790 N97716 1701C3  Lib=114[Plasmodium_falciparum|||||]
            Length=407
            Length = 407

  Minus Strand HSPs:

 Score = 177 (26.6 bits), Expect = 0.075, P = 0.072
 Identities = 129/218 (59%), Positives = 129/218 (59%), Strand = Minus / Plus

Query:   271 AAGTT-TATCAGCTGAACAGAATCATTTAGTATCTTTACAACATTCAAAACATCCAGACA 213
             AAGTT TAT  GC  AA AG AT AT T G A     A AA A   AAAA AT  A A A
Sbjct:   114 AAGTTATATACGCC-AA-AGTATTATAT-GAAAGAAAAAAAAAAAAAAAAAATATATATA 170

Query:   212 C-TGCGTCTGAAGATTTTCACA-TCCAAGATTTCAGCAGTAGCAACAACTACTAAGATTT 155
               T   T T AA ATTTT AC  TC  A AT T    A TA   A A  TA TA    TT
Sbjct:   171 TATATATATAAATATTTTTACTGTCTCACATATATATATTATATATATATA-TATTTCTT 229

Query:   154 TACACAAATGTCAAT-TATCTA-ATATTAAAACAACGACGAAAGTTATACATATAATGGA 97
             T CA  A T T A T TAT TA ATAT A AA  AC A   A GTTATACATAT AT  A
Sbjct:   230 TTCAATAGTATTACTATATATATATATAATAAATACTATATATGTTATACATATTATT-A 288

Query:    96 AATACTGTAGAAATATGGAACAATTTTTATATAACA-ATAT-TAT 54
             A TA T TA AA TAT  A CA    T ATAT  CA ATAT TAT
Sbjct:   289 A-TAATATATAATTATATACCATAAATAATATT-CATATATATAT 331


>cbil|dbest|1199977 AA549967 1044m3  Lib=9[Plasmodium_falciparum|||||]
            Length=536
            Length = 536

  Minus Strand HSPs:

 Score = 176 (26.4 bits), Expect = 0.15, P = 0.14
 Identities = 120/188 (63%), Positives = 120/188 (63%), Strand = Minus / Plus

Query:   207 TCTGAAG-ATTTTCACA-TCCA-AG-ATTTCAGCAGTAGCAACAACTACTAAGATTTTAC 152
             TC  AAG ATTTT ACA T  A A  ATTTC    GT  CA  AA T  TA  ATT TA 
Sbjct:   142 TCAAAAGTATTTTTACAATATATATCATTTCTTT-GTT-CATTAA-TGTTATTATTATAT 198

Query:   151 ACAAATGTC-AATTATCTAATATTAAA-ACAACGACGAAAGT-TAT-ACATATAATGGAA 96
                A  GT  AAT ATC  ATATT A  ACAA GAC AA  T TAT AC TA  AT    
Sbjct:   199 GTTATGGTATAATCATC--ATATTGACGACAA-GACAAATTTGTATTAC-TANNATTTTT 254

Query:    95 ATACTGTAG-AAATATGGAACA-A-TTTTTATATAACAATATTATCAGGTGTTTGAACAC 39
               A T TA  AAATA G A CA A TTTTTATAT ACAATA TAT A  T TTT AA   
Sbjct:   255 TAAATTTAATAAATACGCATCATAATTTTTATATGACAATAATATGATATTTTTCAAAGA 314

Query:    38 AGTGATGATGTTTGCAA 22
             A T AT AT TTT CAA
Sbjct:   315 ATTTAT-ATCTTT-CAA 329


>cbil|dbest|2953 T02771 0110M3  Lib=9[Plasmodium_falciparum|||||]
            Length=278
            Length = 278

  Minus Strand HSPs:

 Score = 168 (25.2 bits), Expect = 0.19, P = 0.17
 Identities = 94/146 (64%), Positives = 94/146 (64%), Strand = Minus / Plus

Query:   166 CTACTAAGATTTTACACAAATGTCAA-TTATCTAATATT-AAAACAACGACGAAAGTTAT 109
             CTA  AAGA T  A  CAAA  T A  TTAT TAA ATT AAAACAA  A GA  GTTAT
Sbjct:    48 CTAA-AAGAATAAATTCAAAACTTAGGTTATTTAA-ATTCAAAACAAAAAGGAC-GTTAT 104

Query:   108 ACATATAATGGAA-ATACTGTAGAA-ATATGGAACAATTTT-TATATA-ACAATATTA-- 55
             ACATAT  TGG A ATA T TA AA AT   GA C    TT TATATA A AA ATT   
Sbjct:   105 ACATATTTTGGCATATA-TATAAAACATTAAGATCTTCATTATATATAGATAAGATTGGT 163

Query:    54 TCAGGTGT-TTGAACACAGTGATGATGTTT 26
             TCA    T TT   CA AGTG T  T TTT
Sbjct:   164 TCATCATTATTTTCCAGAGTGTTATTATTT 193


>cbil|dbest|1249493 C42086 C42086 5' Lib=162[Caenorhabditis_elegans|||||]
            Length=376
            Length = 376

  Minus Strand HSPs:

 Score = 166 (24.9 bits), Expect = 0.22, P = 0.20
 Identities = 134/225 (59%), Positives = 134/225 (59%), Strand = Minus / Plus

Query:   284 TTTGAACTATCAAAAGTTTATCAGCTGAACAGAATCATTT-AGTATCTTTACAACATTCA 226
             TTT  A TAT A AA  TTAT A  T A  A AAT ATTT AG A  TTTA AA  TT A
Sbjct:   120 TTTTTA-TATTAGAAAATTAT-ATATTAT-ATAATTATTTTAGGAAATTTAAAAT-TTGA 175

Query:   225 AAACATCCAGACAC-TGCGTCTGAAGATTTTCACATCCAAGATTTCAGCAGTAGCAACAA 167
             A    T  A A    TG  T   AA ATTTTC  A      ATTT AG    A     AA
Sbjct:   176 AGTGTTTTAAATTTATGTTTTACAACATTTTCCTAATTTT-ATTTAAGTTTAATTTTTAA 234

Query:   166 CT-ACTAAGATTTTACACAA-ATGTCAATTATCTAATA-TTAAAAC-AACGACGAAAGTT 111
              T A TAA  TTTTA   AA A  T AATT    AATA TTAAA   AA  A   AA TT
Sbjct:   235 TTTAATAAAGTTTTATTAAATAAAT-AATTGGTAAATAATTAAATTTAATAANTTAATTT 293

Query:   110 AT-AC--A--TATAATGGAAATACTGTAGAAATATGGAACAATTTTTATATAA 63
             AT A   A  TATAATGGAAA ACTG  GAA T TGGA CAATT TT T TAA
Sbjct:   294 ATTATTAAAATATAATGGAAAAACTG--GAANTCTGGANCAATTGTTTTTTAA 344


>cbil|dbest|967686 AA326462 EST29641 5'-end
            Lib=742[Homo_sapiens|brain|cerebellum|||adult] Length=442
            Author_cmt: similar to acyl-Coenzyme A dehydrogenase, C-4 to C-12
            straight-chain
            Length = 442

  Minus Strand HSPs:

 Score = 169 (25.4 bits), Expect = 0.24, P = 0.21
 Identities = 135/226 (59%), Positives = 135/226 (59%), Strand = Minus / Plus

Query:   268 TTTATCAGCTGAACAGAATCATTTAGTA-TCTTTACAACATTCAAAACATCCAGACACTG 210
             TTTAT A    AACA A  C T T  TA T T TA AA  TT AA A ATC A   A T 
Sbjct:   131 TTTAT-ATTACAACACAG-CTTATGCTACTGTCTAAAATGTTGAATAAATCAAAGTATTT 188

Query:   209 C-GT-CTGAAGAT-TTTCACATCCAAG-ATTTCAGCAGTAGCAACAACTACTAAGATTTT 154
               GT CT AAGAT TTT AC T CA   AT T      T GCA  A  TA  AAG T  T
Sbjct:   189 ATGTACTAAAGATATTTAACCTACACTTATATTTTNNTT-GCAG-ATTTATGAAGGTACT 246

Query:   153 ACACAAATGTCAATTATCTAATATTAAAAC---AACG-AC-GA-AAGTTATACATATAAT 100
              CACAAAT TCAA  A CT AT  TA   C   AAC  A  GA AAGT   A A  TAA 
Sbjct:   247 TCACAAAT-TCAAAGA-CTTATTGTAGCCCGTGAACACATTGACAAGTACAAAANTTAAA 304

Query:    99 GGAAATACTGTAGAAATATGGAACAATTTTTATATAA-CAA-TATTATCAGGT 49
               AA TACTGTAGAAATAT GAA AA T   A A AA C A T TT TCAG T
Sbjct:   305 AAAATTACTGTAGAAATATTGAATAACTAGAACACAAGCCACTGTT-TCAGCT 356


>cbil|dbest|1387092 AA681027 ET5 5'
            Lib=1038[Trypanosoma_brucei_rhodesiense|||||Insect_form] Length=325
            Length = 325

  Plus Strand HSPs:

 Score = 164 (24.6 bits), Expect = 0.24, P = 0.21
 Identities = 100/155 (64%), Positives = 100/155 (64%), Strand = Plus / Plus

Query:     2 TGTATTCATTTTNCTT-TTCTT-TGCAAACATCATCACTGTG-TT--CAAACACCTGATA 56
             TGTATT  TT T     TT TT TG A A AT A  A T T  TT  CAAA A  TG T 
Sbjct:   136 TGTATTTTTTATGGGAATTATTATGTACATATTAATATTTTTATTATCAAAGAAATG-TG 194

Query:    57 ATATTGTTATA-TAAAAATTGTTCCATATTTCT-ACAGTATTTCCATTATATGTATAACT 114
              TAT  T ATA TAAA ATT TT CATA T  T A A TAT T  AT ATAT TAT A T
Sbjct:   195 -TATCAT-ATAATAAATATTTTTACATAGTAATGATA-TATATGTAT-ATATATATTAAT 250

Query:   115 TTCGTCGTTGTTT-TAATATTAGATAATTGACATTTGTGTAA 155
              T GT GTT  T  TAATATTAGAT ATT   AT TGT T A
Sbjct:   251 GTAGT-GTTAATAATAATATTAGATGATTTT-ATGTGTTTTA 290


>cbil|dbest|456915 N51386 yz16f05.s1 3'
            Lib=390[Homo_sapiens||multiple_sclerosis_lesions|||Age_46]
            Length=508 Author_cmt: gb|M87889|HUMALCD140 Human carcinoma
            cell-derived Alu RNA transcript, (rRNA); gb:X02067 H.sapiens mRNA
            for 7SL RNA pseudogene (HUMAN);contains L1.t1 L1 repetitive element
            ;
            Length = 508

  Minus Strand HSPs:

 Score = 164 (24.6 bits), Expect = 0.52, P = 0.41
 Identities = 104/169 (61%), Positives = 104/169 (61%), Strand = Minus / Plus

Query:   214 CACTGCGTCTGA-AGAT-T-TTCACATCCAAGAT--TT-CAGCAGTAGCAACAACTA-CT 162
             CA TG  TC  A AGAT T TTCAC  CCA G T  TT CAGCA TA   ACAA TA C 
Sbjct:    74 CAGTGTATCAAAGAGATATCTTCACTCCCATGTTCATTGCAGCATTATTCACAA-TAGCC 132

Query:   161 AAGATTTTACACAAATGTCAATTATCTAATATTAAAACAACGACGAAAGT-TAT-ACATA 104
             AAGAT T   A  AA  T AA T TC A  ATT  A   A  A GAAA T T   ACAT 
Sbjct:   133 AAGATGTGGAATCAACCT-AAGTGTCCATCATTGGATGGATAAAGAAAATGTGGCACATG 191

Query:   103 TAA-TGGAAATACTGTAGAAATA-TGGAACAATTTTTATATAACAATATTAT 54
              AA TGGAAATAC  T GAAA A TG A C  TTT  A A AA AA ATT T
Sbjct:   192 CAAATGGAAATACAATGGAAACAATGCAGCC-TTTAAAAAGAAGAAAATTCT 242


>cbil|dbest|455786 N50257 yy84e03.r1 5'
            Lib=390[Homo_sapiens||multiple_sclerosis_lesions|||Age_46]
            Length=249 Author_cmt: gb|M87899|HUMALCE272 Human carcinoma
            cell-derived Alu RNA transcript, (rRNA); gb:X14008_rna1 LYSOZYME C
            PRECURSOR (HUMAN);
            Length = 249

  Plus Strand HSPs:

 Score = 157 (23.6 bits), Expect = 0.65, P = 0.48
 Identities = 123/199 (61%), Positives = 123/199 (61%), Strand = Plus / Plus

Query:     9 ATTTTNCTTTTCTTTGCAAACATCATCACTGTGTTCAAACACCTGATAATATTGTT-ATA 67
             ATT T   TTTCT T CA A  T AT A TG G  CA   AC T A AAT T GTT ATA
Sbjct:    40 ATTCTGTGTTTCTATACAGAGCTGATGATTGCG--CATGTACTTAA-AATGT-GTTCATA 95

Query:    68 TAAAAATTGTTCCATATTTCTACAGTATTTC-CATTA-TAT-GTATAACTTT-CGTCGTT 123
                 AA  GTT  A ATT   A AG   T C CA TA TA  GT T   TTT C TC TT
Sbjct:    96 GTTCAAGAGTTAGA-ATTAGAATAGAGATACTCACTAATAGAGT-TGTGTTTACCTC-TT 152

Query:   124 GTTTTAATATTAGATAATTGACATTTGTGTAAAATCTTAGTAGTTGTTG--CTA-CTGCT 180
                T  ATATTA ATA TTGACATTTGTGT AAAT T A  A TTG     CT  CTGC 
Sbjct:   153 CCATAGATATTA-ATACTTGACATTTGTGTGAAATATGAA-ATTTGAACACCTTTCTGCC 210

Query:   181 GAAATCT-TGGATGTGAAAATCTTCAGA 207
               AA CT TG AT TGA A T TT  GA
Sbjct:   211 TTAA-CTATGAAT-TGACATTTTTTTGA 236


>cbil|dbest|447819 D79714 HUM312C11B 5' Lib=395[Homo_sapiens||aorta|||]
            Length=247
            Length = 247

  Minus Strand HSPs:

 Score = 157 (23.6 bits), Expect = 0.66, P = 0.48
 Identities = 119/192 (61%), Positives = 121/192 (63%), Strand = Minus / Plus

Query:   193 CATCCAAGATTTCAGCAGTAGCAACAACTACTAAGATTTTACACAAA-TGTCAATT--AT 137
             C T CAAG  TTCA  A TAG AA AA TA  AA A T TA A AAA T  CAA    AT
Sbjct:    12 CTTTCAAGTATTCAA-A-TAGAAA-AA-TATAAACAATGTAAATAAAATAGCAAAACAAT 67

Query:   136 CTAATAT-TAAAACAACGACGAAAGTTATACATATAATGGAAATACTGTAGAAATATGGA 78
              TAATAT T A A AAC  C AA G TA A A A  AT  A  T CT T GAAAT T  A
Sbjct:    68 GTAATATCTCATAAAACTGC-AATGGTA-A-A-AGCATTTA--TCCTATTGAAAT-TCCA 120

Query:    77 ACAATTTTTATATAACAATATTATCAGGTGTTTGAA-CACAGTGATGATGTTTGCAAAGA 19
              CAATTTTTAT T A AATATTATC G   T T A  CA AGTG   AT TT G +A +A
Sbjct:   121 -CAATTTTTATTTGAAAATATTATC-GACATGTAATTCA-AGTGGC-AT-TTAG-RAGRA 174

Query:    18 AAAGNAAAATGAATACA 2
              AA   AAA G A ACA
Sbjct:   175 TAATTTAAAAGCA-ACA 190


>cbil|dbest|588993 W80781 zd83d03.s1 3' Lib=424[Homo_sapiens|heart||||19_weeks]
            Length=428
            Length = 428

  Minus Strand HSPs:

 Score = 162 (24.3 bits), Expect = 1.0, P = 0.63
 Identities = 124/203 (61%), Positives = 124/203 (61%), Strand = Minus / Plus

Query:   204 GAAGATTTTC-ACATCCAAGATTTCAGCAGT-AGCAACAACTACTAAGATTTTACACAAA 147
             G AG TTTTC ACA   A  ATTTCA CA T A CAA A  TA  AA AT   A    AA
Sbjct:     1 GCAG-TTTTCTACAATGATCATTTCATCAATTATCAATAT-TATCAAAATCAAATGAGAA 58

Query:   146 TGTCAATTATC-TAATATTAAAACAACGACGAAAGTTATACATATAATGGAAATACTGTA 88
             TGTCAATTAT  TAAT TTA AA  A  A  AAA T AT   T TAA   AAAT CT TA
Sbjct:    59 TGTCAATTATTATAATTTTATAATGAGTAA-AAACTCATT--T-TAA---AAAT-CTCTA 110

Query:    87 GAAATATGGAACAATTTTTA-T-ATAACAATATTATCAGGTGTTTGAACACAG-TGATGA 31
                A A  GA CA T T    T ATAACAAT T AT A G  T T AACACA  TG   A
Sbjct:   111 TCCAAAGTGATCATTCTGGCCTCATAACAAT-T-ATAATGGCTATTAACACACCTGTAAA 168

Query:    30 TGTTTGCAAAGAAAAGNAAAATGAATACA 2
             TG   G  A  A  AG AAAA  AATACA
Sbjct:   169 TGACAGACATTAGCAGTAAAA--AATACA 195


>cbil|dbest|989796 AA348571 EST55040 5'-end
            Lib=806[Homo_sapiens|brain|hippocampus|||adult,_74_yrs] Length=268
            Length = 268

  Plus Strand HSPs:

 Score = 152 (22.8 bits), Expect = 1.2, P = 0.69
 Identities = 92/142 (64%), Positives = 92/142 (64%), Strand = Plus / Plus

Query:    84 TTTCTACAGTATTTCCATTATATGT-ATAACT-TTC-GTCGTTGT-TT-TAATATTAGAT 138
             TTTC ACAG  TTTC  TTATAT T ATA CT TTC G    TG  TT T AT TTAGAT
Sbjct:    55 TTTC-ACAGG-TTTC--TTATATTTTATATCTCTTCTGAACATGAATTGTCATTTTAGAT 110

Query:   139 AATTGACATTTGTGTAAAATCTTAGTAGTTGTTGCTA-CTGCTGAAATCTTGGATGTGAA 197
               TTGACATTTGT T AAA    AG AGTTG  G  A CT C GAA  CT G A  T   
Sbjct:   111 TTTTGACATTTGTATCAAAAG--AGAAGTTGAGGAAATCTTCAGAACACTGGTAACTTTT 168

Query:   198 AATCTTCAGACGCAGTGTCTGGA-TGTTT 225
             A T TT   A   A T TC G A TGTTT
Sbjct:   169 AGTTTTNNTATAGACT-TCAGAAGTGTTT 196


>cbil|dbest|51840 T23044 AB211C8R 5' Lib=125[Homo_sapiens|||||] Length=210
            Length = 210

  Plus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 1.6, P = 0.80
 Identities = 120/196 (61%), Positives = 120/196 (61%), Strand = Plus / Plus

Query:    12 TTNCTTTTCTTTGCAAACATCATCACTGTGTTCAAACACCTGATAATATTGTTATATAAA 71
             TT  TTT CTT GCA    TC T A  G GTTCA  CA  T  TA  AT G T  A AAA
Sbjct:     4 TTATTTTACTTGGCATG--TCTTAAG-G-GTTCATTCATGTTGTAGCATGGGTC-A-AAA 57

Query:    72 AATTGTTCCATATTTCTACAG--TA-T-TTCCATTATATGTATAACTTTCGTCGTTGTTT 127
               TT TTCC T TTT   C G  TA T TTCCATTATAT TAT A TT CGT  TTG  T
Sbjct:    58 TTTTCTTCCTTTTTTAGGCTGAATAATATTCCATTATATATATGANTTACGTATTTGAGT 117

Query:   128 TAATATTAGAT-AATTG-ACATTTGTGTAAAA-TCT-TAGTAGTTGTTGCTACTG-CTGA 182
              A T T AGAT AATT  A A  TG  TA A  T T T  TA TT TT  TA  G C G 
Sbjct:   118 CA-TGT-AGATGAATTATATACATGAATATATGTATCTCCTATTTATTTTTAAAGGCAGC 175

Query:   183 AATCTTGGATGTGAAAATCTTCAGA 207
             AA  TTG AT T A  AT TT A A
Sbjct:   176 AAA-TTGTAT-TAATGATTTTGATA 198


>cbil|dbest|127243 F08259 HSCZOH041 
            Lib=186[Homo_sapiens|brain|total_brain|||3_months_old] Length=210
            Length = 210

  Plus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 1.6, P = 0.80
 Identities = 120/196 (61%), Positives = 120/196 (61%), Strand = Plus / Plus

Query:    12 TTNCTTTTCTTTGCAAACATCATCACTGTGTTCAAACACCTGATAATATTGTTATATAAA 71
             TT  TTT CTT GCA    TC T A  G GTTCA  CA  T  TA  AT G T  A AAA
Sbjct:     4 TTATTTTACTTGGCATG--TCTTAAG-G-GTTCATTCATGTTGTAGCATGGGTC-A-AAA 57

Query:    72 AATTGTTCCATATTTCTACAG--TA-T-TTCCATTATATGTATAACTTTCGTCGTTGTTT 127
               TT TTCC T TTT   C G  TA T TTCCATTATAT TAT A TT CGT  TTG  T
Sbjct:    58 TTTTCTTCCTTTTTTAGGCTGAATAATATTCCATTATATATATGANTTACGTATTTGAGT 117

Query:   128 TAATATTAGAT-AATTG-ACATTTGTGTAAAA-TCT-TAGTAGTTGTTGCTACTG-CTGA 182
              A T T AGAT AATT  A A  TG  TA A  T T T  TA TT TT  TA  G C G 
Sbjct:   118 CA-TGT-AGATGAATTATATACATGAATATATGTATCTCCTATTTATTTTTAAAGGCAGC 175

Query:   183 AATCTTGGATGTGAAAATCTTCAGA 207
             AA  TTG AT T A  AT TT A A
Sbjct:   176 AAA-TTGTAT-TAATGATTTTGATA 198


>cbil|dbest|201715 R31670 yh63a09.s1 3'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=431 Author_cmt: gb:S57283 ENDOTHELIN B RECEPTOR
            PRECURSOR (HUMAN);
            Length = 431

  Minus Strand HSPs:

 Score = 160 (24.0 bits), Expect = 3.2, P = 0.96
 Identities = 84/132 (63%), Positives = 84/132 (63%), Strand = Minus / Plus

Query:   169 CAACTACTAAGATTTTACACAAATGTCA-ATTAT-CTAATATTAAAACAACGACGAAAGT 112
             CA  TA TA  ATTTT  ACA  TGT A ATTA  CT  TAT AAA   A G C A AG 
Sbjct:    89 CAGATA-TATAATTTTTTACAT-TGTTATATTACACTTTTAT-AAAGTTA-G-CTACAGC 143

Query:   111 -TATACATATAATGGAA-ATACTGTAGAAATATGGAACAATTTTTATATAACAATATTAT 54
              TA  CAT T  TG  A A ACTGTA    T TGG  CA  T T A  TA CAATA TA 
Sbjct:   144 ATACCCATGTTTTGCTATAAACTGTATTCCTTTGGNCCATATGTAAGCTATCAATACTAA 203

Query:    53 CAGGTGTTTGAACACA 38
              AGGTGTTTGAACA A
Sbjct:   204 AAGGTGTTTGAACATA 219


>cbil|dbest|851740 AA212447 mw76f12.r1 5' Lib=598[Mus_musculus||Liver|||]
            Length=191 Author_cmt: gb:M14636 GLYCOGEN PHOSPHORYLASE, LIVER FORM
            (HUMAN);
            Length = 191

  Minus Strand HSPs:

 Score = 144 (21.6 bits), Expect = 3.3, P = 0.96
 Identities = 64/101 (63%), Positives = 64/101 (63%), Strand = Minus / Plus

Query:   271 AAGTTTATCAGCTGAAC-AG-AATCATTTAGTATCTTTACAACATTCAAAACATCCAGAC 214
             AAGTT   CAG TGA C A  AAT A   AGTAT    A  ACAT    AACAT  AG C
Sbjct:    49 AAGTTCTCCAG-TGACCGAACAATTAAGGAGTATGCCAAGGACATCTGGAACATGGAGCC 107

Query:   213 ACTGCGTCTGAAGATTTTCACATCCAA-GATTTCAGCAGTAG 173
                G  TCTGAAGATTT C  ATCCAA GA T CAGCA T G
Sbjct:   108 TTCGGATCTGAAGATTTCCCTATCCAACGAGTCCAGCAATGG 149


>cbil|dbest|504716 N97882 1440C3  Lib=114[Plasmodium_falciparum|||||]
            Length=364
            Length = 364

  Plus Strand HSPs:

 Score = 159 (23.9 bits), Expect = 3.4, P = 0.97
 Identities = 89/136 (65%), Positives = 89/136 (65%), Strand = Plus / Plus

Query:    52 TGATAATATTGTTATATA-AAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTAT 110
             TGATAATATTGTTATA A AAAA T  T  AT  T CTA A TAT  C A T TA   AT
Sbjct:    78 TGATAATATTGTTATAAATAAAAGTAATA-ATCCTCCTA-ATTATAACAAATTTAATAAT 135

Query:   111 AACTTTCGTCGTTGTTTTA-ATATTAGA-T--AATTGACATTTGTGTAAAA-TCTTAG-T 164
             AA TTT  T G TG T  A A ATT  A T  AA   ACAT TG   AAAA T T AG T
Sbjct:   136 AA-TTTAATAGATGATACACAAATTGAAGTCGAAAATACATGTGATAAAAAGTATAAGAT 194

Query:   165 AGTTGTTG-CTACTGCTGAAA 184
             A TT TT  CTA TG TGAAA
Sbjct:   195 A-TTATTATCTAATG-TGAAA 213


>cbil|dbest|100695 F02439 HSC0ZC072 3'
            Lib=186[Homo_sapiens|brain|total_brain|||3_months_old] Length=270
            Length = 270

  Minus Strand HSPs:

 Score = 150 (22.5 bits), Expect = 3.7, P = 0.98
 Identities = 88/136 (64%), Positives = 88/136 (64%), Strand = Minus / Plus

Query:   284 TTTGAACTATCAAAAGTTTATCAGCTGAAC-AGAATCATTTAGTATCTTTACAACATTCA 226
             T TG A TAT AAAAGTTTATCAGC  AAC AGA T A TTA T TC T ACA  A TC 
Sbjct:    81 TGTGTAATATGAAAAGTTTATCAGCACAACTAGACTGAATTA-T-TCCTCACATAAATCC 138

Query:   225 AAACATCCAGACACTGCGTCTGAAGATTT-TCACATCCAAGATTTCAGCA-GTAGCAACA 168
                 AT   G  AC G  T TGA   TT  T A AT   AG TT CA CA G A CAA A
Sbjct:   139 TTGGATGT-GTTACAGTTT-TGANCCTTGGTTA-AT---AGCTT-CAACATGCA-CAAAA 190

Query:   167 ACTACTAAGAT-TTTACACA 149
               TAC AAGAT TTTACACA
Sbjct:   191 TATACAAAGATGTTTACACA 210


>cbil|dbest|151582 F12687 HSC3DA061 
            Lib=186[Homo_sapiens|brain|total_brain|||3_months_old] Length=295
            Length = 295

  Plus Strand HSPs:

 Score = 155 (23.3 bits), Expect = 3.7, P = 0.98
 Identities = 73/112 (65%), Positives = 73/112 (65%), Strand = Plus / Plus

Query:    63 TTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTATAACTTTC-G-TC 120
             T ATATAAAAA  GTTCCATATTT TA   TA T C AT  TAT T T AC T C G TC
Sbjct:    87 TCATATAAAAAAGGTTCCATATTTGTAGTATACTGCAATANTATTTTTNACATCCAGCTC 146

Query:   121 GTTGTTTTAATATTAGATAAT--TGACATTTGTGTAAA-ATCTTAGTAGTTGTTG 172
              TT   T A T  T G T  T  TG C TTTGTGTAAA AT TT G   T GTTG
Sbjct:   147 TTTAAGTGA-TCCTCG-TNCTGGTGGC-TTTGTGTAAATATGTTTGCCCTAGTTG 198


>cbil|dbest|873723 AA234196 zr54a01.r1 5'
            Lib=589[Homo_sapiens|mixed_(see_below)|Pooled_human_melanocyte,_fet
            al_heart,_and_pregnant_uterus|||] Length=139
            Length = 139

  Plus Strand HSPs:

 Score = 144 (21.6 bits), Expect = 4.5, P = 0.99
 Identities = 70/108 (64%), Positives = 70/108 (64%), Strand = Plus / Plus

Query:    50 CCTGATAATATTGTTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTA 109
             C TGA  AT TT T A  T AA ATTGT   ATA   CTACAGTATTT C TT T TGT 
Sbjct:     1 CATGAGTAT-TTATGAGTTCAATATTGTCAAATAAGGCTACAGTATTTGCTTTTT-TGTG 58

Query:   110 TAACTTTCGT-CGT-TGTT-TTAATATTAGATAATTG-ACATTTGTGTAAA 156
             T A T T  T C T T  T TT A A TAGAT ATT  ACATTT TG A A
Sbjct:    59 TGAATGTATTGCATATAATGTTCA-AGTAGATGATTTTACATTTATGGACA 108


>cbil|dbest|504402 N97552 0443C3  Lib=114[Plasmodium_falciparum|||||]
            Length=122
            Length = 122

  Plus Strand HSPs:

 Score = 143 (21.5 bits), Expect = 5.7, P = 1.0
 Identities = 63/102 (61%), Positives = 63/102 (61%), Strand = Plus / Plus

Query:    50 CCTGATAATATTGTTATATAAAAATTGTTCCATATTTCTACAGTATTTCCATTATATGTA 109
             CC  ATAA AT   TATATAAAAATT TTC  T T T TA A  AT TC ATTA    TA
Sbjct:    21 CCAAATAACATATATATATAAAAATTATTCT-TCTCTTTATATAATATCAATTAAGCTTA 79

Query:   110 TAACTTTCGTCGTTGTTTTAATATTAG-ATAATTGACATTTGT 151
             T  CTT   T GT  TTT A T TT   ATA TT A  TTT T
Sbjct:    80 TTTCTTCTTTGGTAATTTCACTTTTCTTATATTTTATTTTTTT 122


>cbil|dbest|921682 AA280658 zs96d07.r1 5'
            Lib=595[Homo_sapiens||germinal_center_B_cell|||] Length=415
            Length = 415

  Minus Strand HSPs:

 Score = 158 (23.7 bits), Expect = 6.8, P = 1.0
 Identities = 108/178 (60%), Positives = 108/178 (60%), Strand = Minus / Plus

Query:   262 AGCTGAACAGAATCATTTAGTA-TCTTT-ACAACAT-TCAAAACATCCAGACACTGCGTC 206
             A CTG A A AA C TTTA  A TCTTT A   CA  TCA   CA   AGA AC G GTC
Sbjct:   151 ACCTGTAAACAA-C-TTTATGAGTCTTTGATGGCAGCTCATGCCAGT-AGAGACAGAGTC 207

Query:   205 -TGAAGATTTTCACATCCAAGATTTCAGCAGTAGCAACAA-C-TACTA-A-GATTTTACA 151
              T AA A  T  A A CC AGA TTCAGCAGTAG AA AA C T C A A GA      A
Sbjct:   208 ATAAAAAACTGTATAGCCCAGACTTCAGCAGTAGTAAAAAACCTCCGAGAAGAGAGAGAA 267

Query:   150 CA-AATGTCAATTATCTAA--T-ATTAAAACAACGACGAAAGTTATACATATAATGGAAA 95
              A AAT T  A  AT TAA  T ATTAAAACAAC   GAAA     A A A A T GAAA
Sbjct:   268 AAGAATTTGGACGATTTAACGTTATTAAAACAACTTAGAAAAGAGCAGACAAAGTTGAAA 327

Query:    94 T 94
             T
Sbjct:   328 T 328


>cbil|dbest|442446 N40996 yy80f04.s1 3'
            Lib=390[Homo_sapiens||multiple_sclerosis_lesions|||Age_46]
            Length=161
            Length = 161

  Minus Strand HSPs:

 Score = 137 (20.6 bits), Expect = 8.1, P = 1.0
 Identities = 77/120 (64%), Positives = 77/120 (64%), Strand = Minus / Plus

Query:   171 AACAACTACTAAGATTTTACACAAATGTCAATTATCTAATATTAAAACAACGACGAAAGT 112
             AACA C A TAA ATTT A   AA T T A TT T T ATATTAAA  AA  A    AG 
Sbjct:     1 AACAGC-A-TAAAATTTCATTTAA-TATAAGTTTTATCATATTAAAT-AAT-ATATTAGG 55

Query:   111 TATACAT-ATAA-TGGAAATACTGTAGAAATATGGAACA-ATTTTTATATAACAATATT- 56
             TAT  AT A AA T    ATA   TA A AT T  AAC  ATTTTTATATAA AA ATT 
Sbjct:    56 TATTTATTAAAACTTTTTATATAATATATAT-TAAAACTTATTTTTATATAATAAAATTT 114

Query:    55 ATCA 52
             AT A
Sbjct:   115 ATTA 118


>cbil|dbest|469477 N63726 za24h09.s1 3'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=198
            Length = 198

  Plus Strand HSPs:

 Score = 133 (20.0 bits), Expect = 9.9, P = 1.0
 Identities = 59/85 (69%), Positives = 59/85 (69%), Strand = Plus / Plus

Query:    54 ATAATATTGTTATATAAAAATTG-TTCCATATTTCTACAGTATTTCCATTATATGTATAA 112
             ATA T TTG  ATATAAAAATTG TT  AT TTT TA AG  T T  ATT T TGTA A 
Sbjct:    27 ATATTTTTGAAATATAAAAATTGGTTGTATTTTT-TAAAGC-TATA-ATTCT-TGTAGA- 81

Query:   113 CTTTCGTCGTTGTTTTAATATTAGAT 138
             C TTC T GT GTT  AA ATT GAT
Sbjct:    82 CATTC-T-GTGGTTAAAA-ATTTGAT 104


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      284       283      10. 116 11 N/A 73   0.023 75
                                                  81   0.023 105
   -1      0      284       283      10. 116 11 N/A 73   0.023 75
                                                  81   0.023 105


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  dbEST
    Release date:  unknown
    Posted date:  9:10 AM EST Dec 21, 1997
    Format:  BLAST
  # of letters in database:  500,351,318
  # of sequences in database:  1,352,941
  # of database sequences satisfying E:  28
  No. of states in DFA:  159 (159 KB)
  Total size of DFA:  166 KB (192 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  14.16u 1.06s 15.22t  Elapsed: 00:00:03
  Total cpu time:  14.21u 1.11s 15.32t  Elapsed: 00:00:03
  Start:  Thu Feb  5 21:48:33 1998   End:  Thu Feb  5 21:48:36 1998

Date: 14:51:41 on Sun 17 Dec 117.