blastn_dbest_files/914074_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  914074
        (611 letters)

Database:  dbEST
           1,352,941 sequences; 500,351,318 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|914074 AA273063 SWMFCA1851SK 5' Lib=283[Brugi...  3055  3.4e-132  1
A cbil|dbest|1058395 AA414361 vc66g07.s1 5' Lib=862[Mus_mus...   380  3.4e-11   1
A cbil|dbest|296863 H36168 14690  Lib=71[Arabidop...   218  0.17      1
A cbil|dbest|313513 T45144 8407  Lib=71[Arabidops...   201  0.86      1



>cbil|dbest|914074 AA273063 SWMFCA1851SK 5' Lib=283[Brugia_malayi|||||]
            Length=611
            Length = 611

  Plus Strand HSPs:

 Score = 3055 (458.4 bits), Expect = 3.4e-132, P = 3.4e-132
 Identities = 611/611 (100%), Positives = 611/611 (100%), Strand = Plus / Plus

Query:     1 AATTTTGCTTAGAAAAAAACCTGAAAAAAATGTGGGTTTATGCATGAATTCAAATTTTAC 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 AATTTTGCTTAGAAAAAAACCTGAAAAAAATGTGGGTTTATGCATGAATTCAAATTTTAC 60

Query:    61 TGGCAACAATTATCCGACATACGATGGAAATTTGCGTGCCGTCATGCAATGCAGTATATG 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 TGGCAACAATTATCCGACATACGATGGAAATTTGCGTGCCGTCATGCAATGCAGTATATG 120

Query:   121 TGCTGTGTTGCTATGCAGTGTGCGTTCATTAATTTGAGTTTAAAAAAATCCGCAAAATGT 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 TGCTGTGTTGCTATGCAGTGTGCGTTCATTAATTTGAGTTTAAAAAAATCCGCAAAATGT 180

Query:   181 AGTTCTTGCGTTACACTGCGATGAGCTTGATCGGGAAGAAGACCAATAGTAATGACATAC 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 AGTTCTTGCGTTACACTGCGATGAGCTTGATCGGGAAGAAGACCAATAGTAATGACATAC 240

Query:   241 CAACAACATACAGAGCCGACAGACACACTTCAATTTCATTAATTTCAAAAGCAAACTGCA 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 CAACAACATACAGAGCCGACAGACACACTTCAATTTCATTAATTTCAAAAGCAAACTGCA 300

Query:   301 TGTGGAAATTAAAAGGCTTTAAGAAAATAGTGATGTGAGCGTACTTGGCTGATCTGTTGC 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 TGTGGAAATTAAAAGGCTTTAAGAAAATAGTGATGTGAGCGTACTTGGCTGATCTGTTGC 360

Query:   361 TTAACTATTGTTAGCTAAATGATGTGTGCCCCTGGCAGACATTGTTTTGGCACTAGTTGC 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   361 TTAACTATTGTTAGCTAAATGATGTGTGCCCCTGGCAGACATTGTTTTGGCACTAGTTGC 420

Query:   421 AGTTGATGTTTGGTCAACGGGCTGTATATTTGGCGAAATGATCCGTGGTAGTGTATTGTT 480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   421 AGTTGATGTTTGGTCAACGGGCTGTATATTTGGCGAAATGATCCGTGGTAGTGTATTGTT 480

Query:   481 TCCGGGCAATGATCATATTGACCAATGGACCAAATTGTTGAACAGCTTGGTACTCCTCCC 540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   481 TCCGGGCAATGATCATATTGACCAATGGACCAAATTGTTGAACAGCTTGGTACTCCTCCC 540

Query:   541 TGATGTTCATGCGTCGCTTGCAGTCACTGTCCGAAATTATGTTGAAATCGTCCCATTTCC 600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   541 TGATGTTCATGCGTCGCTTGCAGTCACTGTCCGAAATTATGTTGAAATCGTCCCATTTCC 600

Query:   601 CTGGTTTTCCA 611
             |||||||||||
Sbjct:   601 CTGGTTTTCCA 611


>cbil|dbest|1058395 AA414361 vc66g07.s1 5'
            Lib=862[Mus_musculus|embryo|embryo|||2-cell] Length=402 Author_cmt:
            gb:L35236 Mus musculus (MOUSE);
            Length = 402

  Plus Strand HSPs:

 Score = 380 (57.0 bits), Expect = 3.4e-11, P = 3.4e-11
 Identities = 140/203 (68%), Positives = 140/203 (68%), Strand = Plus / Plus

Query:   412 ACTAGTTGCA-GTTGATGTTTGGTCAACGGGCTGTATATTTGGCGAAATGATCCGTGGTA 470
             AC AG  G A GTTGA  TTTGGTCA   GG TG AT  T GG GAAATGATC   GGT 
Sbjct:     4 ACAAGGAGAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTG 63

Query:   471 GTGTATTGTTTCCGGGCAATGATCATATTGACCAATGGACCAAA-TTGTTGAACAGCTTG 529
             GTGT TTGTT CC GG A  GATCATATTGA CA TGGA  AAA TT TTGAACAGCT G
Sbjct:    64 GTGTTTTGTTCCCAGGTACAGATCATATTGATCAGTGGAATAAAGTTATTGAACAGCTCG 123

Query:   530 GTACTCCTC--CCTGATGTTCATGC-GTCGCTTGCAGTCA-CTGTCCGAAATTATGTTGA 585
             G AC CCT   CCTGA  TTCATG  G   CT  CA  CA C GT  G A TTATGTTGA
Sbjct:   124 GAACACCTTGTCCTGAA-TTCATGAAGAAACTA-CAACCAACAGTAAGGACTTATGTTGA 181

Query:   586 AATC-GTCCCATTTCC-CTGGTTTT 608
             AA C G CC A  T C CTGG T T
Sbjct:   182 AAACAGGCCTAAATACGCTGGATAT 206


>cbil|dbest|296863 H36168 14690  Lib=71[Arabidopsis_thaliana|||||]
            Length=466
            Length = 466

  Plus Strand HSPs:

 Score = 218 (32.7 bits), Expect = 0.19, P = 0.17
 Identities = 134/222 (60%), Positives = 134/222 (60%), Strand = Plus / Plus

Query:   346 TGGCTGA-TCTGTTGCTTAACTAT-TGTTAGCTAAATGATGTGTGCCCCTGGCAGACA-T 402
             TG CTGA T TGTTG TTA C A  TG TA  TA A  A  TG GC  CTG    AC  T
Sbjct:    89 TGACTGAGTATGTTG-TTA-CGAGATGGTA--TAGAGCACCTGAGCTTCTGTTGAACTCT 144

Query:   403 TGTTTTGGCACTAGTTGCAGTTGATGTTTGGTCAACGGGCTGTATATTTGGCGAAATGAT 462
             T    T  CAC AG TGC  TTGATGTTTGGTC    GG TGTAT TTT   GA  T AT
Sbjct:   145 TCAGATTACAC-AGCTGCTATTGATGTTTGGTCTGTTGGTTGTATCTTTATGGAGCTTAT 203

Query:   463 CCGTGGTA-GTGTATTGTTTCCGGGCAATGATCATATTGACCAATGGACCAAATTGTT-G 520
                T G A G  T TTGTT CC GG AA GA CAT TT A CAA  G  C  ATTG   G
Sbjct:   204 GAATAGAAAGCCT-TTGTTCCCNGGTAAAGACCATGTTCATCAAATGCGCTTATTGACAG 262

Query:   521 AACAGCTTGGTACTCCTCCCTGATGTTCATGCGTCGCTTGCAGTCAC 567
             A   GCTTGG AC CC  C   AT T  AT C TCG  T  A TCAC
Sbjct:   263 AGTTGCTTGGCACACCGACAGAATCTG-AT-C-TCGGNTTTACTCAC 306


>cbil|dbest|313513 T45144 8407  Lib=71[Arabidopsis_thaliana|||||]
            Length=495
            Length = 495

  Plus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 1.9, P = 0.86
 Identities = 131/222 (59%), Positives = 131/222 (59%), Strand = Plus / Plus

Query:   346 TGGCTGA-TCTGTTGCTTAACTAT-TGTTAGCTAAATGATGTGTGCCCCTGGCAGACA-T 402
             TG CTGA T TGTTG TTA C A  TG TA  TA A  A  T   C  CTG    AC  T
Sbjct:   128 TGACTGAGTATGTTG-TTA-CGAGATGGTA--TAGAGCACCTNANCTTCTGTTGAACTCT 183

Query:   403 TGTTTTGGCACTAGTTGCAGTTGATGTTTGGTCAACGGGCTGTATATTTGGCGAAATGAT 462
             T    T  CAC AG TGC  TTGATGTTTGG C    GG TGTAT TTT   GA  T AT
Sbjct:   184 TCAGATTACAC-AGCTGCTATTGATGTTTGGNCTGTTGGTTGTATCTTTATGGAGCTTAT 242

Query:   463 CCGTGGTA-GTGTATTGTTTCCGGGCAATGATCATATTGACCAATGGACCAAATTGTT-G 520
                T G A G  T TTGT  CC GG AA GA CAT TT A CAA  G  C  ATTG   G
Sbjct:   243 GAATAGAAAGCCT-TTGTNCCCNGGTAAAGACCATGTTCATCAAATGCNCTTATTGACAG 301

Query:   521 AACAGCTTGGTACTCCTCCCTGATGTTCATGCGTCGCTTGCAGTCAC 567
             A   GCTTGG AC CC  C   AT T  AT C TCG TT  A TCAC
Sbjct:   302 AGTTGCTTGGCACACCGNCAGAATCTG-AT-C-TCGGTTTTACTCAC 345


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      611       611      10. 120 11 N/A 73   0.021 80
                                                  88   0.023 118
   -1      0      611       611      10. 120 11 N/A 73   0.021 80
                                                  88   0.023 118


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  dbEST
    Release date:  unknown
    Posted date:  9:10 AM EST Dec 21, 1997
    Format:  BLAST
  # of letters in database:  500,351,318
  # of sequences in database:  1,352,941
  # of database sequences satisfying E:  4
  No. of states in DFA:  242 (242 KB)
  Total size of DFA:  257 KB (320 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  14.66u 1.02s 15.68t  Elapsed: 00:00:03
  Total cpu time:  14.68u 1.06s 15.74t  Elapsed: 00:00:03
  Start:  Thu Feb  5 19:18:12 1998   End:  Thu Feb  5 19:18:15 1998

Date: 17:9:13 on Mon 18 Dec 117.