blastn_dbest_files/CShisMan2_386_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  CShisMan2_386
        (721 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|824833 AA185768 MAAD0176.M2R 5'-end Lib=583[S...  2899  4.8e-125  1
A cbil|dbest|824851 AA185786 MAAD0212.M2R 5'-end Lib=583[S...  2485  3.1e-106  1
A cbil|dbest|824829 AA185764 MAAD0172.M2R 5'-end Lib=583[S...  2419  3.0e-103  1
A cbil|dbest|419238 N21956 SMNHADA020078SK 5' Lib=323[Schi...  2010  9.5e-85   1
A cbil|dbest|824788 AA185825 MAAD0105.M2R 5'-end Lib=583[S...  1860  7.1e-78   1
A cbil|dbest|824787 AA185824 MAAD0104.M2R 5'-end Lib=583[S...  1860  7.1e-78   1
A cbil|dbest|1152942 AA508337 MAAD0371.M2R 5'-end Lib=608[S...  1832  1.3e-76   1
A cbil|dbest|824837 AA185772 MAAD0180.M2R 5'-end Lib=583[S...  1711  4.1e-71   1
A cbil|dbest|824819 AA185754 MAAD0162.M2R 5'-end Lib=583[S...  1587  1.7e-65   1
A cbil|dbest|824818 AA185753 MAAD0161.M2R 5'-end Lib=583[S...  1540  2.4e-63   1
A cbil|dbest|1869499 AI110930 MF003A03.NK3 5' Lib=1411[Schi...  1477  1.3e-60   1
A cbil|dbest|824812 AA185747 MAAD0148.M2R 5'-end Lib=583[S...  1242  8.4e-50   1
A cbil|dbest|1152968 AA508287 MAAD0310.M2R 5'-end Lib=608[S...  1077  2.7e-42   1
A cbil|dbest|824869 AA185804 MAAD0248.M2R 5'-end Lib=583[S...  1075  3.5e-42   1
A cbil|dbest|824874 AA185809 MAAD0258.M2R 5'-end Lib=583[S...  1065  1.0e-41   1
A cbil|dbest|419220 N21938 SMNHADA020045SK 5' Lib=323[Schi...   966  1.6e-37   1
A cbil|dbest|1152967 AA508286 MAAD0313.M2R 5'-end Lib=608[S...   934  9.1e-36   1
A cbil|dbest|1366616 AA661110 JM00M296.QM3 5' Lib=554[Schis...   909  4.0e-35   1
A cbil|dbest|1525953 AA804147 SMTBADA000980SK 5' Lib=1082[S...   709  1.4e-25   1
A cbil|dbest|764124 AA125662 JM00M018.QM3 5' Lib=554[Schis...   698  2.6e-25   1
A cbil|dbest|1869602 AI111033 MF001H03.NK3 5' Lib=1411[Schi...   679  3.7e-24   1
A cbil|dbest|1694621 AA958295 MAAD0496.RAR 5'-end Lib=557[S...   298  1.4e-06   1
A cbil|dbest|1746410 C94279 C94279  Lib=945[Dictyo...   241  0.00039   1
A cbil|dbest|821420 AA182383 JM00M109.QM3 5' Lib=554[Schis...   220  0.0042    1
A cbil|dbest|1200417 AA550407 1557m3  Lib=9[Plasmo...   213  0.62      1
A cbil|dbest|1366888 AA661382 MBAFCW3D03T3 5' Lib=531[Brugi...   174  0.79      1
A cbil|dbest|86081 T36048 EST96109 3'-end Lib=235[Homo_sa...   166  0.91      1
A cbil|dbest|1733923 AA996288 os19a12.s1 3' Lib=1046[Homo_s...   167  0.95      1
A cbil|dbest|1746332 C94201 C94201  Lib=945[Dictyo...   202  0.98      1
A cbil|dbest|1687166 C92038 C92038  Lib=945[Dictyo...   188  0.99      1
A cbil|dbest|1207400 AA557019 861  Lib=958[Pinus_t...   201  0.997     1
A cbil|dbest|816899 AA177960 mt06f03.r1 5' Lib=553[Mus_mus...   193  0.9993    1
A cbil|dbest|397587 D18399 MUSGS01457 3' Lib=375[Mus_muscu...   152  0.99994   1



>cbil|dbest|824833 AA185768 MAAD0176.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=649 Author_cmt:
            Schistosoma mansoni female specific 800 protein
            Length = 649

  Minus Strand HSPs:

 Score = 2899 (435.0 bits), Expect = 4.8e-125, P = 4.8e-125
 Identities = 605/629 (96%), Positives = 605/629 (96%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 240

Query:   469 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 410
             ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG
Sbjct:   241 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 300

Query:   409 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 350
             AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT
Sbjct:   301 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 360

Query:   349 GAATTTCGAGTTAGTAGGTCTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA 290
             GAATTTCGAGTTAGTAGGTCTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA
Sbjct:   361 GAATTTCGAGTTAGTAGGTCTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA 420

Query:   289 ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTTGCC 230
             ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTTGCC
Sbjct:   421 ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTTGCC 480

Query:   229 TTTAGCTTTGAGATGTCCATATTTTTTGTGTNTATATTGAGATCTAGAANGACCACTCAT 170
             TTTAGCTTTGAGATGTCCATATTTT TGTGT TATAT GAGATCTAGAA  ACCACTCAT
Sbjct:   481 TTTAGCTTTGAGATGTCCATATTTTCTGTGTCTATATCGAGATCTAGAAA-ACCACTCAT 539

Query:   169 TTTAGATGCTTCTAAACCATCTTTGTCTAGATCTGCTTTGGTCCAAGTTCCTAATTCCTT 110
             TTTAGATGCTTC AAACC TCT TGTC AGA CTGCTT  G CCAA TTCCTAATTCC  
Sbjct:   540 TTTAGATGCTTCCAAACC-TCTCTGTCCAGAACTGCTTCCG-CCAA-TTCCTAATTCCCA 596

Query:   109 ACTTTTCCTGGTTTTGTCNACTACTTGAT 81
             ACTT  CCTGG TTTGTC  CT  TT AT
Sbjct:   597 ACTT--CCTGGATTTGTCATCTCGTTTAT 623


>cbil|dbest|824851 AA185786 MAAD0212.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=500 Author_cmt:
            Schistosoma mansoni female specific 800 protein
            Length = 500

  Minus Strand HSPs:

 Score = 2485 (372.9 bits), Expect = 3.1e-106, P = 3.1e-106
 Identities = 499/500 (99%), Positives = 499/500 (99%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 240

Query:   469 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 410
             ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG
Sbjct:   241 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 300

Query:   409 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 350
             AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT
Sbjct:   301 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 360

Query:   349 GAATTTCGAGTTAGTAGGTCTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA 290
             GAATTTCGAGTTAGTAGGTCTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA
Sbjct:   361 GAATTTCGAGTTAGTAGGTCTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA 420

Query:   289 ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTT-GC 231
             ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTT GC
Sbjct:   421 ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTTTGC 480

Query:   230 CTTTAGCTTTGAGATGTCCA 211
             CTTTAGCTTTGAGATGTCCA
Sbjct:   481 CTTTAGCTTTGAGATGTCCA 500


>cbil|dbest|824829 AA185764 MAAD0172.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=493
            Length = 493

  Minus Strand HSPs:

 Score = 2419 (362.9 bits), Expect = 3.0e-103, P = 3.0e-103
 Identities = 489/494 (98%), Positives = 489/494 (98%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             CAAAAGGTTATTAACATGA AATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT
Sbjct:     1 CAAAAGGTTATTAACATGACAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTC AACTTGGATATAAGCATGAGT
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTC-AACTTGGATATAAGCATGAGT 239

Query:   469 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 410
             ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACC TG
Sbjct:   240 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCGTG 299

Query:   409 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 350
             AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTT CTCTTTTCCACGAGTTTT
Sbjct:   300 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTGCTCTTTTCCACGAGTTTT 359

Query:   349 GAATTTCGAGTTAGTAGGTCTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA 290
             GAATTTCGAGTTAGTAGG CTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA
Sbjct:   360 GAATTTCGAGTTAGTAGGACTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATA 419

Query:   289 ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTTGCC 230
             ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTTGCC
Sbjct:   420 ATATGTAGATTCTGATGACACGATACCGTGTCTACCGAGTCCACGTGAACGGAATTTGCC 479

Query:   229 TTTAGCTTTGAGAT 216
             TTTAGCTTTGAGAT
Sbjct:   480 TTTAGCTTTGAGAT 493


>cbil|dbest|419238 N21956 SMNHADA020078SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=470
            Length = 470

  Plus Strand HSPs:

 Score = 2010 (301.6 bits), Expect = 9.5e-85, P = 9.5e-85
 Identities = 436/469 (92%), Positives = 436/469 (92%), Strand = Plus / Plus

Query:     1 AATAACAGTTGTNGGAGTGNAAATNCGGNTTGGAACAGAAGAACGAAACTAATCACAACG 60
             AATAACAGTTGT GGAGTG AAAT CGG TTGGAACAGAAGAACGAAACTAATCACAA G
Sbjct:     1 AATAACAGTTGTNGGAGTGNAAATNCGGNTTGGAACAGAAGAACGAAACTAATCACAANG 60

Query:    61 TTGGATCAAAAACTCAGTAAATCAAGTAGTNGACAAAACCAGGAAAAGTAAGGAATTAGG 120
              TGGATCAAAAACTCAGTAA TCAA TAGT GA AAAA  AG AAAAGTAAGGA TTA  
Sbjct:    61 NTGGATCAAAAACTCAGTAACTCAATTAGTNGA-AAAANTAGTAAAAGTAAGGAGTTA-- 117

Query:   121 AACTTGGACCAAAGCAGATCTAGACAAAGATGGTTTAGAAGCATCTAAAATGAGTGGTCN 180
             AACTTGGACCAAAGC GATCTAGACAAA ATGGTTTAGA GCATCTAAAATGAGTGGTC 
Sbjct:   118 AACTTGGACCAAAGCGGATCTAGACAAA-ATGGTTTAGAGGCATCTAAAATGAGTGGTCA 176

Query:   181 TTCTAGATCTCAATATANACACAAAAAATATGGACATCTCAAAGCTAAAGGCAAATTCCG 240
             TTCTAGATCTCAATATA ACACAAAAAATATGGACATCTCAAAGCTAAAGGCAAATTCCG
Sbjct:   177 TTCTAGATCTCAATATAAACACAAAAAATATGGACATCTCAAAGCTAAAGGCAAATTCCG 236

Query:   241 TTCACGTGGACTCGGTAGACACGGTATCGTGTCATCAGAATCTACATATTATGTAATTGA 300
             TTCACGTGGACTCGGTAGACACGGTATCGT TCATCAGAATCTACATATTATGTAATTGA
Sbjct:   237 TTCACGTGGACTCGGTAGACACGGTATCGTATCATCAGAATCTACATATTATGTAATTGA 296

Query:   301 AGGCAAATTCGATAGATATGGTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCGTGG 360
             AGGCAAATTCG TAGATATGGTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCG GG
Sbjct:   297 AGGCAAATTCGNTAGATATGGTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCGNGG 356

Query:   361 -AAAAGAGAAAAAATATTCTAAAAAAATTGTTGATAATCAATTCGATATTCAAGGTGG-T 418
              AAAAGAGAAAA ATATTCTAAAAAA T GT GATAATCAATTCGATATTCAAGGTGG T
Sbjct:   357 GAAAAGAGAAAANATATTCTAAAAAANTGGTGGATAATCAATTCGATATTCAAGGTGGGT 416

Query:   419 TTAATTG-AAGAACGTAAATAT-AAACGAACTGGTG-ATTATCAAGCGAATGG 468
             TTAATTG A GAACGT AATAT AAACGAACTGGTG AT ATCAAGCGAAT G
Sbjct:   417 TTAATTGGANGAACGTNAATATTAAACGAACTGGTGGATCATCAAGCGAATTG 469


>cbil|dbest|824788 AA185825 MAAD0105.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=372 Author_cmt:
            Schistosoma mansoni female specific 800 protein
            Length = 372

  Minus Strand HSPs:

 Score = 1860 (279.1 bits), Expect = 7.1e-78, P = 7.1e-78
 Identities = 372/372 (100%), Positives = 372/372 (100%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 240

Query:   469 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 410
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 300

Query:   409 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 350
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 360

Query:   349 GAATTTCGAGTT 338
             ||||||||||||
Sbjct:   361 GAATTTCGAGTT 372


>cbil|dbest|824787 AA185824 MAAD0104.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=372 Author_cmt:
            Schistosoma mansoni female specific 800 protein
            Length = 372

  Minus Strand HSPs:

 Score = 1860 (279.1 bits), Expect = 7.1e-78, P = 7.1e-78
 Identities = 372/372 (100%), Positives = 372/372 (100%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 240

Query:   469 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 410
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 300

Query:   409 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 350
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 AATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTTT 360

Query:   349 GAATTTCGAGTT 338
             ||||||||||||
Sbjct:   361 GAATTTCGAGTT 372


>cbil|dbest|1152942 AA508337 MAAD0371.M2R 5'-end
            Lib=608[Schistosoma_mansoni|||||adult] Length=386
            Length = 386

  Minus Strand HSPs:

 Score = 1832 (274.9 bits), Expect = 1.3e-76, P = 1.3e-76
 Identities = 376/386 (97%), Positives = 376/386 (97%), Strand = Minus / Plus

Query:   715 GCAAAA-CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA 657
             GCA  A CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA
Sbjct:     1 GCACGAGCAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA 60

Query:   656 ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAA 597
             ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAA
Sbjct:    61 ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAA 120

Query:   596 TGGTTACGTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTT 537
             TGGTTACGTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTT
Sbjct:   121 TGGTTACGTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTT 180

Query:   536 CGCTATTATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAG 477
             CGCTATTATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAG
Sbjct:   181 CGCTATTATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAG 240

Query:   476 CATGAGTACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAAC 417
             CATGAGTACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAAC
Sbjct:   241 CATGAGTACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAAC 300

Query:   416 CACCTTGAATATCGAATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCAC 357
             CACCTTGAATATCGAATTGATTATCAACAATTTTTTTAGAATA TTTTTC C TTTCCA 
Sbjct:   301 CACCTTGAATATCGAATTGATTATCAACAATTTTTTTAGAATAATTTTTCCCCTTTCCAA 360

Query:   356 GAGTTTTG-AATTTCGAGTTAGTAGG 332
             GAGTTTTG AATTTCGAGTTA TA G
Sbjct:   361 GAGTTTTGGAATTTCGAGTTANTANG 386


>cbil|dbest|824837 AA185772 MAAD0180.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=350 Author_cmt:
            Schistosoma mansoni female specific 800 protein
            Length = 350

  Minus Strand HSPs:

 Score = 1711 (256.7 bits), Expect = 4.1e-71, P = 4.1e-71
 Identities = 347/350 (99%), Positives = 347/350 (99%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 240

Query:   469 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 410
             ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG
Sbjct:   241 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 300

Query:   409 AATATCGAATTGATTATCAACAATTTTTTT-AGAATATTTTTT-CTCTTT 362
             AATATCGAATTGATTATCAACAATTTTTTT AGAATATTTTT  CTCTTT
Sbjct:   301 AATATCGAATTGATTATCAACAATTTTTTTTAGAATATTTTTGACTCTTT 350


>cbil|dbest|824819 AA185754 MAAD0162.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=326 Author_cmt:
            Schistosoma mansoni female specific 800 protein
            Length = 326

  Minus Strand HSPs:

 Score = 1587 (238.1 bits), Expect = 1.7e-65, P = 1.7e-65
 Identities = 321/326 (98%), Positives = 321/326 (98%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTNTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 240

Query:   469 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 410
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTG 300

Query:   409 AATATCGAATTGATTATCAACAATTT 384
             |||||||| | ||||| ||||| |||
Sbjct:   301 AATATCGATTGGATTAACAACATTTT 326


>cbil|dbest|824818 AA185753 MAAD0161.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=317 Author_cmt:
            Schistosoma mansoni female specific 800 protein
            Length = 317

  Minus Strand HSPs:

 Score = 1540 (231.1 bits), Expect = 2.4e-63, P = 2.4e-63
 Identities = 314/317 (99%), Positives = 314/317 (99%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 240

Query:   469 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTC-TTCAATTAAACCA-CCT 412
             ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTC TTCAATTAAACCA CCT
Sbjct:   241 ACCATTCGCTTGATAATCACCAGTTCGTTTATATTTACGTTCCTTCAATTAAACCATCCT 300

Query:   411 TGAA-TATCGAATTGAT 396
             TGAA TATCGAATTGAT
Sbjct:   301 TGAAATATCGAATTGAT 317


>cbil|dbest|1869499 AI110930 MF003A03.NK3 5'
            Lib=1411[Schistosoma_mansoni||whole_organism|||sexually_mature_adul
            t] Length=422 Author_cmt: AA185768, Schistosoma mansoni cDNA clone
            similar to Schistosoma mansoni female specific 800 protein.
            Length = 422

  Plus Strand HSPs:

 Score = 1477 (221.6 bits), Expect = 1.3e-60, P = 1.3e-60
 Identities = 349/411 (84%), Positives = 349/411 (84%), Strand = Plus / Plus

Query:   292 TGTAATTGAAGGCAAATTCGATAGATATGGTCGAAAGAGACCTACTAACTCGAAATTCAA 351
             TGTAATTGAAGGCAAATTCGATAGATATGGTCGAAAGAGACCTACTAACTCGAAATTCAA
Sbjct:     1 TGTAATTGAAGGCAAATTCGATAGATATGGTCGAAAGAGACCTACTAACTCGAAATTCAA 60

Query:   352 AACTCGTGGAAAAGAGAAAAAATATTCTAAAAAAATTGTTGATAATCAATTCGATATTCA 411
             AACTCGTGGAAAAGAGAAAAAAT TTCTAAAAAAATTGTTGATAATCAATTCGATATTCA
Sbjct:    61 AACTCGTGGAAAAGAGAAAAAATNTTCTAAAAAAATTGTTGATAATCAATTCGATATTCA 120

Query:   412 AGGTGGTTTAATTGAAGAACGTAAATATAAACGAACTGG-TGATTATCAAGCGAATGGTA 470
             AGGTGGTTTAATTGAA AACGT AATATAAACGAACTGG TGATTATCAAGCGAATGGTA
Sbjct:   121 AGGTGGTTTAATTGAANAACGTTAATATAAACGAACTGGGTGATTATCAAGCGAATGGTA 180

Query:   471 CTCATGCTTATATCCAAGTTGGAGCTGAACATCATGCTTCTTTGAATACAAGAGCAAATA 530
             CTCATGCTTAT TCCAAGTTGGAGCTGAACA CA GCTTCTT    T  AA  G  AA A
Sbjct:   181 CTCATGCTTATNTCCAAGTTGGAGCTGAACAACAAGCTTCTTCAGCTTTAAATGTNAAAA 240

Query:   531 ATAGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTGATTTTAATCTTAACAATAACG 590
               AG GAAA C AACATTCA A AAGAACAAG AATTTGA TTTAA CTTA C  TAACG
Sbjct:   241 GGAGTGAAAACNAACATTCAGATAAGAACAAGGAATTTGAATTTAAGCTTAGCTCTAACG 300

Query:   591 TAACCATTAAAAGGTTAGATTTGCG-ACAG-CAAAAATAAACCATTTCAAGAATTTTAGG 648
                CCA  AAA  G  AGA  TG G A    C A  AT AA CATTTCAA  ATTTTA  
Sbjct:   301 ATNCCAGAAAACAG--AGAAGTGAGGATNTTCGAGCATTAAACATTTCAACNATTTTACA 358

Query:   649 AATATAATTTCTATTAGACTATAATAAACGTAATATCGATTTTCATGTTAATA 701
             AAT TAATTTCT TT GACTAT ATAAA  TAATATCGATTTTCATGTTAA A
Sbjct:   359 AATNTAATTTCTTTTTGACTATTATAAAAATAATATCGATTTTCATGTTAAAA 411


>cbil|dbest|824812 AA185747 MAAD0148.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=259 Author_cmt:
            Schistosoma mansoni female specific 800 protein
            Length = 259

  Minus Strand HSPs:

 Score = 1242 (186.4 bits), Expect = 8.4e-50, P = 8.4e-50
 Identities = 254/258 (98%), Positives = 254/258 (98%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAA  TTTTAATGGTTAC
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAATGTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 470
             ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGT 240

Query:   469 A-CCATTCGC-TTGATAA 454
             A CCATTCGC TTGATAA
Sbjct:   241 AACCATTCGCCTTGATAA 258


>cbil|dbest|1152968 AA508287 MAAD0310.M2R 5'-end
            Lib=608[Schistosoma_mansoni|||||adult] Length=227
            Length = 227

  Minus Strand HSPs:

 Score = 1077 (161.6 bits), Expect = 2.7e-42, P = 2.7e-42
 Identities = 221/227 (97%), Positives = 221/227 (97%), Strand = Minus / Plus

Query:   715 GCAAAA-CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA 657
             GCA  A CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA
Sbjct:     1 GCACGAGCAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA 60

Query:   656 ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAA 597
             ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAA
Sbjct:    61 ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAA 120

Query:   596 TGGTTACGTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTT 537
             TGGTTACGTTATTGTTAAGATTAAAATCAAATTGCTTGT CTTTTGTGAATGTTTGCTTT
Sbjct:   121 TGGTTACGTTATTGTTAAGATTAAAATCAAATTGCTTGTCCTTTTGTGAATGTTTGCTTT 180

Query:   536 CGCTATTATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCA 490
             CGC ATTATTTGCTCTTGTATTCAAAGAAGCATGATG TCAGCTCCA
Sbjct:   181 CGCAATTATTTGCTCTTGTATTCAAAGAAGCATGATGNTCAGCTCCA 227


>cbil|dbest|824869 AA185804 MAAD0248.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=215
            Length = 215

  Minus Strand HSPs:

 Score = 1075 (161.3 bits), Expect = 3.5e-42, P = 3.5e-42
 Identities = 215/215 (100%), Positives = 215/215 (100%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAG 495
             |||||||||||||||||||||||||||||||||||
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAG 215


>cbil|dbest|824874 AA185809 MAAD0258.M2R 5'-end
            Lib=583[Schistosoma_mansoni|||||adult] Length=213
            Length = 213

  Minus Strand HSPs:

 Score = 1065 (159.8 bits), Expect = 1.0e-41, P = 1.0e-41
 Identities = 213/213 (100%), Positives = 213/213 (100%), Strand = Minus / Plus

Query:   709 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 650
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAAATTATAT 60

Query:   649 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 590
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 TCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTAC 120

Query:   589 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 530
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATT 180

Query:   529 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTC 497
             |||||||||||||||||||||||||||||||||
Sbjct:   181 ATTTGCTCTTGTATTCAAAGAAGCATGATGTTC 213


>cbil|dbest|419220 N21938 SMNHADA020045SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=404
            Length = 404

  Plus Strand HSPs:

 Score = 966 (144.9 bits), Expect = 1.6e-37, P = 1.6e-37
 Identities = 274/371 (73%), Positives = 274/371 (73%), Strand = Plus / Plus

Query:   131 AAAGCAGATCTAGACAAAGATGGTTTAGAAGCATCTAAAATGAGTGGTCNTTCTAGATCT 190
             AAAG A A  TA   A A ATG TTT GA  CA CT     G   GG C TTC A ATCT
Sbjct:    23 AAAGAATAA-TATGGATA-ATGATTTNGAGTCAGCTTTTGGGTCAGGACGTTCCATATCT 80

Query:   191 CAATATANACACAAAAAATATGGACATCTCAAAGCTAAAGGCAAATTCCGTTCACGTGG- 249
              AATATA ACACA AAAA  T GA  T  C A GC AAAGG AAATT C  TCACGTGG 
Sbjct:    81 AAATATAAACACATAAAAGCTAGAGCTNACGATGCAAAAGGGAAATTTCAATCACGTGGG 140

Query:   250 -ACTCGGTAGACACGGTATCGTGTCATCAGAATCTACATATTATGTAATTGAAGGCAAAT 308
              ACT G   G  A GGTAT GT TC TCAGAATC  CA A T T TAATTGAAG  A  T
Sbjct:   141 AACTAGAG-GTTATGGTATGGTCTCCTCAGAATCCTCACAATTTTTAATTGAAGAGACTT 199

Query:   309 TCGATAGATATGGTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCGTGGAAAAGAGA 368
             T G TA ATATGGTCGA   A ACCTA TAA TCGAAATTCAAAACTCGTGG AAA A A
Sbjct:   200 TGGNTAAATATGGTCGACCAAAACCTATTAAATCGAAATTCAAAACTCGTGGGAAAAAAA 259

Query:   369 AAAAATATTCTAAAAAAATTGTTGATAATCAATTCGATATTCAAGGTGGTTTAATTGAAG 428
             A AA TATTCTAAAAAAATTGTTGAT ATCA TTCGA ATT AAGGTGGTTTA TTGA G
Sbjct:   260 AGAANTATTCTAAAAAAATTGTTGATNATCANTTCGACATTAAAGGTGGTTTATTTGANG 319

Query:   429 AACGTAAATATAAACGAACTGGTGATTATCAAGCGAATGGTACTCATGCTTATATCCAAG 488
              AC TAA TATAAAC AACTGGTGATTATCAAGC A TGGTACTCATG TTA ATC A G
Sbjct:   320 GACATAANTATAAACAAACTGGTGATTATCAAGCAANTGGTACTCATGTTTACATCAATG 379

Query:   489 TTGGAGCTGAACA 501
             T  GA  TGAACA
Sbjct:   380 TGCGAAATGAACA 392


>cbil|dbest|1152967 AA508286 MAAD0313.M2R 5'-end
            Lib=608[Schistosoma_mansoni|||||adult] Length=196
            Length = 196

  Minus Strand HSPs:

 Score = 934 (140.1 bits), Expect = 9.1e-36, P = 9.1e-36
 Identities = 191/196 (97%), Positives = 192/196 (97%), Strand = Minus / Plus

Query:   715 GCAAAA-CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA 657
             GCA  A CAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA
Sbjct:     1 GCACGAGCAAAAGGTTATTAACATGAAAATCGATATTACGTTTATTATAGTCTAATAGAA 60

Query:   656 ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAA 597
             ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTT+AA
Sbjct:    61 ATTATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTWAA 120

Query:   596 TGGTTACGTTATTGTTAAGATTAAAATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTT 537
             TGGTTACGTTATTGTTAAGATTAAAATCA ATTGCTTGTTCTTTTGTGAATGTTTGCTTT
Sbjct:   121 TGGTTACGTTATTGTTAAGATTAAAATCACATTGCTTGTTCTTTTGTGAATGTTTGCTTT 180

Query:   536 CGCTATTATTTGCTCT 521
             CGCTATTATTTGCTCT
Sbjct:   181 CGCTATTATTTGCTCT 196


>cbil|dbest|1366616 AA661110 JM00M296.QM3 5'
            Lib=554[Schistosoma_japonicum||Whole_organism|||Miracidium]
            Length=596 Author_cmt: Female specific 800 protein
            Length = 596

  Plus Strand HSPs:

 Score = 909 (136.4 bits), Expect = 4.0e-35, P = 4.0e-35
 Identities = 275/375 (73%), Positives = 275/375 (73%), Strand = Plus / Plus

Query:   101 AGGAAA-AGTAAGGAATTAGGAACTTG-GAC-CAAAGCAGATCTAGACAAAGATGGT-TT 156
             AGG A  A TAA GA   A GAA T   GA  CA  G AGA  T GA AAA ATGGT TT
Sbjct:    18 AGGTAGCATTAATGATAAAAGAAGTGCAGATTCATCG-AGACAT-GAAAAAAATGGTATT 75

Query:   157 AGAAGCATCTAAAATGAGTGG-TCNTTCTAGATCTCAATATANACACAAAAAATATGGAC 215
             A  A CA   A  ATG  TGG TC T CT  ATCT  ATAT  A ACA AAAA A  GA 
Sbjct:    76 AATA-CAGAAAGCATGTTTGGATCAT-CTTCATCTAGATATCAATACAGAAAACAAAGAG 133

Query:   216 ATCTCAAAGCTAAAGGCAAATTCCGTTCACGTGGACTCGGTAGACACGGTATCGTGTCAT 275
             AT T AAAGC AAAGGCAAATTCCG TCACG GG  TCGG AGA A GGTA   TGTCAT
Sbjct:   134 ATTTTAAAGCCAAAGGCAAATTCCGATCACGCGGTATCGGAAGATATGGTACAATGTCAT 193

Query:   276 CAGAATCTACATATTATGTAATTGAAGGCAAATTCGATAGATATGGTCGAAAGAGACCTA 335
             CAGAATC ACA ATTA GTAATTGAAGG A   TCGATAGATATGGTCGA   AGACCTA
Sbjct:   194 CAGAATCAACAAATTACGTAATTGAAGGGATGATCGATAGATATGGTCGACGAAGACCTA 253

Query:   336 CTAACTCGAAATTCAAAACTCGTGGAAAAGAGAAAAAATATTCTAAAAAAATTGTTGATA 395
               AA TCGAAATTCAAAACTCGTGGAAAAGAGAA AAATATTC A    AAT   TGATA
Sbjct:   254 TCAATTCGAAATTCAAAACTCGTGGAAAAGAGAAGAAATATTCAAGGCGAATCAATGATA 313

Query:   396 ATCAATTCGATATTCAAGGTGGTTTAATTGAAGAACGTAAATATAAACGAACTGGTGATT 455
             ATC  TTCGATATT A GGTGGTTT   TGAA   CG  AA AT    G A TGGTGATT
Sbjct:   314 ATCGGTTCGATATTAAGGGTGGTTTGTATGAACGTCGACAACATTTGGGTATTGGTGATT 373

Query:   456 ATCAAGCGAATGGTACTCA 474
             ATCAAGC AATGGTACTCA
Sbjct:   374 ATCAAGCAAATGGTACTCA 392


>cbil|dbest|1525953 AA804147 SMTBADA000980SK 5'
            Lib=1082[Schistosoma_mansoni|||||Adult] Length=187
            Length = 187

  Plus Strand HSPs:

 Score = 709 (106.4 bits), Expect = 1.4e-25, P = 1.4e-25
 Identities = 157/173 (90%), Positives = 157/173 (90%), Strand = Plus / Plus

Query:   320 GGTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCGTGGAAAAGAGAAAAAATATTCT 379
             GGTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCGTGGAAAAGAGAAAAAATATTCT
Sbjct:     8 GGTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCGTGGAAAAGAGAAAAAATATTCT 67

Query:   380 AAAAAAATTGTTGATAATCAATTCGATATTCAAGGTGGTTTAATTGAAGAACGTAAATAT 439
             AAAAAAATTGTTGATAATCAATTCGATATTCAAGGTGGTTTAATTGAAGAA  TAAATAT
Sbjct:    68 AAAAAAATTGTTGATAATCAATTCGATATTCAAGGTGGTTTAATTGAAGAAGCTAAATAT 127

Query:   440 AAACGAACTGGTGATTATCAAGCGAATGGTACTCATGCTTATATCCAAGTTGG 492
             AAA  AACTGGTGATTAT AAGCG A GGTA TC  GCT  TAT  AAG  GG
Sbjct:   128 AAAGCAACTGGTGATTAT-AAGCGCAAGGTA-TCTAGCTCTTATATAAGCCGG 178


>cbil|dbest|764124 AA125662 JM00M018.QM3 5'
            Lib=554[Schistosoma_japonicum||Whole_organism|||Miracidium]
            Length=307
            Length = 307

  Plus Strand HSPs:

 Score = 698 (104.7 bits), Expect = 2.6e-25, P = 2.6e-25
 Identities = 208/287 (72%), Positives = 208/287 (72%), Strand = Plus / Plus

Query:   182 TCTAGATCTCAATATANACACAAAAAATATGGAC-ATCTCAAAGCTAAAGGCAAATTCCG 240
             TC A ATC   ATAT    ACA  AAA ATG A  AT T AAAGCTA AGGCAAAT CCG
Sbjct:    23 TCCACATCAAGATATCAGTACAGGAAA-ATGAAAGATTTTAAAGCTAGAGGCAAATCCCG 81

Query:   241 TTCACGTGGACTCGGTAGACACGGTATCGTGTCATCAGAATCTACATATTATGTAATTGA 300
              TCACG GG  TCGG AGA A GGTA   TGTCATCAGAA C ACA ATT  GT  TTGA
Sbjct:    82 ATCACGCGGTATCGGAAGATATGGTACAATGTCATCAGAAACAACAGATTTCGTGGTTGA 141

Query:   301 AGGCAAATTCGATAGATATGGTCGAAAGAGACCTACTAACTCGAAATTCAAAACTCGTGG 360
             AGG AA  TCG TA ATATGGT  AA GA ACCT  TAA TCGAAATTCAAAACTCGTGG
Sbjct:   142 AGGGAAGATCGGTAAATATGGTT-AAGGAAACCTCTTAAATCGAAATTCAAAACTCGTGG 200

Query:   361 AAAAGAGAAAAAATATTCTAAAAAAATTGTTGATAATCAATTCGATATTCAAGGTGGTTT 420
              AA GAGAA AAATATTC A    AAT   TGA AATC  TTCGATAT  AAGGTG TTT
Sbjct:   201 GAAGGAGAAGAAATATTCAAGGCGAATCAATGACAATCGGTTCGATATA-AAGGTGATTT 259

Query:   421 AATTGAAGAACGTAAATATAAACGAACTGGTGATTATCAAGCGAATGG 468
                TG A  AC T AA AT A  G A TGGTGATTATCAAGCGA TGG
Sbjct:   260 GTATGCACGACATCAACATGAGGGTATTGGTGATTATCAAGCGAGTGG 307


>cbil|dbest|1869602 AI111033 MF001H03.NK3 5'
            Lib=1411[Schistosoma_mansoni||whole_organism|||sexually_mature_adul
            t] Length=160 Author_cmt: AA185768, Schistosoma mansoni cDNA clone
            similar to Schistosoma mansoni female specific 800 protein.
            Length = 160

  Plus Strand HSPs:

 Score = 679 (101.9 bits), Expect = 3.7e-24, P = 3.7e-24
 Identities = 145/160 (90%), Positives = 145/160 (90%), Strand = Plus / Plus

Query:   164 TCTAAAATGAGTGGTCNTTCTAGATCTCAATATANACACAAAAAATATGGACATCTCAAA 223
             |||||||||||||||| | ||| ||||||||||| || | | |||| |||||||||||||
Sbjct:     1 TCTAAAATGAGTGGTCNTCCTAAATCTCAATATANACCCCANAAATNTGGACATCTCAAA 60

Query:   224 GCTAAAGGCAAATTCCGTTCACGTGGACTCGGTAGACACGGTATCGTGTCATCAGAATCT 283
             ||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||
Sbjct:    61 GCTAAAGGCAAATTCCGTTCACGTGGACTCGGTTGACACGGTATCCTATCATCAGAATCT 120

Query:   284 ACATATTATGTAATTGAAGGCAAATTCGATAGATATGGTC 323
             || ||||||||| |||||||||||||||||| || |||||
Sbjct:   121 ACNTATTATGTANTTGAAGGCAAATTCGATANATTTGGTC 160


>cbil|dbest|1694621 AA958295 MAAD0496.RAR 5'-end
            Lib=557[Schistosoma_mansoni|||||adult_worm] Length=206
            Length = 206

  Plus Strand HSPs:

 Score = 298 (44.7 bits), Expect = 1.4e-06, P = 1.4e-06
 Identities = 108/155 (69%), Positives = 108/155 (69%), Strand = Plus / Plus

Query:     5 ACAGTTGTNGGAGTGNAAATNCGGNTTGGAACAGAAGAACGAAACTAATCACAACGTTGG 64
             ACAGTTGT   A  G  A T  G  TTG AA  GA GA C  AACTAAT ACAACGTTGG
Sbjct:    60 ACAGTTGTAACACAGAGATTTAGTTTTGAAAGTGAGGAGC--AACTAATAACAACGTTGG 117

Query:    65 ATCAAAAACTCAGTAAATCAAGTAG-TNGACAAAACCAGGAAAAGTAAGGAATTAGGAAC 123
             ATC   A  T A  AAA CA G AG T GACAAA  CA GAA  GTA GGAATTAGGAA 
Sbjct:   118 ATCCCGATTTGATCAAA-CA-GAAGATAGACAAATACAAGAA--GTAGGGAATTAGGAA- 172

Query:   124 TTGGACCAAAGCAGATCTAGACAAAGATGGTTTAGA 159
             TTGG C  AAGCAG TCT GACA AGA GGTTT GA
Sbjct:   173 TTGG-CGGAAGCAGTTCTGGACAGAGA-GGTTTGGA 206


>cbil|dbest|1746410 C94279 C94279 
            Lib=945[Dictyostelium_discoideum|||||slug] Length=401
            Length = 401

  Plus Strand HSPs:

 Score = 241 (36.2 bits), Expect = 0.00039, P = 0.00039
 Identities = 227/379 (59%), Positives = 227/379 (59%), Strand = Plus / Plus

Query:   335 ACTAACTC-GAA-ATTCAAAACTCGTGGAAAAGAGAAAAAATATTCTAAAAAAATTGTTG 392
             A TAACT  GA  AT CAAA  T    G  AA AGAA A AT T C AA AA  T GTT 
Sbjct:     9 ATTAACTTTGATGATCCAAATGTTAATGTTAA-AGAAGAGATCTACCAACAACCT-GTTA 66

Query:   393 ATA-ATCAAT-TCGATATTCAAGGTGGTTTAATTGAAGAACGTAAATATAAA-CGAACTG 449
             A A A CAAT TC  TAT CAA  T G  T AT  AA AA  TAA TA AAA C  AC  
Sbjct:    67 AAACAACAATCTCAGTAT-CAATCTTGGATGAT--AATAA--TAA-TAAAAATCTTACAA 120

Query:   450 GTGATTATCAAG--CGAATGGTACTCATGCTTATATCCA-AGTTGGAGCTGAACATC-AT 505
              TGA  AT  AG  C AA   TA  CA  C  A A C A A     A C GAA AT  AT
Sbjct:   121 ATGAAAATTCAGTTCAAACAATAA-CAA-CA-ACAACAACAAAAAAACCAGAA-ATAGAT 176

Query:   506 GCTTCTTTGAATA-CAAGAGCAAATAATAGCGAAAGCAAACATTCACAAAAGAACAAGCA 564
              C  C    AATA CAA  GCAA TA  A C A A  AAA  TT A AAAA  A AA  A
Sbjct:   177 ACACCACC-AATAACAAATGCAACTACAA-CAACAAAAAAT-TTAAAAAAATTAAAAAAA 233

Query:   565 ATTTGATTTTAATCTTAACAATAACGTAACC-ATTAAAAGGTTAGATT-TGCGACAGCAA 622
                T A TT AA  T AA A TAA  TA    A  AAAAGGTTAGATT T   ACAG AA
Sbjct:   234 GACTCAATTGAAGTTGAA-ATTAAA-TATTTGAAAAAAAGGTTAGATTATTTAACAGAAA 291

Query:   623 AAATAAACCATTTCAAGAATTTTAGGAATATAATTTCTATTAGACTATAATAAACGTAAT 682
             AA T AA  ATTT  AGAA TTTA   AT TAAT   TATTA A TAT  TAAA  TAA 
Sbjct:   292 AATTGAATAATTT--AGAAATTTAAACAT-TAATCA-TATTAAAATATC-TAAAAATAAA 346

Query:   683 ATCGATTTTCATGTTA-ATAACCTTTTGTTTT 713
             A   ATTT   T TTA ATA   TTTT TTTT
Sbjct:   347 AAT-ATTTGG-T-TTAGATATT-TTTTATTTT 374


>cbil|dbest|821420 AA182383 JM00M109.QM3 5'
            Lib=554[Schistosoma_japonicum||Whole_organism|||Miracidium]
            Length=376
            Length = 376

  Plus Strand HSPs:

 Score = 220 (33.0 bits), Expect = 0.0042, P = 0.0042
 Identities = 64/89 (71%), Positives = 64/89 (71%), Strand = Plus / Plus

Query:   401 TTCGATATTCAAGGTGGTTTAATTGAAGAACGTAAATATAAACGAACTGGTGATTATCAA 460
             ||||||||| |||||| |||   || |  || | || || |  | | |||||||||||||
Sbjct:     2 TTCGATATTAAAGGTGATTTGTATGCACGACATCAACATGAGGGTATTGGTGATTATCAA 61

Query:   461 GCGAATGGTACTCATGCTTATATCCAAGT 489
             |||| ||||| | || ||  | || || |
Sbjct:    62 GCGAGTGGTAATTATACTACTCTCAAACT 90


>cbil|dbest|1200417 AA550407 1557m3  Lib=9[Plasmodium_falciparum|||||]
            Length=517
            Length = 517

  Minus Strand HSPs:

 Score = 213 (32.0 bits), Expect = 0.96, P = 0.62
 Identities = 229/402 (56%), Positives = 229/402 (56%), Strand = Minus / Plus

Query:   571 ATCAAATTGCTTGTTCTTTTGTGAATGTTTGCTTTCGCTATTA-TTTGCTCTTGTATTCA 513
             ATCA  TT  T  TTCTTTT TG AT TTT  TTTC  T TT  TTT CT T  T TTCA
Sbjct:   108 ATCATGTTATTAATTCTTTTCTGCATTTTTTGTTTCT-TCTTCGTTTCCT-TCCTTTTCA 165

Query:   512 AA-GAAGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGTACCATTCGCTTGA--T 456
             AA GAA C T AT  T A  T CA       TAT A   T A TA  ATT   TT A  T
Sbjct:   166 AATGAAACTT-ATCCTTATTTTCATTAAAATTATTATTTTCAATAATATTTAATTTACTT 224

Query:   455 A-ATCACCA--GTTCGT-TTATATTTA-CGTTC-TTCAATTAAACCACCTTGAATATCGA 402
             A ATCA CA  G  C T TTA A   A C  TC TT  AT  AA      T  AT TCGA
Sbjct:   225 ATATCATCATAGACCTTATTAGAAACAACACTCCTTGCATCCAATTTTTCTCTATCTCGA 284

Query:   401 ATTGATTATCAACAATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTT-TGAATTTC 343
                  TT T      TTTT TT    T TTTTTTCTCTTTTC A  AGTT  TG  TTTC
Sbjct:   285 TCCTTTTCTTTGTTGTTTTCTTTCCTTTTTTTTTCTCTTTTC-ATTAGTTCATGTTTTTC 343

Query:   342 GAGTTAGTAGGTCTCTTTCGACCATATCTATCGAATT-TGCCTTCAATTACA-TAATA-T 286
             GAGTT  T   TCT  TTC  CCA  TC  T  AAT  T C  T AA TA A T AT  T
Sbjct:   344 GAGTTT-T---TCTAATTCATCCAACTCGTTATAATAATTCAATGAAATAGAATCATCCT 399

Query:   285 G-T-AGATTCTGATGACACGATACCGTGTC-TACCGAGTCCACGTGAACGGA-ATT-TGC 231
               T AGAT C G TGA A  ATA C   TC T  CG G   A  T AA   A AT  TG 
Sbjct:   400 TCTGAGATCCAGTTGATAATATATCAC-TCATTTCG-GAAGAATTCAATTTATATGGTGA 457

Query:   230 CTTTAGCTTTGAGATG-TCCATATTTTTTG-TGTNT-ATATTGAGATCTAGAA 181
              TTTA  TTT A AT  TCCATA  TTT G T T T A ATT    T TAG A
Sbjct:   458 -TTTATTTTTTAAATAATCCATAGCTTTAGATATATTAAATTTTTCTTTAGCA 509


>cbil|dbest|1366888 AA661382 MBAFCW3D03T3 5' Lib=531[Brugia_malayi|||||adult]
            Length=304
            Length = 304

  Plus Strand HSPs:

 Score = 174 (26.1 bits), Expect = 1.5, P = 0.79
 Identities = 116/186 (62%), Positives = 116/186 (62%), Strand = Plus / Plus

Query:   227 AAAGGCAAATTCC-GTTC-ACGTGGACT-CGGTA-GACACGGTATCGTGTCATCAGA-AT 281
             AAAG    ATTC  GTTC A  T   CT C GTA GA AC GTAT G  T AT  GA AT
Sbjct:     2 AAAGTTTCATTCAAGTTCTAAATTCTCTACAGTACGAAACAGTAT-GA-TAATACGATAT 59

Query:   282 C-TAC-ATATTATGTA-ATTGAAGGCAAAT-TCGATAGATATGGTCGAAAGAGACCTACT 337
               TA  ATAT AT  A A  GAAGGCAAAT T   T  A AT G CG A   G    A T
Sbjct:    60 GATATGATATGATAAACAAGGAAGGCAAATATATGTCCA-ATTG-CGCACACGTTGAAAT 117

Query:   338 AACTCGAAATTCAAA-ACTCGTGGAAAAGAGAAAAAATATT-CTAAAAAAATTGTTGATA 395
             AA  C  AAT CAAA A T  TGGAAA   GAAA A T T  C AAAAAAA  G  GA A
Sbjct:   118 AAGACATAATGCAAATAGTTCTGGAAATCGGAAACACTTTGACAAAAAAAAACG--GAAA 175

Query:   396 ATCAATTCGATA 407
             ATCAATTCGA A
Sbjct:   176 ATCAATTCGAAA 187


>cbil|dbest|86081 T36048 EST96109 3'-end Lib=235[Homo_sapiens|testis||||]
            Length=230 Author_cmt: None.
            Length = 230

  Plus Strand HSPs:

 Score = 166 (24.9 bits), Expect = 2.4, P = 0.91
 Identities = 98/159 (61%), Positives = 98/159 (61%), Strand = Plus / Plus

Query:   485 CAAGTTGGAGCTGAACATCATGCTTCTTTGAATACAAGAGCAAATAATAG-CGAAAGCAA 543
             C AGT  G GCTGA   TC T   TCTTT A   C A AG  AA AAT G  G AA  AA
Sbjct:    37 CTAGTGAG-GCTGAGT-TCTTAAATCTTTCACCCCCA-AGTTAAAAATTGGNGCAACAAA 93

Query:   544 ACATTCACAAAAG-AACA-AGCAATTTGATTTTAATCTTAACAATA-ACGTAACCATTAA 600
             ACA   AC   AG AA   A  AAT  GAT TTAA  T  A A TA AC   ACCA  AA
Sbjct:    94 ACAAA-ACTCCAGCAAGGCATAAATAAGATATTAAAGTGCATA-TATACAATACCAG-AA 150

Query:   601 AAGGTTAGATTTGCGACAGCAAAAATAAACCATTTCAAGAATT 643
             AAG TTAGATT G  ACAGCAAAAAT   C A T CAA AA T
Sbjct:   151 AAGTTTAGATTGGGAACAGCAAAAATTT-CTAGTGCAAAAACT 192


>cbil|dbest|1733923 AA996288 os19a12.s1 3'
            Lib=1046[Homo_sapiens|kidney|2_pooled_tumors_(clear_cell_type)|||]
            Length=170 Author_cmt: gb:M20560 ANNEXIN III (HUMAN);
            Length = 170

  Minus Strand HSPs:

 Score = 167 (25.1 bits), Expect = 2.9, P = 0.95
 Identities = 95/148 (64%), Positives = 95/148 (64%), Strand = Minus / Plus

Query:   699 TTAACATGAAAATCGATATTACGTTTATTATAGTCTA-AT-AGAAATTATATTC-CTAAA 643
             TTAA A  A   TC AT TT C TTTATTAT  TCTA AT A AAATTATATTC CTAAA
Sbjct:    16 TTAATACCATTTTCAAT-TT-CATTTATTATCTTCTACATTATAAATTATATTCTCTAAA 73

Query:   642 ATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTAATGGTTACGTTATTG 583
             AT  T  A  T  TTT TTTTT  T T   AAAT  AAC  TT AA   TT C TT TT 
Sbjct:    74 ATAATA-ATCTCTTTTTTTTTTTTTTTT--AAAT--AACAATTAAAA--TTCC-TT-TTA 124

Query:   582 TTAAGATTAAAATCAAATTGCTTGTTCTTTT 552
             TTAA A  A   TC   TT   T TTCTTTT
Sbjct:   125 TTAACACAATTTTCTTTTTATATTTTCTTTT 155


>cbil|dbest|1746332 C94201 C94201 
            Lib=945[Dictyostelium_discoideum|||||slug] Length=536
            Length = 536

  Minus Strand HSPs:

 Score = 202 (30.3 bits), Expect = 3.9, P = 0.98
 Identities = 190/329 (57%), Positives = 190/329 (57%), Strand = Minus / Plus

Query:   653 ATATTCCTAAAATTCTTGAAATGGTTTATTTTTGCTGTCGCAAATCTAACCTTTTA-ATG 595
             A ATTC T   ATT T  AA T  T  A TT  GCTGT  CAAAT  AA  T  TA ATG
Sbjct:   141 AAATTCATCCGATTGTACAATTAATGGAATTG-GCTGTT-CAAATTCAAA-TGGTAGATG 197

Query:   594 GTTACGTTATTGTTAAGATTAAAATCAAATTGCTTGTTC-TTTTGTGAAT-GTTT-GCTT 538
              T A  TTA   T AA A  AA  TCAA  TG  T   C TTTT TG A  GTTT GC  
Sbjct:   198 -TAAT-TTACAATCAA-AGCAATGTCAATGTGAATTACCATTTTATGGACAGTTTTGCCA 254

Query:   537 TCGCTATT-ATTTGCTCTTGTATTCAAAGAAGCATGATGTTCAGCTCCAACTTGGATATA 479
                C AT  A TT C CTTGT  TCAAAGA G  T AT TT A  T CAACTTG   A A
Sbjct:   255 ATACAATAGAATT-C-CTTGTGGTCAAAGATGTTT-ATTTTTAAATTCAACTTGTGGA-A 310

Query:   478 AGCATGAGTACCATTCGCTTG-ATAATCACCAGTTCGTTTATATTTACGTTCTTCAATTA 420
               C T    A  ATT    TG AT AT   CA  T  TT A     AC TT  T A TT 
Sbjct:   311 TTCCTTCTAATAATTTTAATGTATCATTTACATGTA-TTGAACCAAACATTGGTGATTTT 369

Query:   419 AACCACCTTGAATATCGAA--TTGATTATCAACAATTTTTTTAGAAT-ATTTTTTCTCTT 363
                CA  T  AAT TC AA  TT A TA CAACAATTTTT TA AAT ATT TTT T  T
Sbjct:   370 T--CAAATC-AATCTCCAAAATTAAATAACAACAATTTTTATA-AATCATTATTTATAAT 425

Query:   362 TTCCACGAGTTTTGAATTTCGAGTTAGTAGGTCTCTTT 325
              T     A TTTT A TTTC A TTA TA  T T TTT
Sbjct:   426 ATTTTT-ATTTTTTA-TTTCAATTTAATAAATATTTTT 461


>cbil|dbest|1687166 C92038 C92038 
            Lib=945[Dictyostelium_discoideum|||||slug] Length=356
            Length = 356

  Minus Strand HSPs:

 Score = 188 (28.2 bits), Expect = 4.3, P = 0.99
 Identities = 174/299 (58%), Positives = 174/299 (58%), Strand = Minus / Plus

Query:   623 TTTGCTGTCGCAAATCTAACCTTTTA-ATGGTTACGTTATTGTTAAGATTAAAATCAAAT 565
             TT GCTGT  CAAAT  AA  T  TA ATG T A  TTA   T AA A  AA  TCAA  
Sbjct:     8 TTGGCTGTT-CAAATTCAAA-TGGTAGATG-TAAT-TTACAATCAA-AGCAATGTCAATG 62

Query:   564 TGCTTGTTC-TTTTGTGAAT-GTTT-GCTTTCGCTATT-ATTTGCTCTTGTATTCAAAGA 509
             TG  T   C TTTT TG A  GTTT GC     C AT  A TT C CTTGT  TCAAAGA
Sbjct:    63 TGAATTACCATTTTATGGACAGTTTTGCCAATACAATAGAATT-C-CTTGTGGTCAAAGA 120

Query:   508 AGCATGATGTTCAGCTCCAACTTGGATATAAGCATGAGTACCATTCGCTTG-ATAATCAC 450
              G  T AT TT A  T CAACTTG   A A  C T    A   TT    TG AT AT   
Sbjct:   121 TGTTT-ATTTTTAAATTCAACTTGTGGA-ATTCCTTCTAATNNTTTTAATGTATCATTTA 178

Query:   449 CAGTTCGTTTATATTTACGTTCTTCAATTAAACCACCTTGAATATCGAA--TTGATTATC 392
             CA  T  TT A     AC TT  T A TT    CA  T  AAT TC AA  TT A TA C
Sbjct:   179 CATGTA-TTGAACCAAACATTGGTGATTTTT--CAAATC-AATCTCCAAAATTAAATAAC 234

Query:   391 AACAATTTTTTTAGAAT-ATTTTTTCTCTTTTCCACGAGTTTTGAATTTCGAGTTAGTAG 333
             AACAATTTTT TA AAT ATT TTT T  T T     A TTTT A TTTC A TTA TA 
Sbjct:   235 AACAATTTTTATA-AATCATTATTTATAATATTTTT-ATTTTTTA-TTTCAATTTAATAA 291

Query:   332 GTCTCTTT 325
              T T TTT
Sbjct:   292 ATATTTTT 299


>cbil|dbest|1207400 AA557019 861  Lib=958[Pinus_taeda||Xylem|||]
            Length=653
            Length = 653

  Minus Strand HSPs:

 Score = 201 (30.2 bits), Expect = 5.8, P = 1.0
 Identities = 211/339 (62%), Positives = 211/339 (62%), Strand = Minus / Plus

Query:   557 TCTTTTGTGAATGTT-TGCTTTCGCTATTATTTGCTCTTGTATTCAAAGAAGCATGA-TG 500
             TCTTT GT  A GTT TG TTT   T TTATTT    TT T TT  AA A GCAT A T 
Sbjct:   144 TCTTTGGTCCA-GTTGTGTTTTAT-TGTTATTTTAAATT-TGTTTTAATATGCATAAATA 200

Query:   499 --TTCA-GCTCCAAC--TTGGATATAAGCATGAGTACCA-TTCGCTTGATAATCACCAGT 446
               TT A GCT  AA   TTG ATA AA   T A   C A TT G  TGAT  T A    T
Sbjct:   201 AATTTACGCTAAAAAAATTGTATAGAATTCTCAAATCAAATTTG--TGATT-TGAATTTT 257

Query:   445 TCGTTTATATTTACGT-TCTTCAATTAAACCACCTTGAATATCGAATTGATTAT--CAAC 389
             T  TTT TATTT CGT T TTCAATTA A C C T  AAT  C AATT AT AT  CAAC
Sbjct:   258 TTTTTTTTATTT-CGTATTTTCAATTATAACTCATACAAT--CAAATTTATAATTTCAAC 314

Query:   388 AATTTTTTTAGAATATTTTTTCTCTTTTCCACGAGTTT-TGAA-TT--T--CGAGTTAGT 335
             AATTTTTTT  A T TTT  T TCT   CC   A TTT T AA TT  T  CGA T AG 
Sbjct:   315 AATTTTTTTTCA-TGTTTCATTTCTCCACCCATATTTTATCAAATTATTTTCGATTGAGC 373

Query:   334 AGGTCTCTTTCGACCATATCTATCGAATTTGCCTTCAATTACATAATATG-TAGATTCTG 276
             AG   TCT  C A    A CT TC AAT     T  AATT C  AATAT  TA ATTC  
Sbjct:   374 AGAA-TCTCACAATTCGA-CTTTCTAATCCTAATA-AATT-CTCAATATTATA-ATTCC- 427

Query:   275 ATGACACGATACC-G-TGTCTACCGAGTCCACGTGAACGGAATTTGCCTTTA-GCTTTGA 219
             A  ACA  AT CC G T T TACC AGTC    T A CGG AT     TTTA G TTT A
Sbjct:   428 A--ACAA-ATTCCTGATCTTTACC-AGTCTTTCTCA-CGGGATCAAA-TTTATGATTTCA 481


>cbil|dbest|816899 AA177960 mt06f03.r1 5'
            Lib=553[Mus_musculus||Spleen|||4_weeks] Length=443
            Length = 443

  Plus Strand HSPs:

 Score = 193 (29.0 bits), Expect = 7.3, P = 1.0
 Identities = 137/214 (64%), Positives = 137/214 (64%), Strand = Plus / Plus

Query:   455 TATCAAGCGAA-TGGTACTCATGCT-T-ATATCCA-AGTTGGAGCTGAACATCATGCTTC 510
             T TCA G GA  TG T CTCAT CT T A  TCCA AG  GGA C G A A CATG TT 
Sbjct:   122 TCTCAGGGGATCTGAT-CTCATCCTCTCACCTCCACAG--GGACCAGGA-A-CATGTTTA 176

Query:   511 TTTGAATACAAGAGCAAATA-ATAGCGAAAGCAAACATTCACAAAAGAACAAGCAATTTG 569
             T TG  TACA G G A ATA AT G  AA GCAAACATTCA A AA AA AA  AATT  
Sbjct:   177 TATGG-TACATG-G-ACATACAT-GT-AAGGCAAACATTCATACAATAAAAATAAATTA- 230

Query:   570 ATTTTAATCTTAACAATA-ACGTAACCATTAAAA-GGTTA-GATTTGCGACAGCAAAAAT 626
             A     AT TTAA  AT  A  TAA  ATTAAAA GG  A GAT     ACAG A    T
Sbjct:   231 AGAAACATTTTAAATATGTAATTAA--ATTAAAAAGGGAAAGATAAATCACAGTAGCC-T 287

Query:   627 AAACCATTTC-AAGAATTTTAGGAATATAATTTCTATT-AGACT 668
              AA  A   C AAGAATTTTA  AA AT  T T TA T AGA T
Sbjct:   288 CAATAAGGACTAAGAATTTTACAAAAATCCTATTTAGTCAGAAT 331


>cbil|dbest|397587 D18399 MUSGS01457 3' Lib=375[Mus_musculus|||||] Length=261
            Length = 261

  Plus Strand HSPs:

 Score = 152 (22.8 bits), Expect = 9.7, P = 1.0
 Identities = 80/117 (68%), Positives = 80/117 (68%), Strand = Plus / Plus

Query:   471 CTCATGCTTAT-ATCCAAGT-TGGAGCTGAACATCATGCTTCTTTGAATACA-AGAGCAA 527
             CT ATGC T T A CC  GT TGG GC  A C  CAT CTT T T  ATAC  AGAG AA
Sbjct:     4 CTGATGCCTCTGAACCT-GTGTGG-GC--ATCTGCATTCTTATGTACATACCTAGAG-AA 58

Query:   528 ATAATAGCGAAAGCA-AACATTCACAAAAGAACAAGCAATTTGATTTTAATCTTAACAAT 586
             A AA A C A A CA AAC TT A   AA AA AAG AATTT  TTTTAATCTTAA AA 
Sbjct:    59 A-AACA-C-ACA-CATAACTTTAAATTAATAA-AAGTAATTTACTTTTAATCTTAAAAAA 113

Query:   587 A 587
             A
Sbjct:   114 A 114


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      721       714      10. 123 11 N/A 73   0.025 80
                                                  90   0.023 120
   -1      0      721       714      10. 123 11 N/A 73   0.025 80
                                                  90   0.023 120


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  /usr/local/db/others/blast/dbEST
    Release date:  unknown
    Posted date:  10:29 AM EDT Sep 6, 1998
    Format:  BLAST
  # of letters in database:  680,019,941
  # of sequences in database:  1,803,623
  # of database sequences satisfying E:  33
  No. of states in DFA:  220 (220 KB)
  Total size of DFA:  236 KB (256 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  21.64u 2.25s 23.89t  Elapsed: 00:00:09
  Total cpu time:  21.75u 2.28s 24.03t  Elapsed: 00:00:09
  Start:  Sat Sep 26 06:37:42 1998   End:  Sat Sep 26 06:37:51 1998

Date: 17:16:40 on Mon 18 Dec 117.