blastn_dbest_files/CShisMan2_839_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  CShisMan2_839
        (418 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|1815435 AI067828 EST209512 5'-end Lib=1384[Sch...  1841  5.2e-77   1
A cbil|dbest|1815567 AI067960 EST209649 5'-end Lib=1384[Sch...   822  1.2e-30   1
A cbil|dbest|1801503 AI062095 GH01163.5prime 5prime Lib=136...   420  4.8e-13   1
A cbil|dbest|1071528 AA427220 ve79e08.r1 5' Lib=868[Mus_mus...   414  1.0e-12   1



>cbil|dbest|1815435 AI067828 EST209512 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=372 Author_cmt: Sec23
            protein, isoform A
            Length = 372

  Minus Strand HSPs:

 Score = 1841 (276.2 bits), Expect = 5.2e-77, P = 5.2e-77
 Identities = 371/373 (99%), Positives = 371/373 (99%), Strand = Minus / Plus

Query:   373 ACCTGCTTCTGTATTCAATGCAAATTCACCTCCAGGTGCTCCCAAAGGTGTCTACAATTC 314
             ACCTGCTTCTGTATTCAATGCAAATTCACCTCCAGGTGCTCCCAAAGGTGTCTACAATTC
Sbjct:     1 ACCTGCTTCTGTATTCAATGCAAATTCACCTCCAGGTGCTCCCAAAGGTGTCTACAATTC 60

Query:   313 TGAAAAGCAATTTCAACAACCACAAATGGCTCAATTGCCATGCAATATGATTTATTCAAC 254
             TGAAAAGCAATTTCAACAACCACAAATGGCTCAATTGCCAT CAATA GATTTATTCAAC
Sbjct:    61 TGAAAAGCAATTTCAACAACCACAAATGGCTCAATTGCCATACAATA-GATTTATTCAAC 119

Query:   253 CAATGGAACGGTGTGATGCTTTAATCACTGATTTACTTACTGAATTACAACCAGATCCTT 194
             CAATGGAACGGTGTGATGCTTTAATCACTGATTTACTTACTGAATTACAACCAGATCCTT
Sbjct:   120 CAATGGAACGGTGTGATGCTTTAATCACTGATTTACTTACTGAATTACAACCAGATCCTT 179

Query:   193 GGCCTGTACCTCAAGGTAAACGTCCTTTACGTTCAGTTGGTACAGCATTAAGTATTGCAG 134
             GGCCTGTACCTCAAGGTAAACGTCCTTTACGTTCAGTTGGTACAGCATTAAGTATTGCAG
Sbjct:   180 GGCCTGTACCTCAAGGTAAACGTCCTTTACGTTCAGTTGGTACAGCATTAAGTATTGCAG 239

Query:   133 TTGGTTTATTAGAAGCTGCTTATCCTAATACTGGAGCTAGAGTTATGTTATTTCTTGGTG 74
             TTGGTTTATTAGAAGCTGCTTATCCTAATACTGGAGCTAGAGTTATGTTATTTCTTGGTG
Sbjct:   240 TTGGTTTATTAGAAGCTGCTTATCCTAATACTGGAGCTAGAGTTATGTTATTTCTTGGTG 299

Query:    73 GTCCATGTACTCAAGGTCCTGGTATGGTAGTTGATGATGATTTAAAAAATATTATACGTT 14
             GTCCATGTACTCAAGGTCCTGGTATGGTAGTTGATGATGATTTAAAAAATATTATACGTT
Sbjct:   300 GTCCATGTACTCAAGGTCCTGGTATGGTAGTTGATGATGATTTAAAAAATATTATACGTT 359

Query:    13 CACATCATGATAT 1
             CACATCATGATAT
Sbjct:   360 CACATCATGATAT 372


>cbil|dbest|1815567 AI067960 EST209649 5'-end
            Lib=1384[Schistosoma_mansoni|||||] Length=170
            Length = 170

  Minus Strand HSPs:

 Score = 822 (123.3 bits), Expect = 1.2e-30, P = 1.2e-30
 Identities = 168/171 (98%), Positives = 168/171 (98%), Strand = Minus / Plus

Query:   418 GGTTATGTTAAGTGTTGGTCGTAGTTCAGTTACAAATGCTAATCAACCTGCTTCTGTATT 359
             GGTTATGTTAAGTGTTGGTCGTAGTTCAGTTACAAATGCTAATCAACCTGCTTC GTATT
Sbjct:     1 GGTTATGTTAAGTGTTGGTCGTAGTTCAGTTACAAATGCTAATCAACCTGCTTCAGTATT 60

Query:   358 CAATGCAAATTCACCTCCAGGTGCTCCCAAAGGTGTCTACAATTCTGAAAAGCAATTTCA 299
             CAATGCAAATTCACCTCCAGGTGCTCCCAAAGGTGTCTACAATTC GAAAAGCAATTTCA
Sbjct:    61 CAATGCAAATTCACCTCCAGGTGCTCCCAAAGGTGTCTACAATTCGGAAAAGCAATTTCA 120

Query:   298 ACAACCACAAATGGCTCAATTGCCATGCAATATGATTTATTCAACCAATGG 248
             ACAACCACAAATGGCTCAATTGCCATGCAATATG TTTATTCAACCAATGG
Sbjct:   121 ACAACCACAAATGGCTCAATTGCCATGCAATATG-TTTATTCAACCAATGG 170


>cbil|dbest|1801503 AI062095 GH01163.5prime 5prime
            Lib=1366[Drosophila_melanogaster|head||||adult] Length=606
            Length = 606

  Minus Strand HSPs:

 Score = 420 (63.0 bits), Expect = 4.8e-13, P = 4.8e-13
 Identities = 166/263 (63%), Positives = 166/263 (63%), Strand = Minus / Plus

Query:   262 TTATT-CAACCAATGGAACGGTGTGATGCTTTAATCACTGATTTACTTACTGAATTACAA 204
             TT TT CAACC AT G  C GTG GA GC     T    GAT T CTTA  GA TT CAA
Sbjct:   134 TTCTTGCAACCGATCGGCCAGTGCGACGCGGCGCTGGGCGATCTGCTTAGCGAGTTGCAA 193

Query:   203 CCAGATCCTTGGCCTGTACCTCAAGGTAAACGTCCTTTACGTTCAGTTGGTACAGCATTA 144
             C  GATCCTTGGCC GT CC CA GG AA CGT    T CG TC   TGGT C GC  TA
Sbjct:   194 CGCGATCCTTGGCCGGTGCCGCAGGGCAAGCGTTACCTGCGCTCCACTGGTGCCGCCCTA 253

Query:   143 AGTATTGCAGTTGGTTTATTAGAA-GCTGCTTATCCTAATACTGGAGCTAGAGTTATGTT 85
               TATTGC GT GG  T TT GA  GC  CTTATCC AATAC GG G T G  TTATG  
Sbjct:   254 TCTATTGCGGTGGGCCTGTTGGAGTGCA-CTTATCCCAATACGGGCGGTCGCATTATGAC 312

Query:    84 ATTTCTTGGTGGTCCATGTACTCAAGGTCCTGGTATGGTAGTTGATGATGATTTAAAAAA 25
              TT  T GGTGG CC TG  C CA GG CC GG   GGT GT GA GA GA  T AA  A
Sbjct:   313 CTTCGTGGGTGGCCCTTGCTCCCAGGGCCCCGGCCAGGTGGTCGACGACGAGCTGAAGCA 372

Query:    24 TATTATACGTTCACATCATGATAT 1
                 AT CGTTC CATCA GA AT
Sbjct:   373 CCCGATTCGTTCGCATCACGACAT 396


>cbil|dbest|1071528 AA427220 ve79e08.r1 5'
            Lib=868[Mus_musculus|mammary_gland|mammary_gland|||4_weeks]
            Length=543 Author_cmt: TR:E236014 E236014 SEC23 PROTEIN. ;
            Length = 543

  Minus Strand HSPs:

 Score = 414 (62.1 bits), Expect = 1.0e-12, P = 1.0e-12
 Identities = 184/297 (61%), Positives = 184/297 (61%), Strand = Minus / Plus

Query:   297 CAACCACAAATGGCTCAATTGCCATGCAATATGATTTATTCAACCAATGGA-ACGGTGTG 239
             CAACC CA   G   C  TT    T CA  A GATTT T CA CC AT  A A G T TG
Sbjct:    24 CAACCTCAGGAGCAGCCTTTTGTTTCCAGCA-GATTTCTACAGCCCATTCACAAGAT-TG 81

Query:   238 ATGCTTTAA--TCACTGATTTACTTACTGAATTACAACCAGATCCTTGGCCTGTACCTCA 181
             A  C T AA  TCAC GAT T CT    GA  T CA    GA CC TGGCC GTA CTCA
Sbjct:    82 A--CATGAACCTCACAGATCTTCTCGGGGAGCTGCAGAGGGACCCATGGCCAGTAACTCA 139

Query:   180 AGGTAAACGTCCTTTACGTTCAGTTGGTACAGCATTAAGTATTGCAGTTGGTTTATTAGA 121
              GG AA  G CC  T CG TC   TGGT   GC TT    ATTGC GTTGG TT TT GA
Sbjct:   140 GGGGAAGAGACCACTGCGGTCCACTGGTGTTGCTTTGTCCATTGCTGTTGGCTTGTTGGA 199

Query:   120 AGCTGCTTATCCTAATACTGGAGCTAGAGTTATGTTATTTCTTGGTGGTCCATGTACTCA 61
              G   CTT  CC AATACTGGAGC AG  T ATG T TT   TGG GG CC    AC CA
Sbjct:   200 GGGGACTTTCCCAAATACTGGAGCCAGGATCATGCTGTTCACTGGCGGGCCCCCGACCCA 259

Query:    60 AGGTCCTGGTATGGTAGTTGATGATGATTTAAAAAATATTATACGTTCACATCATGATAT 1
             AGG CCTGG ATGGT GTTG  GATGA TT AA A T  TAT CGTTC    CA GA AT
Sbjct:   260 AGGACCTGGCATGGTGGTTGGAGATGAGTTGAAGACTCCTATTCGTTCCTGGCACGACAT 319


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      418       418      10. 120 11 N/A 73   0.025 77
                                                  85   0.024 112
   -1      0      418       418      10. 120 11 N/A 73   0.025 77
                                                  85   0.024 112


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  /usr/local/db/others/blast/dbEST
    Release date:  unknown
    Posted date:  10:29 AM EDT Sep 6, 1998
    Format:  BLAST
  # of letters in database:  680,019,941
  # of sequences in database:  1,803,623
  # of database sequences satisfying E:  4
  No. of states in DFA:  209 (209 KB)
  Total size of DFA:  219 KB (256 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  19.21u 1.79s 21.00t  Elapsed: 00:00:04
  Total cpu time:  19.24u 2.36s 21.60t  Elapsed: 00:00:04
  Start:  Sat Sep 26 09:47:12 1998   End:  Sat Sep 26 09:47:16 1998

Date: 16:24:22 on Sun 17 Dec 117.