blastn_dbest_files/CShisMan2_881_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  CShisMan2_881
        (367 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|343537 R95211 SMNHADA002006SK 5' Lib=323[Schi...  1747  9.2e-73   1
A cbil|dbest|1158765 AA514086 MC2NE018.ACS 5' Lib=911[Schis...   915  6.9e-35   1
A cbil|dbest|816172 AA177164 JM00M092.QM3 5' Lib=554[Schis...   526  1.1e-17   1
A cbil|dbest|1208669 AA558288 nl54b07.s1  Lib=934[...   156  0.76      1
A cbil|dbest|162347 T92226 ye17e11.r1 5' Lib=249[Homo_sapi...   146  0.990     1



>cbil|dbest|343537 R95211 SMNHADA002006SK 5' Lib=323[Schistosoma_mansoni|||||]
            Length=367
            Length = 367

  Plus Strand HSPs:

 Score = 1747 (262.1 bits), Expect = 9.2e-73, P = 9.2e-73
 Identities = 355/367 (96%), Positives = 355/367 (96%), Strand = Plus / Plus

Query:     1 GTCCATNTGAGCCTCATTACACTAAGATAGAGNAATTTNGATATTTCACCAAATCGTCAA 60
             |||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct:     1 GTCCATNTGAGCCTCATTACACTAAGATAGAGNAATTTNGATATTTCACCAAATCGTCAA 60

Query:    61 ATCAAAGTACCTATGATGATGAAAGAAGAAGTATTGCATTATGGAAAATTCGAAAATCAA 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 ATCAAAGTACCTATGATGATGAAAGAAGAAGTATTGCATTATGGAAAATTCGAAAATCAA 120

Query:   121 GGATTTGAAATCGTCAGTAAACCATTAAATAACACACGTTTCACATTTGTTGTCGTATTA 180
             ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct:   121 GGATTTGAAATCGTCAGTAAACCATTANATAACACACGTNTCACATTTGTTGTCGTATTA 180

Query:   181 CCTCTTGAAAAATGGTCTCTAACGGGGGCCATGGAACTTTTGAATGGGAATAAAATTCTA 240
             ||||||||||||||||||||||| || |||||||||||  ||| ||||||||||||||||
Sbjct:   181 CCTCTTGAAAAATGGTCTCTAACTGGTGCCATGGAACTNNTGANTGGGAATAAAATTCTA 240

Query:   241 AGTGAATACATAAAGAAATTAAAAGAAACTACAGNATCATTAAGATTACCAAAATTTACA 300
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct:   241 AGTGAATACATAAAGAAATTAAAAGAAACTACAGNATCATTAAGATTACCAAAATTTACA 300

Query:   301 TGGACAACTACACTTGATCTTGTGCAAACATCGACATCTATGGGTATTGNCGATTTGTCT 360
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct:   301 TGGACAACTACACTTGATCTTGTGCAAACATCGACATCTATGGGTATTGNCGATTTGTCT 360

Query:   361 ACTCCAG 367
             |||||||
Sbjct:   361 ACTCCAG 367


>cbil|dbest|1158765 AA514086 MC2NE018.ACS 5'
            Lib=911[Schistosoma_mansoni|||||cercarial] Length=185
            Length = 185

  Plus Strand HSPs:

 Score = 915 (137.3 bits), Expect = 6.9e-35, P = 6.9e-35
 Identities = 183/183 (100%), Positives = 183/183 (100%), Strand = Plus / Plus

Query:    88 GAAGTATTGCATTATGGAAAATTCGAAAATCAAGGATTTGAAATCGTCAGTAAACCATTA 147
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 GAAGTATTGCATTATGGAAAATTCGAAAATCAAGGATTTGAAATCGTCAGTAAACCATTA 60

Query:   148 AATAACACACGTTTCACATTTGTTGTCGTATTACCTCTTGAAAAATGGTCTCTAACGGGG 207
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AATAACACACGTTTCACATTTGTTGTCGTATTACCTCTTGAAAAATGGTCTCTAACGGGG 120

Query:   208 GCCATGGAACTTTTGAATGGGAATAAAATTCTAAGTGAATACATAAAGAAATTAAAAGAA 267
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 GCCATGGAACTTTTGAATGGGAATAAAATTCTAAGTGAATACATAAAGAAATTAAAAGAA 180

Query:   268 ACT 270
             |||
Sbjct:   181 ACT 183


>cbil|dbest|816172 AA177164 JM00M092.QM3 5'
            Lib=554[Schistosoma_japonicum||Whole_organism|||Miracidium]
            Length=437 Author_cmt: Serpin (SPI) mRNA
            Length = 437

  Plus Strand HSPs:

 Score = 526 (78.9 bits), Expect = 1.1e-17, P = 1.1e-17
 Identities = 170/239 (71%), Positives = 170/239 (71%), Strand = Plus / Plus

Query:     2 TCCATNTGAGCCTCATTACACTAAGAT-AGAGNAATTTNGATATTTCACCAAATCGTCAA 60
             TCCAT TG  CC  ATTA AC AAG T AGA  A TTT G T T  CA   AATC TCA 
Sbjct:   200 TCCATTTGTACCGTATTATAC-AAGTTTAGAAAATTTTAG-TGTAACAAATAATCATCAT 257

Query:    61 ATCAAAGTACCTATGATGATGAAAGAAGAAGTATTGCATTATGGAAAATT-CGAAAATCA 119
              T  AAGT CCTATGATG   AAAGA GAA TATT  A TAT  AAAATT C A AA  A
Sbjct:   258 CTTCAAGTTCCTATGATGTCAAAAGATGAAATATTAAAGTATAAAAAATTTCCAGAAG-A 316

Query:   120 AGGATTTGAAATCGTCAGTAAACCATTAAATAACACACGTTTCAC-ATTTGTTGTCGTAT 178
              GGATTTGAAAT GTCAGTAAACCA T AA AA ACACGTTT  C ATTT TT TC TAT
Sbjct:   317 TGGATTTGAAATTGTCAGTAAACCAATGAAGAATACACGTTTTTCCATTTATTATCTTAT 376

Query:   179 TACCTCTTGAAAAATGGTCTCTAACGGGGGCCATGGAACTTTTGAATGGGAATAAAATTC 238
             TACC  T GA AAATGG  T TAA  GG GC AT GAA T TT AATGG A TAAAAT  
Sbjct:   377 TACCATTGGAGAAATGGAATTTAAATGGTGCTATTGAAGTATTAAATGGCA-TAAAATAT 435

Query:   239 TA 240
             TA
Sbjct:   436 TA 437


>cbil|dbest|1208669 AA558288 nl54b07.s1 
            Lib=934[Homo_sapiens|prostate|prostatic_intraepithelial_neoplasia_-
            _high_grade|||adult] Length=234
            Length = 234

  Plus Strand HSPs:

 Score = 156 (23.4 bits), Expect = 1.4, P = 0.76
 Identities = 82/128 (64%), Positives = 82/128 (64%), Strand = Plus / Plus

Query:   225 TGGGAATAAAATT-CTA-AGTGAATACATAAAGAAATTAAAAGAAACTACAGNATCATTA 282
             TGG AA AA ATT CT  A TG  TACATAAAGAAATT A  GAAA T     AT  TT 
Sbjct:    76 TGGTAACAACATTTCTTCAATGT-TACATAAAGAAATTGAGGGAAATTTTGCAATACTTG 134

Query:   283 AGATTACCAAAATTTA-CATGGACAACTA--CACTTG-ATCTTGTGCAAACATCGACATC 338
              G TTACC    TTTA C TGGACA   A  CACT G AT T   GC  AC T G CA C
Sbjct:   135 GGGTTACCTT--TTTATCTTGGACAGTGATCCACTAGTATATCAGGCTGACCTAGTCAAC 192

Query:   339 TA-TGGGTATT 348
             T  TGG TATT
Sbjct:   193 TGGTGGCTATT 203


>cbil|dbest|162347 T92226 ye17e11.r1 5' Lib=249[Homo_sapiens|lung||||72_years]
            Length=245
            Length = 245

  Plus Strand HSPs:

 Score = 146 (21.9 bits), Expect = 4.6, P = 0.99
 Identities = 54/80 (67%), Positives = 54/80 (67%), Strand = Plus / Plus

Query:   212 TGGAACTTTTG-AATGGGAATAAAATTCTAAGTGAATACATAAAGAAATTAAAAGAAACT 270
             TGGA  TTTTG AA G  AATA AA    AA T A TA A AAAGAAATTAA A AA C 
Sbjct:    28 TGGATGTTTTGGAAAGTTAATATAAAAGAAAATTA-TATAAAAAGAAATTAAGACAACCA 86

Query:   271 ACAGNATCATTAAGAT-TACC 290
             A AG A CAT  A AT TACC
Sbjct:    87 AGAGAAACATGGACATATACC 107


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      367       362      10. 119 11 N/A 73   0.021 77
                                                  83   0.023 110
   -1      0      367       362      10. 119 11 N/A 73   0.021 77
                                                  83   0.023 110


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  /usr/local/db/others/blast/dbEST
    Release date:  unknown
    Posted date:  10:29 AM EDT Sep 6, 1998
    Format:  BLAST
  # of letters in database:  680,019,941
  # of sequences in database:  1,803,623
  # of database sequences satisfying E:  5
  No. of states in DFA:  200 (200 KB)
  Total size of DFA:  208 KB (256 KB)
  Time to generate neighborhood:  0.00u 0.01s 0.01t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  19.02u 2.03s 21.05t  Elapsed: 00:00:04
  Total cpu time:  19.03u 3.81s 22.84t  Elapsed: 00:00:06
  Start:  Sat Sep 26 11:15:54 1998   End:  Sat Sep 26 11:16:00 1998

Date: 17:12:18 on Mon 18 Dec 117.