blastn_dbest_files/CBrugiaQ_2326_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  CBrugiaQ_2326
        (385 letters)

Database:  dbEST
           1,352,941 sequences; 500,351,318 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|276417 H16479 AS3ISB270SL 5'-end Lib=279[Brug...  1653  1.2e-68   1
A cbil|dbest|364463 H63044 AS3ISB081T3 5'-end Lib=279[Brug...  1645  2.7e-68   1
A cbil|dbest|727226 AA089392 SW3ICA1598SK 5' Lib=282[Brugi...  1637  6.7e-68   1
A cbil|dbest|276421 H16483 AS3ISB278SL 5'-end Lib=279[Brug...  1636  7.0e-68   1
A cbil|dbest|281222 H21284 AS3ISB246SL 5'-end Lib=279[Brug...  1634  9.1e-68   1
A cbil|dbest|364468 H63049 AS3ISB084T3 5'-end Lib=279[Brug...  1612  8.2e-67   1
A cbil|dbest|273953 H14039 AS3ISB381SL 5'-end Lib=279[Brug...  1578  3.0e-65   1
A cbil|dbest|354108 H52886 SW3ICA430SK 5' Lib=282[Brugia_m...  1519  1.6e-62   1
A cbil|dbest|217723 R47658 AS3ISB041SL 5'-end Lib=279[Brug...  1495  1.8e-61   1
A cbil|dbest|276426 H16488 AS3ISB298SL 5'-end Lib=279[Brug...  1473  1.7e-60   1
A cbil|dbest|217669 R47604 AS3ISA027SL 5'-end Lib=279[Brug...  1422  3.9e-58   1
A cbil|dbest|217684 R47619 AS3ISB014SL 5'-end Lib=279[Brug...  1385  1.8e-56   1
A cbil|dbest|217720 R47655 AS3ISB051SL 5'-end Lib=279[Brug...  1242  4.6e-50   1
A cbil|dbest|281249 H21311 AS3ISB244SL 5'-end Lib=279[Brug...  1232  1.3e-49   1
A cbil|dbest|281195 H21257 AS3ISB186SL 5'-end Lib=279[Brug...   553  7.9e-19   1
A cbil|dbest|1381519 AA675933 SWOvL3CAN02D07SK 5' Lib=284[O...   434  1.4e-13   1
A cbil|dbest|1386647 AA680582 SWOvL3CAN03G04SK 5' Lib=284[O...   390  1.2e-11   1
A cbil|dbest|1371975 AA666456 SWOvL3CAN01D11SK 5' Lib=284[O...   333  3.5e-09   1
A cbil|dbest|344561 R95270 SWOvL3CA162SK 5' Lib=284[Onchoc...   334  3.8e-09   1
A cbil|dbest|345336 R95939 SWOvL3CA026SK 5' Lib=284[Onchoc...   275  3.6e-06   1
A cbil|dbest|309242 H48191 SWOvL3CA507SK 5' Lib=284[Onchoc...   261  8.7e-06   1
A cbil|dbest|28784 T09688 0274m3  Lib=9[Plasmodi...   176  0.094     1
A cbil|dbest|1200527 AA550517 1675m3  Lib=9[Plasmo...   193  0.75      1
A cbil|dbest|1279033 C58041 C58041 3' Lib=162[Caenorhabditi...   169  0.78      1
A cbil|dbest|1258753 C51316 C51316 3' Lib=162[Caenorhabditi...   164  0.997     1
A cbil|dbest|1330784 C77045 C77045 3' Lib=1021[Mus_musculus...   179  0.9993    1



>cbil|dbest|276417 H16479 AS3ISB270SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=356
            Length = 356

  Plus Strand HSPs:

 Score = 1653 (248.0 bits), Expect = 1.2e-68, P = 1.2e-68
 Identities = 335/339 (98%), Positives = 335/339 (98%), Strand = Plus / Plus

Query:    39 ATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAA 98
             ATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAA
Sbjct:     5 ATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAA 64

Query:    99 GCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCAT 158
             GCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCAT
Sbjct:    65 GCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCAT 124

Query:   159 CCTTATCCTGCTTTGGG-TCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCA 217
             CCTTATCCTGCTTTGGG TCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCA
Sbjct:   125 CCTTATCCTGCTTTGGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCA 184

Query:   218 CTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACT 277
             CTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACT
Sbjct:   185 CTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACT 244

Query:   278 TGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTT 337
             TGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTT
Sbjct:   245 TGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTT 304

Query:   338 TTCTCATTTTATGCTTATTTTAATTCTGTGTTCAAATAA 376
             TTCTCATTTTATGCTTATTTTAATTCTGTGT  AAA AA
Sbjct:   305 TTCTCATTTTATGCTTATTTTAATTCTGTGTAAAAAAAA 343


>cbil|dbest|364463 H63044 AS3ISB081T3 5'-end Lib=279[Brugia_malayi|||||]
            Length=378
            Length = 378

  Plus Strand HSPs:

 Score = 1645 (246.8 bits), Expect = 2.7e-68, P = 2.7e-68
 Identities = 339/352 (96%), Positives = 339/352 (96%), Strand = Plus / Plus

Query:    25 GATTATCAAGTTNAATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTG 84
             || | | |  |  ||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct:    15 GAGTTTGAGATACAATGATGATATTATCAATATTTACTACTTTATATATCATATTAATTG 74

Query:    85 CACAAGGAGTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATG 144
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct:    75 CACAAGGAGTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTTGGTTATCATCATG 134

Query:   145 CTTCTTGGTATCATCCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTT 204
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct:   135 CTTCTTGGTATCATCCTTATCCTGCTTTTGGTCCAATGCCATATTATCAGCCTCATCCTT 194

Query:   205 ATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAA 264
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   195 ATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAA 254

Query:   265 TTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAA 324
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   255 TTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAA 314

Query:   325 ATCATTTATTTTTTTCTCATTTTATGCTTATTTTAATTCTGTGTTCAAATAA 376
             ||||||||||||||||||||||||||||||||||||||||||||  ||| ||
Sbjct:   315 ATCATTTATTTTTTTCTCATTTTATGCTTATTTTAATTCTGTGTAAAAAAAA 366


>cbil|dbest|727226 AA089392 SW3ICA1598SK 5' Lib=282[Brugia_malayi|||||]
            Length=345
            Length = 345

  Plus Strand HSPs:

 Score = 1637 (245.6 bits), Expect = 6.7e-68, P = 6.7e-68
 Identities = 335/342 (97%), Positives = 335/342 (97%), Strand = Plus / Plus

Query:    33 AGTTNAATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGA 92
             A TT AATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGA
Sbjct:     4 ATTTCAATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGA 63

Query:    93 GTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGG 152
             GTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTT GGTTATCATCATGCTTCTTGG
Sbjct:    64 GTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTTGGTTATCATCATGCTTCTTGG 123

Query:   153 TATCATCCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCT 212
             TATCATCCTTATCCTGCTTT GGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCT
Sbjct:   124 TATCATCCTTATCCTGCTTTTGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCT 183

Query:   213 TATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCT 272
             TATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCT
Sbjct:   184 TATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCT 243

Query:   273 GCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC-GTGAAATCATTT 331
             GCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTC GTGAAATCATTT
Sbjct:   244 GCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCCGTGAAATCATTT 303

Query:   332 ATTTTTTTCTCATTTTATGCTTATTTTAATTCTGT-GTTCAA 372
             ATTTTTTTCTCATTTTATGCTTATTTTAATTCTGT GTT AA
Sbjct:   304 ATTTTTTTCTCATTTTATGCTTATTTTAATTCTGTTGTTAAA 345


>cbil|dbest|276421 H16483 AS3ISB278SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=365
            Length = 365

  Plus Strand HSPs:

 Score = 1636 (245.5 bits), Expect = 7.0e-68, P = 7.0e-68
 Identities = 340/351 (96%), Positives = 340/351 (96%), Strand = Plus / Plus

Query:    27 TTATCAAGTTNAATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCA 86
             TT TC  GTT  ATTATGATATTATCA TATTTACTACTTTATATATCATATTAATTGCA
Sbjct:     3 TTTTCT-GTTGGATTATGATATTATCAGTATTTACTACTTTATATATCATATTAATTGCA 61

Query:    87 CAAGGAGTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGG-TTATCATCATGC 145
             CAAGGAGTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGG TTATCATCATGC
Sbjct:    62 CAAGGAGTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGGTTATCATCATGC 121

Query:   146 TTCTTGGTATCATCCTTATCCTGCTTTGGG-TCCAATGCCATATTATCAGCCTCATCCTT 204
             TTCTTGGTATCATCCTTATCCTGCTTTGGG TCCAATGCCATATTATCAGCCTCATCCTT
Sbjct:   122 TTCTTGGTATCATCCTTATCCTGCTTTGGGGTCCAATGCCATATTATCAGCCTCATCCTT 181

Query:   205 ATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAA 264
             ATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAA
Sbjct:   182 ATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAA 241

Query:   265 TTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAA 324
             TTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAA
Sbjct:   242 TTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAA 301

Query:   325 ATCATTTATTTTTTTCTCATTTTATGCTTATTTTAATTCTGTGTTCAAATAA 376
             ATCATTTATTTTTTTCTCATTTTATGCTTATTT AATTCTGTGT  AAA AA
Sbjct:   302 ATCATTTATTTTTTTCTCATTTTATGCTTATTTCAATTCTGTGTAAAAAAAA 353


>cbil|dbest|281222 H21284 AS3ISB246SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=345
            Length = 345

  Plus Strand HSPs:

 Score = 1634 (245.2 bits), Expect = 9.1e-68, P = 9.1e-68
 Identities = 330/334 (98%), Positives = 330/334 (98%), Strand = Plus / Plus

Query:    43 TGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCAT 102
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 TGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCAT 60

Query:   103 GGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCCTT 162
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 GGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCCTT 120

Query:   163 ATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATG 222
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 ATCCTGCTTGGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATG 180

Query:   223 CTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTT 282
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 CTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTT 240

Query:   283 CATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTTTCTC 342
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 CATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTTTCTC 300

Query:   343 ATTTTATGCTTATTTTAATTCTGTGTTCAAATAA 376
             ||||||||||||||||||||||||||  ||| ||
Sbjct:   301 ATTTTATGCTTATTTTAATTCTGTGTAAAAAAAA 334


>cbil|dbest|364468 H63049 AS3ISB084T3 5'-end Lib=279[Brugia_malayi|||||]
            Length=379
            Length = 379

  Plus Strand HSPs:

 Score = 1612 (241.9 bits), Expect = 8.2e-67, P = 8.2e-67
 Identities = 348/368 (94%), Positives = 348/368 (94%), Strand = Plus / Plus

Query:     9 TATGACCAGAGTTTGAGATTATCAAGTTNAATTATGATATTATCAATATTTACTACTTTA 68
             TATGACCA AGTTTGAGATT TCAA      TTATGATATTATCAATATTTACTACTT A
Sbjct:     8 TATGACCA-AGTTTGAGATT-TCAA------TTATGATATTATCAATATTTACTACTTAA 59

Query:    69 TATATCATATTAATTGCACAAGGAGTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGT 128
             TATATCATATTAATTG ACAAGGAGTTCA GCATGGTGGTA CAACCAGTTGGTTATGGT
Sbjct:    60 TATATCATATTAATTGGACAAGGAGTTCATGCATGGTGGTACCAACCAGTTGGTTATGGT 119

Query:   129 TTGGGTTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTTTGGGTCCAATGCCATAT 188
             TT GGTTATCATCATG TTCTTGGTATCATCCTTATCCTGCTTT GGTCCAATGCCATAT
Sbjct:   120 TTTGGTTATCATCATGATTCTTGGTATCATCCTTATCCTGCTTTTGGTCCAATGCCATAT 179

Query:   189 TATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCA 248
             TATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCA
Sbjct:   180 TATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCA 239

Query:   249 CATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAG 308
             CATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAG
Sbjct:   240 CATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAG 299

Query:   309 AAGTGAAATTCGTGAAATCATTTATTTTTTTCTCATTTTATGCTTATTTTAATTCTGTGT 368
             AAGTGAAATTCGTGAAATCATTTATTTTTTTCTCATTTTATGCTTATTTTAATTCTGT  
Sbjct:   300 AAGTGAAATTCGTGAAATCATTTATTTTTTTCTCATTTTATGCTTATTTTAATTCTGTAA 359

Query:   369 TCAAATAA 376
               AAA AA
Sbjct:   360 AAAAAAAA 367


>cbil|dbest|273953 H14039 AS3ISB381SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=351
            Length = 351

  Plus Strand HSPs:

 Score = 1578 (236.8 bits), Expect = 3.0e-65, P = 3.0e-65
 Identities = 326/338 (96%), Positives = 326/338 (96%), Strand = Plus / Plus

Query:    39 ATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAA 98
             AT A G T T ATCAATATTTA T CTTTATATATCATATTAATTG ACAAGGAGTTCAA
Sbjct:     2 ATGA-GCTTTAATCAATATTTAGTCCTTTATATATCATATTAATTGNACAAGGAGTTCAA 60

Query:    99 GCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCAT 158
             GCATGGTGG ATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCAT
Sbjct:    61 GCATGGTGGCATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCAT 120

Query:   159 CCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCAC 218
             CCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCAC
Sbjct:   121 CCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCAC 180

Query:   219 TATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTT 278
             TATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTT
Sbjct:   181 TATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTT 240

Query:   279 GGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTT 338
             GGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTT
Sbjct:   241 GGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTT 300

Query:   339 TCTCATTTTATGCTTATTTTAATTCTGTGTTCAAATAA 376
             TCTCATTTTATGCTTATTTTAATTCTGTGT  AAA AA
Sbjct:   301 TCTCATTTTATGCTTATTTTAATTCTGTGTAAAAAAAA 338


>cbil|dbest|354108 H52886 SW3ICA430SK 5' Lib=282[Brugia_malayi|||||] Length=316
            Length = 316

  Plus Strand HSPs:

 Score = 1519 (227.9 bits), Expect = 1.6e-62, P = 1.6e-62
 Identities = 311/316 (98%), Positives = 311/316 (98%), Strand = Plus / Plus

Query:    56 ATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCATGGTGGTATCAACC 115
             ATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCATGGTGGTATCAACC
Sbjct:     1 ATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCATGGTGGTATCAACC 60

Query:   116 AGTTGGTTATGGTTTGGG-TTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTTTG- 173
             AGTTGGTTATGGTTTGGG TTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTTTG 
Sbjct:    61 AGTTGGTTATGGTTTGGGGTTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTTTGT 120

Query:   174 GGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCAT 233
             GGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCAT
Sbjct:   121 GGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCAT 180

Query:   234 CACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTGCA 293
             CACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTGCA
Sbjct:   181 CACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTGCA 240

Query:   294 AATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTTTCTCATTTTATGCTT 353
             AATCTTGGTAGGAAGAAGTGAAATTCG GAAATCATTTATTTTTTTCTCAT TTATGCTT
Sbjct:   241 AATCTTGGTAGGAAGAAGTGAAATTCGNGAAATCATTTATTTTTTTCTCATATTATGCTT 300

Query:   354 ATTTTAATTCT-GTGT 368
             ATTTTAATTCT GTGT
Sbjct:   301 ATTTTAATTCTTGTGT 316


>cbil|dbest|217723 R47658 AS3ISB041SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=338
            Length = 338

  Plus Strand HSPs:

 Score = 1495 (224.3 bits), Expect = 1.8e-61, P = 1.8e-61
 Identities = 311/326 (95%), Positives = 311/326 (95%), Strand = Plus / Plus

Query:    52 CAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCATGGTGGTATC 111
             CA T T TACTACTTTAT TATCATATTA TTGCACAAGGAGTTCAAGCATGGTGG ATC
Sbjct:     1 CACTCTATACTACTTTATNTATCATATTANTTGCACAAGGAGTTCAAGCATGGTGGNATC 60

Query:   112 AACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTT 171
             AACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTT
Sbjct:    61 AACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTT 120

Query:   172 TGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTC 231
             TGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTC
Sbjct:   121 TGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTC 180

Query:   232 ATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTG 291
             ATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTG
Sbjct:   181 ATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTG 240

Query:   292 CAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTTTC-TCATTTTATG 350
             CAA TCTTGGTAGGAAGAAGTGAAAT CG GAAATCATTTATTTT TTC TCATTTTATG
Sbjct:   241 CAACTCTTGGTAGGAAGAAGTGAAATCCGCGAAATCATTTATTTTCTTCCTCATTTTATG 300

Query:   351 CTTATTTTAATTCTGTGTTCAAATAA 376
             CTTATTT AATTCTGTGT  AAA AA
Sbjct:   301 CTTATTTAAATTCTGTGTAAAAAAAA 326


>cbil|dbest|276426 H16488 AS3ISB298SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=348
            Length = 348

  Plus Strand HSPs:

 Score = 1473 (221.0 bits), Expect = 1.7e-60, P = 1.7e-60
 Identities = 315/335 (94%), Positives = 315/335 (94%), Strand = Plus / Plus

Query:    43 TGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCAT 102
             T A AT ATCA T    ACTACTTTAT TATCAT TTAATTGCACAAGGAGTTCAAGCAT
Sbjct:     1 TAAAATAATCAGTTCCCACTACTTTATTTATCATGTTAATTGCACAAGGAGTTCAAGCAT 60

Query:   103 GGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCCTT 162
             GGTGGTATCAACCAGTTGGTTATGGTTT GGTTATCATCATGCTTCTTGGTATCATCCTT
Sbjct:    61 GGTGGTATCAACCAGTTGGTTATGGTTTAGGTTATCATCATGCTTCTTGGTATCATCCTT 120

Query:   163 ATCCTGCTTTGGGTCCAATGCC-ATATTATCAGCCTCATCCTTATCATCCTTATCACTAT 221
             ATCCTGCTTTGGGTCCAATGCC ATATTATCAG CTCATCCTTATCATCCTTATCACTAT
Sbjct:   121 ATCCTGCTTTGGGTCCAATGCCCATATTATCAGGCTCATCCTTATCATCCTTATCACTAT 180

Query:   222 GCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGT 281
             GCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGT
Sbjct:   181 GCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGT 240

Query:   282 TCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGT-GAAATCATTTATTTTTTTC 340
             TCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCG  GAAATCA TTATTTT TTC
Sbjct:   241 TCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGCCGAAATCAATTATTTTCTTC 300

Query:   341 TCATTTTATGCTTATTTTAATTCTGTGTTCAAATAA 376
             TCATTTTATGCTTAT TTA TTCTGTGT CAAA AA
Sbjct:   301 TCATTTTATGCTTATCTTACTTCTGTGT-CAAAAAA 335


>cbil|dbest|217669 R47604 AS3ISA027SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=306
            Length = 306

  Plus Strand HSPs:

 Score = 1422 (213.4 bits), Expect = 3.9e-58, P = 3.9e-58
 Identities = 292/299 (97%), Positives = 292/299 (97%), Strand = Plus / Plus

Query:    42 ATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCA 101
             ATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCA
Sbjct:     8 ATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCA 67

Query:   102 TGGTGGTATCAACCAGTTGGTTATGGTTTGGG-TTATCATCATGCTTCTTGGTATCATCC 160
             TGGTGGTATCAACCAG TGGTTATGGTTTGGG TTATCATCATGCTTCTTGGTATCATCC
Sbjct:    68 TGGTGGTATCAACCAGCTGGTTATGGTTTGGGGTTATCATCATGCTTCTTGGTATCATCC 127

Query:   161 TTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTA 220
             TTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTA
Sbjct:   128 TTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTA 187

Query:   221 TGCTGATATTCATCACATGTATTCTGCA-CATAAAGGTGCACAAATTGGTGCTGCACTTG 279
             TGCTGATATTCATCACATGTATTCTG A CATAAAGGTGCACAAATTGGTGCTGCACTTG
Sbjct:   188 TGCTGATATTCATCACATGTATTCTGTAACATAAAGGTGCACAAATTGGTGCTGCACTTG 247

Query:   280 GTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTT 338
             GTTCATTGGCTGCAAATCTTGGTAGGAAGA GTGAAATTCG GAAATCAT TATTTTTT
Sbjct:   248 GTTCATTGGCTGCAAATCTTGGTAGGAAGAGGTGAAATTCGCGAAATCATNTATTTTTT 306


>cbil|dbest|217684 R47619 AS3ISB014SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=318
            Length = 318

  Plus Strand HSPs:

 Score = 1385 (207.8 bits), Expect = 1.8e-56, P = 1.8e-56
 Identities = 293/312 (93%), Positives = 293/312 (93%), Strand = Plus / Plus

Query:    35 TTNAATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGT 94
             TT  ATTATGAT T  TCAATATT ACTACTTTATAT TCATAT AATTGCACAAGGAGT
Sbjct:     6 TTCCATTATGATCTC-TCAATATTAACTACTTTATATGTCATATCAATTGCACAAGGAGT 64

Query:    95 TCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTA 154
             TCAAGCATGGTGGTATCAACCAG TGGTTATGGTTTGGGTTATCATCATGCTTCT GGTA
Sbjct:    65 TCAAGCATGGTGGTATCAACCAGCTGGTTATGGTTTGGGTTATCATCATGCTTCTCGGTA 124

Query:   155 TCATCCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTA 214
             TCATCCTTATCCTGCTT GGG CCAATGCCATATTATCAGCCTCATCCTTATCATCCTTA
Sbjct:   125 TCATCCTTATCCTGCTTGGGGCCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTA 184

Query:   215 TCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGC 274
             TCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGC
Sbjct:   185 TCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGC 244

Query:   275 ACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATT 334
             ACTTGG TCATTGG TGCAAATCTTGGTAGGAAGAAGTGAAATTCG GAA TCATTTAT 
Sbjct:   245 ACTTGGCTCATTGGTTGCAAATCTTGGTAGGAAGAAGTGAAATTCGCGAACTCATTTATC 304

Query:   335 TTTTTCTCATTT 346
             TT  TCTCATTT
Sbjct:   305 TTCCTCTCATTT 316


>cbil|dbest|217720 R47655 AS3ISB051SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=351
            Length = 351

  Plus Strand HSPs:

 Score = 1242 (186.4 bits), Expect = 4.6e-50, P = 4.6e-50
 Identities = 282/321 (87%), Positives = 282/321 (87%), Strand = Plus / Plus

Query:    52 CAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCATGGTGGTATC 111
             CAA A  TA T  TT ATATATCATAT A    C CAA GAG TCAAG ATGGTGGTATC
Sbjct:    30 CAAAAAATATTTTTTNATATATCATATNAGCCNCCCAAAGAGNTCAAGNATGGTGGTATC 89

Query:   112 AACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTT 171
             AACCAGTTGGTTATGGTTTGGG TATCATCATGCTTCTTGGTATCATCCTTATCCTGCTT
Sbjct:    90 AACCAGTTGGTTATGGTTTGGGCTATCATCATGCTTCTTGGTATCATCCTTATCCTGCTT 149

Query:   172 TGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTC 231
             T GGTCCAATGCCATATTATCAGCCTCATCC TATCATCCTTATCACTATGCTGAT TTC
Sbjct:   150 TTGGTCCAATGCCATATTATCAGCCTCATCCCTATCATCCTTATCACTATGCTGATTTTC 209

Query:   232 ATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGC-TGCACTTGGTTCATTGGCT 290
             ATCACATGTATTCTGCACATAA GGTGCACAAAT GGTGC TGCACTTGG TCATTGGCT
Sbjct:   210 ATCACATGTATTCTGCACATAACGGTGCACAAATCGGTGCCTGCACTTGGCTCATTGGCT 269

Query:   291 GCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATCATTTATTTTTTT--CTCATTTTA 348
             G AA TCTTGGTAGGAAGAAGTGAAATTCGTGAAATCA T ATT TT    CTCAT  T 
Sbjct:   270 GTAACTCTTGGTAGGAAGAAGTGAAATTCGTGAAATCACTCATTCTTCCACCTCATCCTC 329

Query:   349 TGCTTATTTTAAT-TCTGTGT 368
             TGCTTATTTT AT TCTG GT
Sbjct:   330 TGCTTATTTTNATCTCTGCGT 350


>cbil|dbest|281249 H21311 AS3ISB244SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=348
            Length = 348

  Plus Strand HSPs:

 Score = 1232 (184.8 bits), Expect = 1.3e-49, P = 1.3e-49
 Identities = 296/345 (85%), Positives = 296/345 (85%), Strand = Plus / Plus

Query:    48 TTATCAATATT-TACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGCATGGTG 106
             T ATCAATATT TACTACTTTATATATCA ATTAAT GCACAAGGAGTTCAAGCATGG G
Sbjct:     1 TCATCAATATTCTACTACTTTATATATCACATTAATCGCACAAGGAGTTCAAGCATGGCG 60

Query:   107 GTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGTATCATCCTTATCC 166
             GTATCAACCAGTTGGTTATGGTT GGGTTATCATCATG TTCTTGGTATCA CCT ATCC
Sbjct:    61 GTATCAACCAGTTGGTTATGGTTCGGGTTATCATCATGATTCTTGGTATCACCCTAATCC 120

Query:   167 TGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGA 226
             TGCTTTGGGTCCAATGCCATATTAT AG CTCATCCTTATCATCC  ATCACTATGCTGA
Sbjct:   121 TGCTTTGGGTCCAATGCCATATTATTAGTCTCATCCTTATCATCCCCATCACTATGCTGA 180

Query:   227 TATTCATCACATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATT 286
             TAT CATCACATGT TTCTG ACATAAAGGTGCACAA TTGG G TGCACTTGG TCATT
Sbjct:   181 TATCCATCACATGTCTTCTGAACATAAAGGTGCACAATTTGGAGTTGCACTTGGCTCATT 240

Query:   287 GGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGAAATC-ATT-TATTTTTTTC-TCA 343
             GG TG AAATCTTGGT GGAAGAAGTGAAATTCGTGA ATC AT  TATTT T  C T A
Sbjct:   241 GGTTGNAAATCTTGGTCGGAAGAAGTGAAATTCGTGACATCCATCCTATTTCTCCCCTTA 300

Query:   344 TTT-TATGCTT-ATTTTAAT-TCTGTGTT-CAAATA-ACCCCCCC 383
             T   T TGCTT ATT  A T TCT TGT  C  A A A CCCCCC
Sbjct:   301 TACATTTGCTTTATTCCACTCTCTTTGTGGCTCAAATAACCCCCC 345


>cbil|dbest|281195 H21257 AS3ISB186SL 5'-end Lib=279[Brugia_malayi|||||]
            Length=267
            Length = 267

  Plus Strand HSPs:

 Score = 553 (83.0 bits), Expect = 7.9e-19, P = 7.9e-19
 Identities = 167/214 (78%), Positives = 167/214 (78%), Strand = Plus / Plus

Query:    36 TNAATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTT 95
             T AA TATGATAT  TCAATATTTA TACTTTATATATCATATTA TTG ACAAGGAGT 
Sbjct:     5 TCAAATATGATATGCTCAATATTTATTACTTTATATATCATATTAGTTGNACAAGGAGTC 64

Query:    96 CAAGCATGGT-GGT-ATCAACCAGTTGGTT-ATGGT-TTGGGT-TATCATCATG-CTTCT 149
             CA G ATGGT GGT ATCA CCAG  GG   ATGGT TTGGGT TATCA CATG CTTCT
Sbjct:    65 CACGTATGGTTGGTTATCACCCAGCAGGCCCATGGTCTTGGGTCTATCACCATGACTTCT 124

Query:   150 TGGTATCATCC-TTATCCTG-CTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATC 207
             TGGTATCA CC TTATC TG CTT GGGTCCA TG CAT TTATCAGCCTCA  C T T 
Sbjct:   125 TGGTATCACCCCTTATCATGNCTTGGGGTCCACTGTCATTTTATCAGCCTCACACCT-T- 182

Query:   208 ATCCTTATCACTATGCTGATATTCATCACATGTATTCTG 246
             ATC   ATC CTAT    AT  T AT A AT T  T TG
Sbjct:   183 ATC---ATCCCTATCAATATGCTGATAATATATCATATG 218

 Score = 512 (76.8 bits), Expect = 5.6e-17, P = 5.6e-17
 Identities = 154/195 (78%), Positives = 154/195 (78%), Strand = Plus / Plus

Query:   103 GGTGGT-ATCAACCAGTTGGTT-ATGGT-TTGGGT-TATCATCATG-CTTCTTGGTATCA 157
             G TGGT ATCA CCAG  GG   ATGGT TTGGGT TATCA CATG CTTCTTGGTATCA
Sbjct:    73 GTTGGTTATCACCCAGCAGGCCCATGGTCTTGGGTCTATCACCATGACTTCTTGGTATCA 132

Query:   158 TCC-TTATCCTG-CTTTGGGTCCAATGCCATATTATCAGCCTCAT-CCTTATCATCCTTA 214
              CC TTATC TG CTT GGGTCCA TG CAT TTATCAGCCTCA  CCTTATCATCC TA
Sbjct:   133 CCCCTTATCATGNCTTGGGGTCCACTGTCATTTTATCAGCCTCACACCTTATCATCCCTA 192

Query:   215 TCACTATGCTGATATTC-ATCACATGTATTCT-GCACATAAAGGTGCACAA-ATT--GGT 269
             TCA TATGCTGATA T  ATCA ATGT TTCT G ACA AAAGG G ACAA ATT  GGT
Sbjct:   193 TCAATATGCTGATAATATATCATATGT-TTCTTGGACAAAAAGGCGTACAATATTCAGGT 251

Query:   270 GCT-GCACTTGGTTCA 284
             G T GCACT GG  CA
Sbjct:   252 GTTTGCACTCGGCCCA 267


>cbil|dbest|1381519 AA675933 SWOvL3CAN02D07SK 5'
            Lib=284[Onchocerca_volvulus|||||] Length=363
            Length = 363

  Plus Strand HSPs:

 Score = 434 (65.1 bits), Expect = 1.4e-13, P = 1.4e-13
 Identities = 212/316 (67%), Positives = 212/316 (67%), Strand = Plus / Plus

Query:    51 TCAATATTTACTACTTTATATATCATATTAATTGCACAAGG-AGTTCAAGCATGGTGGTA 109
             TCAA A TTA T  TTTAT  AT  TATT ATT CACAAGG AGTTCAAG ATGGTGGTA
Sbjct:     1 TCAACACTTA-T--TTTATGCATGGTATTGATTACACAAGGTAGTTCAAGGATGGTGGTA 57

Query:   110 TCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGT-ATCATCCTTATCCTG 168
             TC   C G  GGTTA GGTT  GGTT T AT  T  TTC T  T AT AT   TA C T 
Sbjct:    58 TC---CGGGCGGTTACGGTTATGGTTTTTATGGTT-TTCATCCTCATGATTGGTACCATC 113

Query:   169 CTTTGGGTCCAATGCCATATTATCAGCCTCATCC-TT--ATCATCCTTATCACTATGC-T 224
             CT   G  CC  T C  TAT ATC GC T A CC TT  ATCATCC   T A TAT C T
Sbjct:   114 CT---GAACCGTT-C--TATCATCCGCATGAACCGTTCTATCATCCGCCTTA-TATTCAT 166

Query:   225 GATATTCATCACATGTATTC-TGCACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTC 283
              AT TT   CA   G   T  TGCAC TAA GGTGCACAAAT GGTGCTGCA TTGGTT 
Sbjct:   167 CATTTTGG-CAGTGGGCGTAATGCACGTAAGGGTGCACAAATCGGTGCTGCAATTGGTTT 225

Query:   284 ATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAA---TTCGTGAA-ATCATTTATTTTTTT 339
              TTGGCTG AA T TTGGTA  AAGAA TGAAA   TT  T    AT A  T   TT  T
Sbjct:   226 GTTGGCTGGAACTTTTGGTAAAAAGAAATGAAAGAATTATTTCGCATGAAATCAATTACT 285

Query:   340 C-TCATTTTATGCTTATTTTAATTCTGT 366
             C TCA TT AT    A TTT ATT TGT
Sbjct:   286 CGTCAATTAATATAAAATTTTATTTTGT 313


>cbil|dbest|1386647 AA680582 SWOvL3CAN03G04SK 5'
            Lib=284[Onchocerca_volvulus|||||] Length=396
            Length = 396

  Plus Strand HSPs:

 Score = 390 (58.5 bits), Expect = 1.2e-11, P = 1.2e-11
 Identities = 222/342 (64%), Positives = 222/342 (64%), Strand = Plus / Plus

Query:    35 TTNAATTATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGA-G 93
             TT A  TATGATAT AT A  A TTA T  TTTAT  AT  TATT ATTGCACAAGGA G
Sbjct:     6 TTCAGCTATGATATCATTAGCACTTA-T--TTTATGCATACTATTGATTGCACAAGGAAG 62

Query:    94 TTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTTGGT 153
             TTCAAG ATGGT GTATC  C  G  GGTTA   TT  GGTTAT ATC T  T CTT GT
Sbjct:    63 TTCAAGGATGGTCGTATC--CGGGC-GGTTACAATTATGGTTATTATCCTCATCCTTCGT 119

Query:   154 ATCATCCTT-ATCCTGCTTTGGGTCCAATGCCATA-TTAT-CAGCCTCA-TC--CTTAT- 206
             ATCATC T  ATC T CT T   TC    GCC TA TTAT CA   TCA TC  CTTAT 
Sbjct:   120 ATCATCGTGGATCGTACTATCA-TCATCCGCC-TACTTATTCATA-TCAATCGCCTTATA 176

Query:   207 -C-ATCCTTATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAAA 264
              C AT  TTAT  CTATGC G T  T   CAC T  A   T CACA A  GGTG    AA
Sbjct:   177 ACCATAATTATGGCTATGCGGGTGGTG--CACGTACAGG-TACACAAATCGGTGGTGGAA 233

Query:   265 TTGGTGC-TGCACTTG-GTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAAT--TCG 320
              TGGT C T   CT G G T AT GGCTG A  T TTGGTA  AAGAA TGAAA   TC 
Sbjct:   234 CTGGTTCCTTGGCTGGAGGT-AT-GGCTGGAGGTATTGGTAAAAAGAAATGAAAGAATCA 291

Query:   321 TGAA--ATC-ATTTATTTTTTTCTCATTTTATGCTTATTTTAATTCTGTGTTCAAA 373
             T     AT  A T A TT  T  TCA TT AT    A TTTAAT  TGT  T AAA
Sbjct:   292 TTTTGCATGGAATCAATTACTCATCAGTTCATATACAATTTAATCTTGTTATGAAA 347


>cbil|dbest|1371975 AA666456 SWOvL3CAN01D11SK 5'
            Lib=284[Onchocerca_volvulus|||||] Length=518
            Length = 518

  Plus Strand HSPs:

 Score = 333 (50.0 bits), Expect = 3.5e-09, P = 3.5e-09
 Identities = 155/241 (64%), Positives = 155/241 (64%), Strand = Plus / Plus

Query:    41 TATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGC 100
             TATGATAT AT A  A TTA T  TTTAT  AT  TATT ATTGCACAAGGAGTTCAAG 
Sbjct:     1 TATGATATCATTAGCACTTA-T--TTTATGCATACTATTGATTGCACAAGGAGTTCAAGG 57

Query:   101 ATGGTGGTATCAAC-CAGTTGG--TTATGGTTTGGGTTATCATCATGCTTCTTGGT-ATC 156
             ATGGT GTATC    C GTT    TTATGGTT    T  TCATCA G  TC T  T AT 
Sbjct:    58 ATGGTCGTATCCGGGCGGTTACAATTATGGTTATTATCCTCATCA-GTATCCTCATCATT 116

Query:   157 ATCCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATC 216
             ATCCT ATCCT C T    TC      C TA TATCA C TC  CCT  T AT C TATC
Sbjct:   117 ATCCTCATCCTTCGTATCATCGTGGATCGTACTATCATCATCCGCCTACTTATTCATATC 176

Query:   217 ACTATGCTGATATTCATCAC-ATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCA 275
             A T   CT ATA  CAT A  ATG  T  TGC   T   GGTGCAC  A  GGTGC   A
Sbjct:   177 AATCGCCTTATAACCATAATTATGGCTA-TGCGGGT---GGTGCACGTACAGGTGCACAA 232

Query:   276 CTTGGT 281
              T GGT
Sbjct:   233 ATCGGT 238

 Score = 291 (43.7 bits), Expect = 2.8e-07, P = 2.8e-07
 Identities = 205/335 (61%), Positives = 205/335 (61%), Strand = Plus / Plus

Query:    39 ATTATGAT-ATTATCAAT-ATTTACTACTTTATAT--ATCATATTAATTGCACAAGGA-G 93
             AT AT AT ATTA CA T ATTT  T C T  TAT  AT   A  A   G  CAAGGA G
Sbjct:     2 ATGAT-ATCATTAGCACTTATTTTATGCATACTATTGATTGCACAAGGAGTTCAAGGATG 60

Query:    94 TTCA-AGCATGGTGGTATCAACCA-GTTGGTTATGGTT-TGGGTTATCATCATGCTTCTT 150
              TC  A C  GG GGT  CAA  A G T  TTAT  T  T  GT ATC TCAT  TT T 
Sbjct:    61 GTCGTATCCGGGCGGTTACAATTATGGTTATTATCCTCATCAGT-ATCCTCATCATTATC 119

Query:   151 GGTATCATCCTTATCCTGCTTTGGGTCCAATGCCAT-ATTATCAGCCT-C--ATCCTTAT 206
                ATC T C TATC T C T GG TC  A  C AT AT ATC GCCT C  AT C TAT
Sbjct:   120 CTCATCCTTCGTATCAT-CGT-GGATCGTA--CTATCATCATCCGCCTACTTATTCATAT 175

Query:   207 CA-TC--CTTATCACTATGCTGATATTCATCACATGTATTCTGCACATAAAGGTGCACAA 263
             CA TC  CTTAT AC AT  T AT    AT  C  GT  T  GCAC TA AGGTGCACAA
Sbjct:   176 CAATCGCCTTATAACCATAATTATGGCTATG-CGGGTGGT--GCACGTACAGGTGCACAA 232

Query:   264 ATTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAAGAAGTGAAATTCGTGA 323
             AT GGTG TG A  TGGTTC TTGGCTG A  T T G T GGA G A TG  A      A
Sbjct:   233 ATCGGTGGTGGAACTGGTTCCTTGGCTGGAGGTATGGCT-GGAGGTATTGGTAAAAAN-A 290

Query:   324 AATCATTTATTTTTTTCTCATTTTATGC-TTATTTTAATTCTGTGTT 369
             AAT A   A T  TTT  CAT   AT   TTA T  AATTCT  GTT
Sbjct:   291 AATGAAAGAATCATTTTGCATGAAATCAATTACTC-AATTCTCGGTT 336


>cbil|dbest|344561 R95270 SWOvL3CA162SK 5' Lib=284[Onchocerca_volvulus|||||]
            Length=427
            Length = 427

  Plus Strand HSPs:

 Score = 334 (50.1 bits), Expect = 3.8e-09, P = 3.8e-09
 Identities = 170/270 (62%), Positives = 170/270 (62%), Strand = Plus / Plus

Query:    41 TATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGC 100
             TATGATAT AT A  A TTA T  TTTAT  AT  TATT ATTGCACAAGGAGTTCAAG 
Sbjct:    32 TATGATATCATTAGCACTTA-T--TTTATGCATACTATTGATTGCACAAGGAGTTCAAGG 88

Query:   101 ATGGTGGTATCAAC-CAGTTGG--TTATGGTTTGGGTTATCATCATGCTTCTTGGT-ATC 156
             ATGGT GTATC    C GTT    TTATGGTT    T  TCATCA G  TC T  T AT 
Sbjct:    89 ATGGTCGTATCCGGGCGGTTACAATTATGGTTATTATCCTCATCA-GTATCCTCATCATT 147

Query:   157 ATCCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGCCTCATCCTTATCATCCTTATC 216
             ATCCT ATCCT C T    TC      C TA TATCA C TC  CCT  T AT C TATC
Sbjct:   148 ATCCTCATCCTTCGTATCATCGTGGATCGTACTATCATCATCCGCCTACTTATTCATATC 207

Query:   217 ACTATGCTGATATTCATCAC-ATGTATTCTGCACATAAAGGTGCACAAATTGGTGCTGCA 275
             A T   CT ATA  CAT A  ATG  T  TGC   T   GGTGCAC  A  GGTGC  CA
Sbjct:   208 AATCGCCTTATAACCATAATTATGGCTA-TGCGGGT---GGTGCACGTACAGGTGCA-CA 262

Query:   276 CTTGGTTCATTGG-CTGCAAATCTTGGTAGGAAGAA 310
               T G T  T G  CTG     CTTGG  GGA G A
Sbjct:   263 NATCGGTGGTGGAACTGGNTC-CTTGGCTGGAGGTA 297


>cbil|dbest|345336 R95939 SWOvL3CA026SK 5' Lib=284[Onchocerca_volvulus|||||]
            Length=212
            Length = 212

  Plus Strand HSPs:

 Score = 275 (41.3 bits), Expect = 3.6e-06, P = 3.6e-06
 Identities = 137/203 (67%), Positives = 137/203 (67%), Strand = Plus / Plus

Query:    33 AGTTNAATTATGATATTATCAATATTTACTACTTTATAT--ATCATATTAATTGCACAAG 90
             A TT A  T TGATA  ATCA TA   ACT  TTTATAT  AT  TATT ATTGCACAAG
Sbjct:     7 ATTTAAGCTGTGATA--ATCATTAGC-ACTTATTTATATGCATACTATTGATTGCACAAG 63

Query:    91 GAGTTCAAGCATGGTGGTATCAACCAGTTGGTTATGGTTTGGGTTATCATCATGCTTCTT 150
             GAGTTCAAG ATGGT GTATC  C  G  GGTTA   TT  GGTTAT ATC T C TC T
Sbjct:    64 GAGTTCAAGGATGGTCGTATC--CGGGC-GGTTACAATTATGGTTATTATCCT-CATCAT 119

Query:   151 GGTA-TCATCCTT-ATCCTGCTTTG-GGTCCAATGCCATATTATCAGCC-TCATCCTTAT 206
               T  TCATCCTT AT  T C T G GG CC   GC  TAT ATCA CC TC T CTTAT
Sbjct:   120 TATCCTCATCCTTCATA-T-CATCGTGGACC---GCACTATCATCATCCGTC-TACTTAT 173

Query:   207 -CATCCTTATCACTATGCTGATATTCATCA 235
              CAT    ATC   AT  T AT  T AT A
Sbjct:   174 TCATATCAATCCGAATTATAATTATAATTA 203


>cbil|dbest|309242 H48191 SWOvL3CA507SK 5' Lib=284[Onchocerca_volvulus|||||]
            Length=374
            Length = 374

  Plus Strand HSPs:

 Score = 261 (39.2 bits), Expect = 8.7e-06, P = 8.7e-06
 Identities = 123/194 (63%), Positives = 123/194 (63%), Strand = Plus / Plus

Query:    41 TATGATATTATCAATATTTACTACTTTATATATCATATTAATTGCACAAGGAGTTCAAGC 100
             TATGATAT AT A  A TTA T  TTTAT  AT  TATT ATTGCACAAGGAGTTCAAG 
Sbjct:     1 TATGATATCATTAGCACTTA-T--TTTATGCATACTATTGATTGCACAAGGAGTTCAAGG 57

Query:   101 ATGGTGGTATCAAC-CAGT-TGG--TTATGGTTTGGGTTATCATCATGCTTCTTGGT-AT 155
             ATGGT G ATC    C G  T    TTATGGTT    T  TCATCA GC TC T  T A 
Sbjct:    58 ATGGTCGCATCCGGGCGGAATACAATTATGGTTATTATCCTCATCA-GCCTCCTCATCAN 116

Query:   156 CATCCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGC-CTCATCCTTATCATCCTTA 214
             C TCC  A CCT C T     C     CC T  TATCA C C C TC T  T AT C TA
Sbjct:   117 CNTCCNCACCCTTCGTATCANCGCGGACCGTNCTATCACCACCCGTC-TNCTNATTCATA 175

Query:   215 TCACTATGCTGATATTCAT 233
             TCACT   CT  TA  CAT
Sbjct:   176 TCACTCGTCTCNTAACCAT 194


>cbil|dbest|28784 T09688 0274m3  Lib=9[Plasmodium_falciparum|||||]
            Length=267
            Length = 267

  Plus Strand HSPs:

 Score = 176 (26.4 bits), Expect = 0.099, P = 0.094
 Identities = 114/191 (59%), Positives = 114/191 (59%), Strand = Plus / Plus

Query:   187 ATTATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCATCACATGTATTCTG 246
             AT A CA   TCAT  TTAT AT  T ATCACTATGCT AT T  AT A AT T TTC  
Sbjct:     9 ATCACCATGTTCATNNTTATTATTATCATCACTATGCTCATTTNTATTA-ATATCTTCAC 67

Query:   247 CACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGC--TGCAAATCTTGGTAG 304
             CA  T  A  T  A  AAT   T  T CACT  G TCATT     TGC A  CTT  T  
Sbjct:    68 CATGTTCATTTTTAATAATA--TCAT-CACTATGCTCATTTTTATTGCCATNCTTC-T-- 121

Query:   305 GAAGAAGTGAAATTCGTGAAATCATTTATTTTTTTCTCATT-TTATGCTTATTTTAATTC 363
             GA     T   ATT  TG  AT  T     TT TTCT ATT TT T  TTATTTT  TTC
Sbjct:   122 GATTCT-TCTTATTGTTGTTATTCTNCTNATTCTTCTTATTGTTGTTATTATTTTCCTTC 180

Query:   364 TGTGT-TCAA-ATAAC 377
             TGTGT TCA  ATAAC
Sbjct:   181 TGTGTGTCATCATAAC 196

 Score = 153 (23.0 bits), Expect = 1.6, P = 0.81
 Identities = 71/111 (63%), Positives = 71/111 (63%), Strand = Plus / Plus

Query:   136 ATCATCATGCTTCTTGGTATCATCCTTATCCTGCTTTGGGTCCAATGCCATATTATCAGC 195
             AT  TCAT  TT TT  TATCATC  TAT CT  TTT   T  AAT  C T T A CA  
Sbjct:    15 ATGTTCATNNTTATTATTATCATCACTATGCTCATTTNTATT-AATATC-T-TCACCATG 71

Query:   196 CTCATCCTTA-TCATCCTTATCACTATGCTGATATTCATCAC-ATGTATTCTG 246
              TCAT  TTA T AT  T ATCACTATGCT AT TT AT  C AT   TTCTG
Sbjct:    72 TTCATTTTTAATAATA-TCATCACTATGCTCATTTTTATTGCCATNC-TTCTG 122


>cbil|dbest|1200527 AA550517 1675m3  Lib=9[Plasmodium_falciparum|||||]
            Length=652
            Length = 652

  Plus Strand HSPs:

 Score = 193 (29.0 bits), Expect = 1.4, P = 0.75
 Identities = 205/341 (60%), Positives = 205/341 (60%), Strand = Plus / Plus

Query:    23 GAGATTATCAAGTTNAATTATGATATTATCAATATTTACTACTTTATATATCATATTAAT 82
             GAGATTATCAAG   AATT TG  ATTATCA T TT A TA T TATAT T  T  TA T
Sbjct:   267 GAGATTATCAAGAGGAATTTTGTCATTATCA-TCTTGA-TAATATATAT-TGTTTGTACT 323

Query:    83 TG-CACAAGG-A-GTTCAAGCATGG-TGGTATCAAC--CAGTTGGTTATGGTTTGGGT-T 135
             T  CA A    A GTT  A CAT   T  TAT AA   CA    G   TG T  GGGT T
Sbjct:   324 TATCATATTATATGTTTCATCATTAATTTTATGAATATCATCAAGAGTTGATGGGGGTGT 383

Query:   136 ATCATCATGCT-TCTTGGT-ATCATCCTTA-TCC-TGCTTTGGGTCCAATGCCATATTAT 191
             AT  TCA   T T TT  T AT ATCC TA TCC T CTT    TC AAT   AT TTA 
Sbjct:   384 ATATTCAATATATTTTCATTATGATCCATAGTCCATTCTTCAT-TC-AATTT-AT-TTAA 439

Query:   192 CAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCATCAC-ATGTAT-TCTGCAC 249
             CA   T  TC TTAT  T C  A  ACT T C  A AT  ATC C ATGT T TCT   C
Sbjct:   440 CATA-TGTTCGTTATGGTTC--A--ACTTTTCACACAT--ATCTCTATGTCTGTCTATCC 492

Query:   250 ATAAAGGTGCACAAATTG-GT-GCTGCACT-T-GGTTCATTGGCTGCAAATCTTGGTAGG 305
             AT  A G   A A ATT  GT G T CA T T GG TCA T   TG    T TTGG A  
Sbjct:   493 ATTTATGAA-ATAGATTTAGTTGGTTCATTATAGGATCACTATGTGATTGT-TTGGCAA- 549

Query:   306 AAGAAGTGAAATTCGTGAAATCA-T-TTATTTTTTTCTCATTTTATGCTTA-TTTTAA 360
             AA  A T AAA TCGT    T A T TTATTT TT C  AT  T  G TT  TTTTAA
Sbjct:   550 AACTATTAAAAGTCGTATTTTTAGTATTATTTGTTCCATATAATTCGTTTTCTTTTAA 607


>cbil|dbest|1279033 C58041 C58041 3' Lib=162[Caenorhabditis_elegans|||||]
            Length=300
            Length = 300

  Plus Strand HSPs:

 Score = 169 (25.4 bits), Expect = 1.5, P = 0.78
 Identities = 145/237 (61%), Positives = 145/237 (61%), Strand = Plus / Plus

Query:   133 GTTATCATCATGCTTCTTGGTA-TCATCCTTATCCT-G-CTTTGGGTCCAATG-CCATAT 188
             GTTA C TC T CTT TT GT  TC T CTTATC T G CTTT   T CA  G CC T T
Sbjct:    24 GTTA-C-TCCTTCTT-TTCGTCGTCCTTCTTATCGTCGTCTTTCTTTTCATCGTCCTTTT 80

Query:   189 TATCAGCCTCATCCTTATCATCCTTATCACTATGCTGATATTCATCA-CATGTATTCTGC 247
             TATCA C TC T CTTATCATCCTT T A   T CT  T TT  TC  C T T TTCT  
Sbjct:    81 TATCATCTTCCTTCTTATCATCCTTTTTATCGTCCTCTTTTTTGTCGTCCTCT-TTCTTA 139

Query:   248 ACATAAAGGTGCACAAATTGGTGCTGCACTTGGTTCATTGGCTGCAAATCTTGGTAGGAA 307
              C T     T C     T G T  TG ACTT  T  A T   TG A  T TTG T G A 
Sbjct:   140 TCCTCGTCCTTCTTCTCTCGCT--TGGACTTTTTGGACTTTTTGGA--T-TTGCTTG-AC 193

Query:   308 GAAGTGAAATTCGTGAAATCATTTATTT-TTTTC-TCATTTTA-T-G-CTTA-TTTTAAT 361
                 TG A TTC TG A T  TTT TTT TTTTC TC TTTT  T G CTT  TTTT AT
Sbjct:   194 TTCTTGGATTTCTTGGACT--TTTCTTTCTTTTCATCTTTTTTCTCGTCTTTCTTTTCAT 251

Query:   362 TCTGTGTT 369
              CT T TT
Sbjct:   252 CCT-TCTT 258


>cbil|dbest|1258753 C51316 C51316 3' Lib=162[Caenorhabditis_elegans|||||]
            Length=300
            Length = 300

  Minus Strand HSPs:

 Score = 164 (24.6 bits), Expect = 5.9, P = 1.0
 Identities = 142/242 (58%), Positives = 142/242 (58%), Strand = Minus / Plus

Query:   370 GAACACAGAATTAAAATAAGCATAAAATGAGAAAAAAA-T-AAATGATTTCACGA-ATTT 314
             GAA A AG   T AAATA GC  A AATGAGAAAAAAA T AAATG T    CGA ATTT
Sbjct:    10 GAAAA-AGTCATGAAATATGCCAACAATGAGAAAAAAAATCAAATGGTAAT-CGACATTT 67

Query:   313 CACTTCTTCCTACCAAGATTTGCAGCCAATGA-ACCAAGTGCAGCACCAATTTGTGCACC 255
              A T CT    A  AAGA         AAT A AC  A TGC   A CAAT T T  A  
Sbjct:    68 AAATGCTAATAAATAAGACACTTTTA-AATTACACTTATTGCTTAAACAATGTATAAAAA 126

Query:   254 TTTATGT-GCAGAATAC-ATGTGATGAAT-ATCAGCATAGTGATAAGGATGATAAGGATG 198
             TT A    G A AA AC A  TGA  AAT A CA  A AG G TAA  AT AT A GAT 
Sbjct:   127 TTGAGCAAGAAAAAAACCAACTGAATAATTAACAAAACAG-G-TAATTATAATTAAGAT- 183

Query:   197 AGGCTGATA-ATATGGCATTGGACCCAAAG-C-AGGATAAGGATGATACCAAGAAGCATG 141
             A   T ATA ATAT   A  G A     A  C AGGAT A GA GA A CAA AA   T 
Sbjct:   184 ATA-TAATATATATAATAAAGAAAAAGCATTCTAGGATGAAGA-GAAATCAACAAAATTC 241

Query:   140 -ATGATAACC 132
              ATGATAA C
Sbjct:   242 CATGATAATC 251


>cbil|dbest|1330784 C77045 C77045 3'
            Lib=1021[Mus_musculus||blastocyst|||3.5-dpc] Length=518
            Length = 518

  Minus Strand HSPs:

 Score = 179 (26.9 bits), Expect = 7.3, P = 1.0
 Identities = 157/253 (62%), Positives = 157/253 (62%), Strand = Minus / Plus

Query:   370 GAACACAGAATTAAAATAAGCATAAAATGAGA-A--AAAAATAAAT-GATTTCACGAATT 315
             GAA A A AAT AA A AAG   AAA T A A A  AAAAATAAAT GATTT A GA T 
Sbjct:   141 GAATATAAAATAAACA-AAGTTCAAATTTATACATAAAAAATAAATAGATTTGAAGA-TC 198

Query:   314 TCACTTCTTCCTACCAAGATTTGCAGCCAATGAACCAA-GTG-CAGCACCAATTTG-TGC 258
               AC   TTC  A  AA ATTT CA   AATG A  AA G   CAG AC AA   G TG 
Sbjct:   199 A-ACAAATTCTAAGAAATATTT-CA---AATGGAAAAATGCAACAGTACTAAAAAGATGG 253

Query:   257 ACCTTTATGTGCAGAATACATGTGATGAATATCAGCATAGTGATAAG-GAT-GATA--AG 202
             A    TAT  G A  ATA AT T ATG ATAT A CATA  GA AA  G T GA    AG
Sbjct:   254 ATTAATATTAGTATGATATATAT-ATGTATAT-ATCATAAAGACAAAAGCTTGACCCTAG 311

Query:   201 -GAT-G-AG-GCTGATAATATGGCATTGGACCCAAAGCAGGATAAGGATGATACCAAGAA 146
              GA  G A  G   A AATA  GCA   GACCCAAAGCA G TAAGG   ATA  A GAA
Sbjct:   312 AGACAGTACAGAACAGAATACAGCAA--GACCCAAAGCAAGTTAAGGTCCATAAGA-GAA 368

Query:   145 GC-ATGATGATAACCCAAACCATAAC 121
             G  A  A  A    CCA ACCA AAC
Sbjct:   369 GATACCACAANTTACCANACCA-AAC 393


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      385       384      10. 118 11 N/A 73   0.022 77
                                                  84   0.023 111
   -1      0      385       384      10. 118 11 N/A 73   0.022 77
                                                  84   0.023 111


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  dbEST
    Release date:  unknown
    Posted date:  9:10 AM EST Dec 21, 1997
    Format:  BLAST
  # of letters in database:  500,351,318
  # of sequences in database:  1,352,941
  # of database sequences satisfying E:  26
  No. of states in DFA:  199 (199 KB)
  Total size of DFA:  208 KB (256 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  14.78u 0.73s 15.51t  Elapsed: 00:00:04
  Total cpu time:  14.85u 0.77s 15.62t  Elapsed: 00:00:04
  Start:  Thu Feb  5 20:54:48 1998   End:  Thu Feb  5 20:54:52 1998

Date: 14:49:20 on Sun 17 Dec 117.