blastn_dbest_files/CcruzaQ_1768_blastn.Z


BLASTN 2.0a10MP-WashU [15-May-1997] [Build 16:56:41 May 19 1997]

Reference:  Gish, Warren (1994-1997).  unpublished.
Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J.
Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  CcruzaQ_1768
        (522 letters)

Database:  /usr/local/db/others/blast/dbEST
           1,803,623 sequences; 680,019,941 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

A cbil|dbest|1792845 AI053302 TENU1732 3' Lib=1138[Trypanos...  1739  2.2e-72   1
A cbil|dbest|1745970 AI007401 TENU0421 3' Lib=854[Trypanoso...  1583  2.7e-65   1
A cbil|dbest|130051 T69131 yc32c05.s1 3' Lib=252[Homo_sapi...   390  1.1e-11   1
A cbil|dbest|1698109 AA961754 or60d11.s1 3' Lib=1049[Homo_s...   387  1.3e-11   1
A cbil|dbest|830703 AA191632 zp63g12.s1 3' Lib=523[Homo_sa...   380  3.0e-11   1
A cbil|dbest|1503045 AA781370 aj25d11.s1 3' Lib=628[Homo_sa...   379  3.3e-11   1
A cbil|dbest|765009 AA126843 zn87f11.r1 5' Lib=537[Homo_sa...   372  6.4e-11   1
A cbil|dbest|1224241 AA573841 nk08c06.s1 3' Lib=937[Homo_sa...   372  6.9e-11   1
A cbil|dbest|820089 AA182044 zp65g12.s1 3' Lib=523[Homo_sa...   372  7.0e-11   1
A cbil|dbest|1203053 AA552685 nk15e04.s1 3' Lib=937[Homo_sa...   372  7.0e-11   1
A cbil|dbest|1172718 AA528078 nh90a12.s1 3' Lib=894[Homo_sa...   372  7.2e-11   1
A cbil|dbest|786422 AA147872 zo47h12.s1 3' Lib=523[Homo_sa...   371  7.3e-11   1
A cbil|dbest|949170 AA307700 EST178716 5'-end Lib=840[Homo...   372  7.6e-11   1
A cbil|dbest|1132173 AA486598 ab18c10.r1 5' Lib=249[Homo_sa...   372  7.6e-11   1
A cbil|dbest|1324164 AA626420 ab49d12.r1 5' Lib=537[Homo_sa...   372  7.8e-11   1
A cbil|dbest|1131353 AA488511 ab39c11.r1 5' Lib=527[Homo_sa...   372  7.8e-11   1
A cbil|dbest|771286 AA131423 zo08a03.r1 5' Lib=524[Homo_sa...   372  7.9e-11   1
A cbil|dbest|955581 AA314272 EST186116 5'-end Lib=842[Homo...   372  7.9e-11   1
A cbil|dbest|953819 AA312510 EST183177 5'-end Lib=719[Homo...   373  8.0e-11   1
A cbil|dbest|1128469 AA483724 ne75h07.s1  Lib=883[...   372  8.3e-11   1
A cbil|dbest|1854320 AI095933 qb26f02.x1 3' Lib=474[Homo_sa...   372  8.4e-11   1
A cbil|dbest|794411 AA155677 zo49g03.s1 3' Lib=523[Homo_sa...   370  8.6e-11   1
A cbil|dbest|1668232 AA935507 on20e11.s1 3' Lib=1076[Homo_s...   372  8.7e-11   1
A cbil|dbest|830705 AA191634 zp63h12.s1 3' Lib=523[Homo_sa...   366  1.3e-10   1
A cbil|dbest|826199 AA188007 zp68g03.s1 3' Lib=523[Homo_sa...   366  1.3e-10   1
A cbil|dbest|1755947 AI016790 ov31c04.x1 3' Lib=628[Homo_sa...   363  1.6e-10   1
A cbil|dbest|949005 AA307477 EST178563 5'-end Lib=840[Homo...   365  1.6e-10   1
A cbil|dbest|804192 AA165542 zo81b06.r1 5' Lib=510[Homo_sa...   365  1.6e-10   1
A cbil|dbest|739655 AA101162 zn42g02.s1 3' Lib=523[Homo_sa...   364  1.7e-10   1
A cbil|dbest|949846 AA308538 EST179358 5'-end Lib=841[Homo...   365  1.7e-10   1
A cbil|dbest|952788 AA311324 EST182218 5'-end Lib=711[Homo...   363  1.9e-10   1
A cbil|dbest|1766364 AI027466 ow06c08.x1 3' Lib=417[Homo_sa...   361  2.3e-10   1
A cbil|dbest|764957 AA126791 zn87f11.s1 3' Lib=537[Homo_sa...   359  2.4e-10   1
A cbil|dbest|845214 AA207193 zq73g05.r1 5' Lib=502[Homo_sa...   360  2.5e-10   1
A cbil|dbest|1375735 AA670151 ab65b06.s1 3' Lib=537[Homo_sa...   359  2.5e-10   1
A cbil|dbest|1344104 AA640636 nr22c03.r1  Lib=574[...   359  2.7e-10   1
A cbil|dbest|724784 AA088390 zl89d07.s1 3' Lib=486[Homo_sa...   356  3.5e-10   1
A cbil|dbest|794806 AA156260 zo48c01.r1 5' Lib=523[Homo_sa...   357  3.6e-10   1
A cbil|dbest|1346769 AA643333 nr97e05.s1 3' Lib=1017[Homo_s...   356  3.6e-10   1
A cbil|dbest|794326 AA155781 zo49e09.s1 3' Lib=523[Homo_sa...   356  3.6e-10   1
A cbil|dbest|955791 AA314411 EST186318 5'-end Lib=842[Homo...   356  3.9e-10   1
A cbil|dbest|830782 AA191711 zp82e09.s1 3' Lib=527[Homo_sa...   353  4.9e-10   1
A cbil|dbest|1375457 AA669873 ag42c04.s1 3' Lib=931[Homo_sa...   353  5.0e-10   1
A cbil|dbest|958246 AA316938 EST188592 5'-end Lib=841[Homo...   354  5.8e-10   1
A cbil|dbest|794525 AA155979 zo48c01.s1 3' Lib=523[Homo_sa...   349  7.5e-10   1
A cbil|dbest|860265 AA220938 zr01g10.s1 3' Lib=536[Homo_sa...   349  7.8e-10   1
A cbil|dbest|1582992 AA857337 oh97c10.s1 3' Lib=1103[Homo_s...   349  8.4e-10   1
A cbil|dbest|785707 AA147112 zo32g07.r1 5' Lib=486[Homo_sa...   348  8.7e-10   1
A cbil|dbest|130334 T69414 yc38c10.s1 3' Lib=252[Homo_sapi...   349  8.7e-10   1
A cbil|dbest|1560597 AA838041 oe91h03.s1  Lib=988[...   349  8.9e-10   1
A cbil|dbest|279667 H19729 yn60f04.r1 5' Lib=300[Homo_sapi...   350  8.9e-10   1
A cbil|dbest|1232144 AA581711 nn52c07.s1 3' Lib=991[Homo_sa...   347  9.7e-10   1
A cbil|dbest|830221 AA191136 zp86c10.r1 5' Lib=527[Homo_sa...   350  1.0e-09   1
A cbil|dbest|1178691 AA532728 nj21e04.s1 3' Lib=927[Homo_sa...   347  1.1e-09   1
A cbil|dbest|1557737 AA836667 of53b10.s1  Lib=1080...   351  1.1e-09   1
A cbil|dbest|1410384 AA703670 ag77a11.r1 5' Lib=525[Homo_sa...   347  1.1e-09   1
A cbil|dbest|1551083 AA828948 od81d01.s1  Lib=887[...   347  1.1e-09   1
A cbil|dbest|716225 AA081118 zn33h03.s1 3' Lib=523[Homo_sa...   346  1.1e-09   1
A cbil|dbest|1634900 AA906640 ok98h08.s1 3' Lib=1076[Homo_s...   345  1.2e-09   1
A cbil|dbest|1233159 AA581820 nn35e05.s1 3' Lib=990[Homo_sa...   345  1.3e-09   1
A cbil|dbest|826763 AA186536 zp64h07.r1 5' Lib=523[Homo_sa...   346  1.3e-09   1
A cbil|dbest|1347370 AA643934 np42e08.s1 3' Lib=894[Homo_sa...   344  1.4e-09   1
A cbil|dbest|785650 AA147099 zo32g07.s1 3' Lib=486[Homo_sa...   344  1.5e-09   1
A cbil|dbest|1131221 AA488379 ab39c10.s1 3' Lib=527[Homo_sa...   343  1.6e-09   1
A cbil|dbest|1292026 AA599285 ag35b06.s1 3' Lib=931[Homo_sa...   342  1.7e-09   1
A cbil|dbest|1157659 AA513008 nh92f12.s1 3' Lib=894[Homo_sa...   342  1.7e-09   1
A cbil|dbest|1346587 AA643151 nr96c02.s1 3' Lib=1017[Homo_s...   341  1.7e-09   1
A cbil|dbest|433552 N32177 yy25a12.s1 3' Lib=367[Homo_sapi...   341  1.8e-09   1
A cbil|dbest|1131246 AA488404 ab37f11.s1 3' Lib=527[Homo_sa...   341  2.0e-09   1
A cbil|dbest|351513 H50303 yo28b10.r1 5' Lib=300[Homo_sapi...   342  2.4e-09   1
A cbil|dbest|1771374 AI032123 os76b07.s1 3' Lib=939[Homo_sa...   338  2.7e-09   1
A cbil|dbest|1157660 AA513009 nh92g01.s1 3' Lib=894[Homo_sa...   336  3.2e-09   1
A cbil|dbest|820332 AA181295 zp68f08.s1 3' Lib=523[Homo_sa...   336  3.2e-09   1
A cbil|dbest|945180 AA303872 EST16549 5'-end Lib=830[Homo_...   339  3.3e-09   1
A cbil|dbest|1453124 AA738152 nx12a08.s1 3' Lib=1049[Homo_s...   337  3.4e-09   1
A cbil|dbest|947057 AA305673 EST176747 5'-end Lib=838[Homo...   336  4.1e-09   1
A cbil|dbest|1207862 AA557481 nk60g01.s1 3' Lib=941[Homo_sa...   334  4.1e-09   1
A cbil|dbest|1292886 AA600145 ae50d04.s1 3' Lib=537[Homo_sa...   334  4.3e-09   1
A cbil|dbest|1583786 AA858131 oe41g03.s1 3' Lib=1017[Homo_s...   334  4.3e-09   1
A cbil|dbest|1429539 AA722276 ag85c11.r1 5' Lib=525[Homo_sa...   333  4.7e-09   1
A cbil|dbest|1233671 AA583157 nn37b12.s1 3' Lib=990[Homo_sa...   333  4.8e-09   1
A cbil|dbest|948231 AA306921 EST177844 5'-end Lib=719[Homo...   332  5.5e-09   1
A cbil|dbest|1204381 AA554013 nk35e08.s1 3' Lib=938[Homo_sa...   331  5.8e-09   1
A cbil|dbest|1273792 AA595110 no32a07.s1 3' Lib=994[Homo_sa...   331  5.8e-09   1
A cbil|dbest|1640044 AA911985 og21f09.s1 3' Lib=1081[Homo_s...   328  6.9e-09   1
A cbil|dbest|825756 AA187503 zp65g12.r1 5' Lib=523[Homo_sa...   329  7.0e-09   1
A cbil|dbest|1228327 AA580074 nl79h03.s1 3' Lib=895[Homo_sa...   328  7.6e-09   1
A cbil|dbest|1131241 AA488399 ab37f06.s1 3' Lib=527[Homo_sa...   328  7.7e-09   1
A cbil|dbest|1229866 AA578756 nk93e02.s1 3' Lib=938[Homo_sa...   326  9.2e-09   1
A cbil|dbest|947183 AA305873 EST176873 5'-end Lib=719[Homo...   326  9.3e-09   1
A cbil|dbest|1046785 AA405073 zu12f06.r1 5' Lib=628[Homo_sa...   326  9.3e-09   1
A cbil|dbest|954641 AA313332 EST185227 5'-end Lib=840[Homo...   326  1.0e-08   1
A cbil|dbest|958049 AA316720 EST188411 5'-end Lib=841[Homo...   326  1.0e-08   1
A cbil|dbest|1204483 AA554115 nk35g11.s1 3' Lib=938[Homo_sa...   325  1.1e-08   1
A cbil|dbest|115978 T61895 yb93d08.s1 3' Lib=252[Homo_sapi...   325  1.1e-08   1
A cbil|dbest|351401 H50191 yo27b12.r1 5' Lib=300[Homo_sapi...   325  1.2e-08   1
A cbil|dbest|1229761 AA578651 ni48c04.s1 3' Lib=914[Homo_sa...   323  1.2e-08   1
A cbil|dbest|958255 AA316947 EST188600 5'-end Lib=841[Homo...   324  1.4e-08   1
A cbil|dbest|955472 AA314143 EST186011 5'-end Lib=842[Homo...   324  1.4e-08   1
A cbil|dbest|955426 AA314117 EST185967 5'-end Lib=842[Homo...   324  1.4e-08   1
A cbil|dbest|1056758 AA412697 zu12f06.s1 3' Lib=628[Homo_sa...   322  1.4e-08   1
A cbil|dbest|508604 W01619 za36d08.r1 5' Lib=262[Homo_sapi...   323  1.5e-08   1
A cbil|dbest|948474 AA307166 EST178073 5'-end Lib=840[Homo...   323  1.6e-08   1
A cbil|dbest|1583893 AA858238 oe43e10.s1 3' Lib=1017[Homo_s...   320  2.0e-08   1
A cbil|dbest|1167726 AA523107 ni44b07.s1 3' Lib=914[Homo_sa...   318  2.2e-08   1
A cbil|dbest|1226564 AA576164 nm60a03.s1 3' Lib=986[Homo_sa...   319  2.3e-08   1
A cbil|dbest|1327839 AA629565 ad46a12.s1 3' Lib=537[Homo_sa...   318  2.3e-08   1
A cbil|dbest|1421211 AA714498 nw23f06.s1 3' Lib=1051[Homo_s...   318  2.3e-08   1
A cbil|dbest|830109 AA190588 zp86c10.s1 3' Lib=527[Homo_sa...   318  2.3e-08   1
A cbil|dbest|1560253 AA838555 oe39d04.s1  Lib=1017...   318  2.3e-08   1
A cbil|dbest|1233316 AA581977 nn36b01.s1 3' Lib=990[Homo_sa...   317  2.5e-08   1
A cbil|dbest|1721305 AA984846 am93h07.s1 3' Lib=629[Homo_sa...   318  2.5e-08   1
A cbil|dbest|1721303 AA984844 am93h05.s1 3' Lib=629[Homo_sa...   317  2.8e-08   1
A cbil|dbest|826744 AA186644 zp63h12.r1 5' Lib=523[Homo_sa...   316  3.0e-08   1
A cbil|dbest|953030 AA311505 EST182444 5'-end Lib=719[Homo...   316  3.1e-08   1
A cbil|dbest|1847716 AI089246 qb09a05.x1 3' Lib=474[Homo_sa...   315  3.1e-08   1
A cbil|dbest|702166 AA070258 zm69b07.r1 5' Lib=502[Homo_sa...   314  3.8e-08   1
A cbil|dbest|105419 T52137 yb29h08.r1 5' Lib=251[Homo_sapi...   315  4.4e-08   1
A cbil|dbest|321705 R87887 yo47b03.r1 5' Lib=299[Homo_sapi...   313  4.7e-08   1
A cbil|dbest|1326158 AA628414 af26c08.s1 3' Lib=843[Homo_sa...   311  5.1e-08   1
A cbil|dbest|831316 AA192420 zp91b05.s1 3' Lib=527[Homo_sa...   316  5.2e-08   1
A cbil|dbest|105306 T52024 yb29h08.s1 3' Lib=251[Homo_sapi...   310  5.4e-08   1
A cbil|dbest|826737 AA186637 zp63g12.r1 5' Lib=523[Homo_sa...   310  5.6e-08   1
A cbil|dbest|1149892 AA505262 nh82g06.s1 3' Lib=894[Homo_sa...   308  5.9e-08   1
A cbil|dbest|1526118 AA804288 nw31g02.s1 3' Lib=1051[Homo_s...   308  6.3e-08   1
A cbil|dbest|724899 AA088556 zl89d07.r1 5' Lib=486[Homo_sa...   308  6.7e-08   1
A cbil|dbest|1233126 AA581787 nn39e11.s1 3' Lib=990[Homo_sa...   309  6.8e-08   1
A cbil|dbest|1495862 AA774081 ac36a03.s1 3' Lib=525[Homo_sa...   308  6.8e-08   1
A cbil|dbest|789210 AA151947 zo02h07.s1 3' Lib=486[Homo_sa...   306  7.5e-08   1
A cbil|dbest|1328062 AA629788 ad44a01.s1 3' Lib=537[Homo_sa...   308  7.8e-08   1
A cbil|dbest|301278 H40227 yn85f12.r1 5' Lib=300[Homo_sapi...   305  9.4e-08   1
A cbil|dbest|804143 AA165509 zo81b06.s1 3' Lib=510[Homo_sa...   303  9.8e-08   1
A cbil|dbest|1312439 AA614738 np53e07.s1 3' Lib=894[Homo_sa...   303  1.0e-07   1
A cbil|dbest|1698162 AA961807 or41e04.s1 3' Lib=1049[Homo_s...   303  1.1e-07   1
A cbil|dbest|991283 AA349974 EST56963 5'-end Lib=688[Homo_...   304  1.1e-07   1
A cbil|dbest|1202481 AA552113 nk05f09.s1 3' Lib=937[Homo_sa...   302  1.1e-07   1
A cbil|dbest|534327 W26508 30e3  Lib=433[Homo_sap...   304  1.3e-07   1
A cbil|dbest|1198586 AA548546 nk50a06.s1 3' Lib=939[Homo_sa...   300  1.4e-07   1
A cbil|dbest|1583535 AA857880 oh99d09.s1 3' Lib=1103[Homo_s...   301  1.4e-07   1
A cbil|dbest|717400 AA082168 zn42g02.r1 5' Lib=523[Homo_sa...   300  1.7e-07   1
A cbil|dbest|1263770 AA586394 no56g09.s1 3' Lib=995[Homo_sa...   298  1.8e-07   1
A cbil|dbest|1367543 AA661937 nt96e09.s1  Lib=919[...   299  1.8e-07   1
A cbil|dbest|1638259 AA910302 og80d10.s1 3' Lib=1104[Homo_s...   299  1.8e-07   1
A cbil|dbest|836061 AA196975 zq60h01.s1 3' Lib=502[Homo_sa...   298  2.0e-07   1
A cbil|dbest|1843905 AI085525 qf24a08.x1 3' Lib=1331[Homo_s...   298  2.0e-07   1
A cbil|dbest|835605 AA196519 zq59f05.s1 3' Lib=502[Homo_sa...   297  2.0e-07   1
A cbil|dbest|1605695 AA878854 of88a12.s1 3' Lib=1077[Homo_s...   302  2.3e-07   1
A cbil|dbest|1344790 AA641322 nr91a07.s1 3' Lib=1017[Homo_s...   299  2.4e-07   1
A cbil|dbest|857967 AA218635 zq14b05.s1 3' Lib=552[Homo_sa...   294  2.9e-07   1
A cbil|dbest|1604984 AA878143 oi04a08.s1 3' Lib=1103[Homo_s...   294  3.0e-07   1
A cbil|dbest|136150 T73793 yc54a04.s1 3' Lib=252[Homo_sapi...   294  3.0e-07   1
A cbil|dbest|1201323 AA550955 nj35a07.s1 3' Lib=927[Homo_sa...   292  3.7e-07   1
A cbil|dbest|1226683 AA576283 nm60g04.s1 3' Lib=986[Homo_sa...   291  4.1e-07   1
A cbil|dbest|1631998 AA903967 ob16c04.s1 3' Lib=1045[Homo_s...   291  4.1e-07   1
A cbil|dbest|1719887 AA983428 or45f01.s1 3' Lib=1049[Homo_s...   290  4.3e-07   1
A cbil|dbest|815362 AA176371 zp30h04.s1 3' Lib=502[Homo_sa...   291  4.3e-07   1
A cbil|dbest|810080 AA171787 zo97a02.r1 5' Lib=510[Homo_sa...   291  4.5e-07   1
A cbil|dbest|940875 AA299336 EST12090 5'-end Lib=693[Homo_...   291  5.1e-07   1
A cbil|dbest|1658871 AA927108 oi58f02.s1 3' Lib=1103[Homo_s...   288  5.5e-07   1
A cbil|dbest|943165 AA301713 EST14900 5'-end Lib=815[Homo_...   291  5.5e-07   1
A cbil|dbest|818511 AA179515 zp48d12.s1 3' Lib=527[Homo_sa...   288  5.5e-07   1
A cbil|dbest|1345069 AA641633 nr80b12.s1 3' Lib=1016[Homo_s...   288  5.7e-07   1
A cbil|dbest|871920 AA232221 zr25e06.s1 3' Lib=536[Homo_sa...   288  5.7e-07   1
A cbil|dbest|1233498 AA582159 nn44e03.s1 3' Lib=990[Homo_sa...   288  5.7e-07   1
A cbil|dbest|772383 AA132313 zo17g07.s1 3' Lib=486[Homo_sa...   288  5.7e-07   1
A cbil|dbest|1324251 AA626507 ab50d10.r1 5' Lib=537[Homo_sa...   288  5.8e-07   1
A cbil|dbest|1328083 AA629809 ad44c03.s1 3' Lib=537[Homo_sa...   288  5.8e-07   1
A cbil|dbest|1829954 AI075018 oq97g09.x1 3' Lib=988[Homo_sa...   288  5.8e-07   1
A cbil|dbest|827306 AA187031 zp62g07.s1 3' Lib=523[Homo_sa...   288  5.9e-07   1
A cbil|dbest|1232556 AA582535 nn50f10.s1 3' Lib=991[Homo_sa...   288  5.9e-07   1
A cbil|dbest|825535 AA187292 zp60d02.s1 3' Lib=523[Homo_sa...   288  6.0e-07   1
A cbil|dbest|738684 AA100337 zl81h12.s1 3' Lib=486[Homo_sa...   288  6.0e-07   1
A cbil|dbest|820143 AA181106 zp67c09.s1 3' Lib=523[Homo_sa...   288  6.4e-07   1
A cbil|dbest|1409433 AA702813 zi90d01.s1 3' Lib=452[Homo_sa...   287  6.8e-07   1
A cbil|dbest|826547 AA186446 zp70h03.s1 3' Lib=523[Homo_sa...   286  6.8e-07   1
A cbil|dbest|702493 AA070523 zm58a02.r1 5' Lib=494[Homo_sa...   287  7.1e-07   1
A cbil|dbest|772329 AA132462 zo07g12.r1 5' Lib=523[Homo_sa...   287  7.2e-07   1
A cbil|dbest|1430493 AA723160 zg88e02.s1 3' Lib=424[Homo_sa...   286  7.2e-07   1
A cbil|dbest|682404 AA056565 zl66g02.s1 3' Lib=486[Homo_sa...   286  7.2e-07   1
A cbil|dbest|1231886 AA581453 nd88g12.s1 3' Lib=996[Homo_sa...   286  7.2e-07   1
A cbil|dbest|477368 N71274 za36d08.s1 3' Lib=262[Homo_sapi...   286  7.5e-07   1
A cbil|dbest|786985 AA152368 zo07b07.s1 3' Lib=523[Homo_sa...   285  7.8e-07   1
A cbil|dbest|702067 AA069956 zm69b07.s1 3' Lib=502[Homo_sa...   285  8.1e-07   1
A cbil|dbest|434924 N33549 yy04e04.s1 3' Lib=367[Homo_sapi...   284  8.4e-07   1
A cbil|dbest|859077 AA219762 zr01g10.r1 5' Lib=536[Homo_sa...   284  8.5e-07   1
A cbil|dbest|1012292 AA370754 EST82714 5'-end Lib=787[Homo_...   288  9.3e-07   1
A cbil|dbest|1375814 AA670230 ae94g09.s1 3' Lib=931[Homo_sa...   284  9.4e-07   1
A cbil|dbest|1159606 AA514890 nh72a04.s1  Lib=892[...   282  1.0e-06   1
A cbil|dbest|772330 AA132463 zo07g12.s1 3' Lib=523[Homo_sa...   283  1.0e-06   1
A cbil|dbest|662580 AA045841 zl67b11.s1 3' Lib=486[Homo_sa...   282  1.2e-06   1
A cbil|dbest|79941 T29908 EST99745 3'-end Lib=224[Homo_sa...   281  1.2e-06   1
A cbil|dbest|1347843 AA644407 zu85a10.s1 3' Lib=628[Homo_sa...   281  1.3e-06   1
A cbil|dbest|1021239 AA379930 EST92825 5'-end Lib=667[Homo_...   283  1.3e-06   1
A cbil|dbest|997971 AA356663 EST65248 5'-end Lib=724[Homo_...   283  1.4e-06   1
A cbil|dbest|785880 AA147348 zo39c04.s1 3' Lib=523[Homo_sa...   280  1.4e-06   1
A cbil|dbest|595825 W87520 zh67f11.r1 5' Lib=452[Homo_sapi...   279  1.4e-06   1
A cbil|dbest|1654196 AA922406 oi53c02.s1 3' Lib=1102[Homo_s...   279  1.5e-06   1
A cbil|dbest|1590869 AA865532 oh30d08.s1 3' Lib=991[Homo_sa...   279  1.6e-06   1
A cbil|dbest|827638 AA188612 zp78a07.s1 3' Lib=527[Homo_sa...   278  1.6e-06   1
A cbil|dbest|453578 N48049 yy99b09.s1 3' Lib=390[Homo_sapi...   278  1.7e-06   1
A cbil|dbest|1133927 AA489257 ab36a11.r1 5' Lib=527[Homo_sa...   279  1.8e-06   1
A cbil|dbest|969793 AA328567 EST32063 5'-end Lib=730[Homo_...   282  1.8e-06   1
A cbil|dbest|458776 N53247 yy99b09.r1 5' Lib=390[Homo_sapi...   281  1.8e-06   1
A cbil|dbest|1002577 AA361248 EST70521 5'-end Lib=706[Homo_...   282  1.9e-06   1
A cbil|dbest|977138 AA335880 EST40395 5'-end Lib=715[Homo_...   277  2.1e-06   1
A cbil|dbest|785268 AA146734 zo34d12.s1 3' Lib=486[Homo_sa...   276  2.1e-06   1
A cbil|dbest|1298059 AA603403 np14c12.s1  Lib=575[...   276  2.2e-06   1
A cbil|dbest|710780 AA075585 zm88a04.r1 5' Lib=510[Homo_sa...   276  2.2e-06   1
A cbil|dbest|621932 AA011065 ze21b09.r1 5' Lib=424[Homo_sa...   276  2.2e-06   1
A cbil|dbest|737209 AA099283 zl77g07.s1 3' Lib=486[Homo_sa...   276  2.2e-06   1
A cbil|dbest|1583858 AA858203 oe43c06.s1 3' Lib=1017[Homo_s...   285  2.3e-06   1
A cbil|dbest|1326003 AA628259 af98h05.s1 3' Lib=628[Homo_sa...   276  2.3e-06   1
A cbil|dbest|738437 AA100278 zl81e06.s1 3' Lib=486[Homo_sa...   276  2.3e-06   1
A cbil|dbest|770162 AA130503 zo06e11.s1 3' Lib=523[Homo_sa...   276  2.3e-06   1
A cbil|dbest|1328093 AA629819 ad44d08.s1 3' Lib=537[Homo_sa...   275  2.3e-06   1
A cbil|dbest|1131974 AA486399 ab36a11.s1 3' Lib=527[Homo_sa...   276  2.4e-06   1
A cbil|dbest|1583077 AA857422 oh98c05.s1 3' Lib=1103[Homo_s...   276  2.4e-06   1
A cbil|dbest|1421542 AA714829 nv47d09.r1  Lib=883[...   276  2.4e-06   1
A cbil|dbest|1041782 AA401598 zu62e08.r1 5' Lib=628[Homo_sa...   276  2.4e-06   1
A cbil|dbest|768957 AA133612 zl92c07.s1 3' Lib=486[Homo_sa...   274  2.6e-06   1
A cbil|dbest|993660 AA352353 EST60336 5'-end Lib=765[Homo_...   276  3.0e-06   1
A cbil|dbest|827279 AA187156 zp62c06.s1 3' Lib=523[Homo_sa...   272  3.1e-06   1
A cbil|dbest|796707 AA158063 zo43h05.s1 3' Lib=523[Homo_sa...   272  3.4e-06   1
A cbil|dbest|738145 AA100073 zl80c08.s1 3' Lib=486[Homo_sa...   272  3.4e-06   1
A cbil|dbest|1004452 AA363145 EST72954 5'-end Lib=683[Homo_...   276  3.6e-06   1
A cbil|dbest|1368947 AA663441 ab83e10.s1 3' Lib=552[Homo_sa...   278  3.7e-06   1
A cbil|dbest|739671 AA101179 zn35d08.s1 3' Lib=523[Homo_sa...   270  3.8e-06   1
A cbil|dbest|765471 AA127497 zn81e02.s1 3' Lib=537[Homo_sa...   269  4.3e-06   1
A cbil|dbest|969137 AA327912 EST31315 5'-end Lib=730[Homo_...   271  4.5e-06   1
A cbil|dbest|1613668 AA886602 ny46c04.s1  Lib=919[...   270  4.7e-06   1
A cbil|dbest|1430822 AA723559 ah24b05.s1 3' Lib=417[Homo_sa...   289  4.9e-06   1
A cbil|dbest|959925 AA318546 EST20716 5'-end Lib=735[Homo_...   271  5.1e-06   1
A cbil|dbest|1422335 AA715622 nv51h03.r1  Lib=883[...   267  5.1e-06   1
A cbil|dbest|1005983 AA364602 EST75299 5'-end Lib=734[Homo_...   271  5.1e-06   1
A cbil|dbest|304446 H43395 yp09h04.r1 5' Lib=298[Homo_sapi...   267  5.3e-06   1
A cbil|dbest|772289 AA132422 zo07a11.s1 3' Lib=523[Homo_sa...   266  6.0e-06   1
A cbil|dbest|1767424 AI028733 ov92h02.x1 3' Lib=628[Homo_sa...   266  6.2e-06   1
A cbil|dbest|1214315 AA563932 nk23a07.s1 3' Lib=938[Homo_sa...   288  6.6e-06   1
A cbil|dbest|1041653 AA400081 zu62e08.s1 3' Lib=628[Homo_sa...   266  6.8e-06   1
A cbil|dbest|260275 H00395 yj23b09.r1 5' Lib=271[Homo_sapi...   265  7.2e-06   1
A cbil|dbest|1158342 AA513702 nh80b11.s1 3' Lib=894[Homo_sa...   264  7.6e-06   1
A cbil|dbest|796303 AA157750 zo46b01.s1 3' Lib=523[Homo_sa...   264  7.8e-06   1
A cbil|dbest|994773 AA353465 EST61598 5'-end Lib=765[Homo_...   268  8.6e-06   1
A cbil|dbest|948180 AA306872 EST177797 5'-end Lib=719[Homo...   262  1.0e-05   1
A cbil|dbest|1146022 AA501392 ne66e10.s1  Lib=881[...   260  1.4e-05   1
A cbil|dbest|953842 AA312394 EST183199 5'-end Lib=719[Homo...   259  1.4e-05   1
A cbil|dbest|709450 AA074238 zm75g12.s1 3' Lib=502[Homo_sa...   277  1.4e-05   1
A cbil|dbest|1232621 AA582600 nn51a07.s1 3' Lib=991[Homo_sa...   258  1.6e-05   1
A cbil|dbest|1381818 AA680212 ac82e03.s1 3' Lib=249[Homo_sa...   257  1.8e-05   1
A cbil|dbest|998587 AA357115 EST65976 3'-end Lib=710[Homo_...   257  1.9e-05   1


WARNING:  Descriptions of 90 database sequences were not reported due to the
          limiting value of parameter V = 250.



>cbil|dbest|1792845 AI053302 TENU1732 3'
            Lib=1138[Trypanosoma_cruzi|||epimastigote||] Length=351 Author_cmt:
            PETIDYL-PROPYL CIS-TRANS ISOMERASE B (PPCTIB) CYCLOPHILIN B
            gi|2995585, similar to Leishmania major chromosome 1
            gb|AE001274|AE001274
            Length = 351

  Minus Strand HSPs:

 Score = 1739 (260.9 bits), Expect = 2.2e-72, P = 2.2e-72
 Identities = 349/351 (99%), Positives = 349/351 (99%), Strand = Minus / Plus

Query:   351 CGCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATCGTGGATGG 292
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CGCTGATGGTAATCACCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATCGTGGATGG 60

Query:   291 CCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGTCCATTCATCC 232
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 CCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGTCCATTCATCC 120

Query:   231 ACGACATGGCCTTCATTGTAATATAAAAGGACGACGCATTCGTGTCCTCGTTGTCGTTGC 172
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 ACGACATGGCCTTCATTGTAATATAAAAGGACGACGCATTCGTGTCCTCGTTGTCGTTGC 180

Query:   171 ACATCCCAATGACGCCAGGCGCGTCGTGTGGAATGGCGTAAGANTCGTTTGGAAAATATC 112
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct:   181 ACATCCCAATGACGCCAGGCGCGTCGTGTGGAATGGCGTAAGANTCGTTTGGAAAATATC 240

Query:   111 GACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGAGATGTCGCCTCCCATCA 52
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 GACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGAGATGTCGCCTCCCATCA 300

Query:    51 CCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTGTACGTCAACT 1
             |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 CCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTGTACGTCAACT 351


>cbil|dbest|1745970 AI007401 TENU0421 3'
            Lib=854[Trypanosoma_cruzi|||epimastigote||] Length=322
            Length = 322

  Minus Strand HSPs:

 Score = 1583 (237.5 bits), Expect = 2.7e-65, P = 2.7e-65
 Identities = 319/322 (99%), Positives = 319/322 (99%), Strand = Minus / Plus

Query:   522 GTCTTCCAGCGACAACCCACTCCTCCTCTTACATCATCGTCTGCACCCAAAGTTCCCCGA 463
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 GTCTTCCAGCGACAACCCACTCCTCCTCTTACATCATCGTCTGCACCCAAAGTTCCCCGA 60

Query:   462 AACGGAATAAAGAGAGAAAGAGAGGAATAAAGGACGGGAGTTATTCCCTCCCTCCCTTCC 403
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AACGGAATAAAGAGAGAAAGAGAGGAATAAAGGACGGGAGTTATTCCCTCCCTCCCTTCC 120

Query:   402 TCTCTCTTCTTTTCTCGTATCAGTCGTCCGTGAGGTCAATGACACCGCAGTCGCTGATGG 343
             |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct:   121 TCTCTCTTCTTTTCTCGTATCAGTCGTCCGTGAGGTCAATGACACCGCAGTCACTGATGG 180

Query:   342 TAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATCGTGGATGGCCTCCACGA 283
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 TAATCTCCTTGCAAGGGCTTTGGTTGTGTTTTACATCTACATCGTGGATGGCCTCCACGA 240

Query:   282 CATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGTCCATTCATCCACGACATGG 223
             ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct:   241 CATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAACGTCCATTCATCCACGACATGG 300

Query:   222 CCTTCATTGTAATATAAAAGGA 201
             ||||||||||||||||||||||
Sbjct:   301 CCTTCATTGTAATATAAAAGGA 322


>cbil|dbest|130051 T69131 yc32c05.s1 3'
            Lib=252[Homo_sapiens|liver||||49_years_old] Length=595 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 595

  Minus Strand HSPs:

 Score = 390 (58.5 bits), Expect = 1.1e-11, P = 1.1e-11
 Identities = 224/351 (63%), Positives = 224/351 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   215 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 269

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   270 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 328

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GAC CATT GTGT   
Sbjct:   329 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAC-CATTTGTGTTGG 385

Query:   183 CGTTGT-CGTTGCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN- 128
              GT    C TT C CAT   CAA GA GCCAGG GC  CGT TG   T G  T AAG   
Sbjct:   386 -GTCCAGCATTTC-CATGGACAA-GATGCCAGG-GCC-CGTATGCTTTAGGATGAAGTTC 440

Query:   127 TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGA 69
             TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T GA
Sbjct:   441 TCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGGGTGT-GA 498

Query:    68 GATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTGTA 9
              A GTC CC CCC T AC CA   CCC  G A TAT C G  AAA   GGA CCC T TA
Sbjct:   499 -A-GTCACCACCC-TGACACATAACCCTGGGA-TATTCTGTGAAAGCAGGA-CCCTTNTA 553

Query:     8 C 8
             C
Sbjct:   554 C 554


>cbil|dbest|1698109 AA961754 or60d11.s1 3'
            Lib=1049[Homo_sapiens||pooled_germ_cell_tumors|||] Length=681
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 681

  Minus Strand HSPs:

 Score = 387 (58.1 bits), Expect = 1.3e-11, P = 1.3e-11
 Identities = 221/350 (63%), Positives = 221/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  ACA C A A C
Sbjct:   232 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACA-CAA-AGC 286

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   287 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 345

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   346 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 403

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTCGTGTGGAATGGCGTAAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  TG    A G  G AAG  
Sbjct:   404 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTA-TGCTTTAGGATGAAAGTC 459

Query:   127 TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTC-TCTAG 70
             TC T T  AAA T  TC  CCATAG   GA T  CCC C  T CC TT TGG C T T G
Sbjct:   460 TCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCCACAGTGCCATTATGGGCGTGT-G 517

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTGT 10
             A A GTC C  C    CAC  A  CCC G G AATAT C G  AAA   GGA  CC T T
Sbjct:   518 AAA-GTCACACCNTGACACATAAACCCTG-GAAATATTCTGTGAAAGCAGGAAACCTTAT 575

Query:     9 A 9
             A
Sbjct:   576 A 576


>cbil|dbest|830703 AA191632 zp63g12.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=623
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 623

  Minus Strand HSPs:

 Score = 380 (57.0 bits), Expect = 3.0e-11, P = 3.0e-11
 Identities = 220/350 (62%), Positives = 220/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   225 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   339 CCATCCAACCACTGCA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 397

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGTAAGAN- 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG    GG   AAG   
Sbjct:   398 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTAGGATGAAGTTC 452

Query:   127 TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGAG 68
             TC T T  AAA T TC  CC TAG   GA T  CC CC  T CC TT TGG  T T GA 
Sbjct:   453 TCATCTTCAAATT-TCTCCCCTAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-GA- 509

Query:    67 ATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTGTA 9
             A GTC CC CCC T AC CA    CC  G AATA T C G  AAA   GGA CCC T TA
Sbjct:   510 A-GTCACCACCC-TGACACATAAACCCTGGAATAATTCTGTGAAAGCAGGAACCCTTATA 567


>cbil|dbest|1503045 AA781370 aj25d11.s1 3' Lib=628[Homo_sapiens|||||]
            Length=634 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 634

  Minus Strand HSPs:

 Score = 379 (56.9 bits), Expect = 3.3e-11, P = 3.3e-11
 Identities = 227/358 (63%), Positives = 227/358 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   220 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 274

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   275 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 333

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   334 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 391

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   392 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 446

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   447 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 504

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA    CC  G AATA T C G  AAA   GGA CCCCT 
Sbjct:   505 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAATTCTGTGAAAGCAGGAACCCCT- 560

Query:    10 TACGTCAACT 1
             TA   CAA T
Sbjct:   561 TATAACAAAT 570


>cbil|dbest|765009 AA126843 zn87f11.r1 5'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=671 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 671

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 6.4e-11, P = 6.4e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   142 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 200

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   201 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 256

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   257 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 311

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   312 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 369

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   370 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 428

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   429 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 483

Query:   357 GG 358
             GG
Sbjct:   484 GG 485


>cbil|dbest|1224241 AA573841 nk08c06.s1 3' Lib=937[Homo_sapiens|colon|tumor|||]
            Length=625 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 625

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 6.9e-11, P = 6.9e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   443 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 500

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA    CC  G AATA T C G  AAA   GGA CCC T 
Sbjct:   501 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAATTCTGTGAAAGCAGGAACCCTTA 557

Query:    10 TA 9
             TA
Sbjct:   558 TA 559


>cbil|dbest|820089 AA182044 zp65g12.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=613
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 613

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.0e-11, P = 7.0e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   443 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGGGTGT-G 500

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA    CC  G AATA T C G  AAA   GGA CCC T 
Sbjct:   501 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAATTCTGTGAAAGCAGGAACCCTTA 557

Query:    10 TA 9
             TA
Sbjct:   558 TA 559


>cbil|dbest|1203053 AA552685 nk15e04.s1 3' Lib=937[Homo_sapiens|colon|tumor|||]
            Length=610 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 610

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.0e-11, P = 7.0e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   445 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 502

Query:    69 AGATGTCGCCTCCCATCACCCACGC-CCCGCGCAATATACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA    CCC CG A  AT C G  AAA   GGA CC CT 
Sbjct:   503 A-A-GTCACCACCC-TGACACATAAACCCTCGGATAATTCTGTGAAAGCAGGAGCCTCTA 559

Query:    10 TA 9
             TA
Sbjct:   560 TA 561


>cbil|dbest|1172718 AA528078 nh90a12.s1 3' Lib=894[Homo_sapiens||breast|||]
            Length=596 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 596

  Minus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.2e-11, P = 7.2e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   443 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 500

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA    CC  G AATA T C G  AAA   GGA CCC T 
Sbjct:   501 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAATTCTGTGAAAGCAGGAACCCTTA 557

Query:    10 TA 9
             TA
Sbjct:   558 TA 559


>cbil|dbest|786422 AA147872 zo47h12.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=653
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 653

  Minus Strand HSPs:

 Score = 371 (55.7 bits), Expect = 7.3e-11, P = 7.3e-11
 Identities = 225/356 (63%), Positives = 225/356 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 394

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   395 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 449

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   450 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 507

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA    CC  G AATA T C G  AAA   GGA CCC T 
Sbjct:   508 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAATTCTGTGAAAGCAGGAACCC-TA 563

Query:    10 TACGTCAA 3
             TA   CAA
Sbjct:   564 TAANCCAA 571


>cbil|dbest|949170 AA307700 EST178716 5'-end
            Lib=840[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=566 Author_cmt: cyclophilin A
            Length = 566

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.6e-11, P = 7.6e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   150 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 208

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   209 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 264

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   265 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 319

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   320 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 377

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   378 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 436

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   437 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 491

Query:   357 GG 358
             GG
Sbjct:   492 GG 493


>cbil|dbest|1132173 AA486598 ab18c10.r1 5'
            Lib=249[Homo_sapiens|lung||||72_years] Length=566 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 566

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.6e-11, P = 7.6e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:    23 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 81

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:    82 CAC-AC-G-CCATAATGGCAGTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 137

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   138 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 192

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   193 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 250

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   251 GGCAAGC-ATGTGGTGTTTGGCAAAGTGACAGAAGGCATGAATATTGTGGAGGCCATGGA 309

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   310 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 364

Query:   357 GG 358
             GG
Sbjct:   365 GG 366


>cbil|dbest|1324164 AA626420 ab49d12.r1 5'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=548 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);contains Alu repetitive element;
            Length = 548

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.8e-11, P = 7.8e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:     4 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 62

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:    63 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 118

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   119 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 173

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   174 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 231

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   232 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 290

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   291 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 345

Query:   357 GG 358
             GG
Sbjct:   346 GG 347


>cbil|dbest|1131353 AA488511 ab39c11.r1 5'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=547 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 547

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.8e-11, P = 7.8e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:    29 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 87

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:    88 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 143

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   144 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 198

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   199 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 256

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   257 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 315

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   316 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 370

Query:   357 GG 358
             GG
Sbjct:   371 GG 372


>cbil|dbest|771286 AA131423 zo08a03.r1 5'
            Lib=524[Homo_sapiens|||||Ntera-2/RA+MI_neuroepithelial_cells]
            Length=544 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 544

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.9e-11, P = 7.9e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   151 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 209

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   210 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 265

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   266 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 320

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   321 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 378

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   379 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 437

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   438 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 492

Query:   357 GG 358
             GG
Sbjct:   493 GG 494


>cbil|dbest|955581 AA314272 EST186116 5'-end
            Lib=842[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=542 Author_cmt: similar to
            cyclophilin A
            Length = 542

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 7.9e-11, P = 7.9e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   120 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 178

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   179 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 234

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   235 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 289

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   290 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 347

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   348 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 406

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   407 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 461

Query:   357 GG 358
             GG
Sbjct:   462 GG 463


>cbil|dbest|953819 AA312510 EST183177 5'-end
            Lib=719[Homo_sapiens|||T-lymphocyte||] Length=482 Author_cmt:
            cyclophilin A
            Length = 482

  Plus Strand HSPs:

 Score = 373 (56.0 bits), Expect = 8.0e-11, P = 8.0e-11
 Identities = 213/338 (63%), Positives = 213/338 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   144 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 202

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   203 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 258

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   259 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 313

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   314 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 371

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   372 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 430

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCAT 346
              CG T T G  GT   A   A    AAG CCC GCAAG AGAT ACCAT
Sbjct:   431 GCGCTTTTGG-GTCCCAGGAATGGCAAGACCCAGCAAGAAGATCACCAT 478


>cbil|dbest|1128469 AA483724 ne75h07.s1 
            Lib=883[Homo_sapiens||Ewing's_sarcoma|||] Length=519 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 519

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 8.3e-11, P = 8.3e-11
 Identities = 220/347 (63%), Positives = 220/347 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   178 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 236

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   237 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 292

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACA--A 181
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   A
Sbjct:   293 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTGGA 348

Query:   182 CGAGGACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             C    ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   349 CCCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 406

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   407 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 465

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTG 355
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG
Sbjct:   466 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTG 519


>cbil|dbest|1854320 AI095933 qb26f02.x1 3'
            Lib=474[Homo_sapiens|uterus||||adult] Length=509 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 509

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 8.4e-11, P = 8.4e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:    62 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGAGACTT 120

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   121 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 176

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   177 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 231

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   232 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 289

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   290 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 348

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   349 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 403

Query:   357 GG 358
             GG
Sbjct:   404 GG 405


>cbil|dbest|794411 AA155677 zo49g03.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=616
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 616

  Minus Strand HSPs:

 Score = 370 (55.5 bits), Expect = 8.6e-11, P = 8.6e-11
 Identities = 226/356 (63%), Positives = 226/356 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   445 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 502

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA   CCC  G AATA T C G  AAA   GGA CC  T 
Sbjct:   503 A-A-GTCACCACCC-TGACACATAACCCTGG-AATAATTCTGTGAAANCAGGANCCT-TA 557

Query:    10 TACGTCAA 3
             TAC  CAA
Sbjct:   558 TACC-CAA 564


>cbil|dbest|1668232 AA935507 on20e11.s1 3'
            Lib=1076[Homo_sapiens|lung|carcinoid|||] Length=493 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 493

  Plus Strand HSPs:

 Score = 372 (55.8 bits), Expect = 8.7e-11, P = 8.7e-11
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   118 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 176

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   177 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 232

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   233 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 287

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   288 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 345

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   346 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 404

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   405 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 459

Query:   357 GG 358
             GG
Sbjct:   460 GG 461


>cbil|dbest|830705 AA191634 zp63h12.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=636
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 636

  Minus Strand HSPs:

 Score = 366 (54.9 bits), Expect = 1.3e-10, P = 1.3e-10
 Identities = 224/356 (62%), Positives = 224/356 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   225 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   339 CCATCCAACCACTTCA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 397

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGTAAGAN- 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG    GG   AAG   
Sbjct:   398 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTAGGATGAAGTTC 452

Query:   127 TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGA 69
             TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T GA
Sbjct:   453 TCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCC-TTATGGCGTGT-GA 509

Query:    68 GATGTCGCCTCCCAT-CACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
              A GTC CC CCC   CAC  A   CCC  G AATA T C G  AAA   GGA CCC T 
Sbjct:   510 -A-GTCACCACCCTGACACATAAAACCCTGG-AATAATTCTGTGAAAGCAGGAACCCTTA 566

Query:    10 TACGTCAA 3
             TA   CAA
Sbjct:   567 TAACCCAA 574


>cbil|dbest|826199 AA188007 zp68g03.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=620
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 620

  Minus Strand HSPs:

 Score = 366 (54.9 bits), Expect = 1.3e-10, P = 1.3e-10
 Identities = 218/352 (61%), Positives = 218/352 (61%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GA  CATT GTGT  
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAACCATTTGTGTTG 387

Query:   184 TCGTTGT-CGTTGCACATCCCA-ATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGTAAG 130
               GT    C TTG  CAT     A GA GCCAGG C  GT  G T T G ATG  GT   
Sbjct:   388 G-GTCCAGCATTGGCCATGGGNCANGATGCCAGGACCNGTATGCTTTAGGATGANGTTCN 446

Query:   129 AN-TCGTTTGGAAAATATCGACC-ATAGCACGAGTAACCCCC-GTTTCCGTTGTGGTCTC 73
                TC TTT  AAA T TC  CC AT G   GA T  CCCCC G T CC TT TGG    
Sbjct:   447 NCATC-TTTC-AAATTTTCNCCCCATNGATGGACTTGCCCCCAGGTGCCATTATGGGGG- 503

Query:    72 TAGAGATGTCGCCTCCCAT-CACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCC 14
             T G  A GTC CC CCC   CA   A  CCC G G A  AT C G   AA G GGA CCC
Sbjct:   504 T-GTNAAGTCNCCCCCCTGACANATAANCCCTGGGAANAATTCTGNTGAAAGGGGANCCC 562

Query:    13 CTGTA 9
              T TA
Sbjct:   563 TTTTA 567


>cbil|dbest|1755947 AI016790 ov31c04.x1 3' Lib=628[Homo_sapiens|||||]
            Length=694 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 694

  Minus Strand HSPs:

 Score = 363 (54.5 bits), Expect = 1.6e-10, P = 1.6e-10
 Identities = 221/350 (63%), Positives = 221/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   203 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 257

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   258 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 316

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   317 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 374

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   375 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 429

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   430 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 487

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA    CC  G AATA T C G   AA   GGA CCC T 
Sbjct:   488 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAATTCTGTGGAAGCAGGAACCCTTA 544

Query:    10 TA 9
             TA
Sbjct:   545 TA 546


>cbil|dbest|949005 AA307477 EST178563 5'-end
            Lib=840[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=547 Author_cmt: cyclophilin A
            Length = 547

  Plus Strand HSPs:

 Score = 365 (54.8 bits), Expect = 1.6e-10, P = 1.6e-10
 Identities = 221/350 (63%), Positives = 221/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 450

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT A CAT  GC GACTG 
Sbjct:   451 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCANCATT-GCTGACTGT 505

Query:   357 GG 358
             GG
Sbjct:   506 GG 507


>cbil|dbest|804192 AA165542 zo81b06.r1 5'
            Lib=510[Homo_sapiens|||||adult,_64_years] Length=546 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 546

  Plus Strand HSPs:

 Score = 365 (54.8 bits), Expect = 1.6e-10, P = 1.6e-10
 Identities = 223/350 (63%), Positives = 223/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   150 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 208

Query:    68 CTCTAGAGACCACAACGGAAACGGG-GGTTACTCGTGCTATGGTC-GATATTTTCCAAAC 125
             C C A  G CCA AA GG A C GG GG  A TC   CTATGG   GA ATTT   A A 
Sbjct:   209 CAC-AC-G-CCATAATGGCACCTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGAT 264

Query:   126 GANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAAC 182
             GA   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   
Sbjct:   265 GAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG- 319

Query:   183 GAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAA 238
             GA   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG A
Sbjct:   320 GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGA 377

Query:   239 TGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCC 297
             TGG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  
Sbjct:   378 TGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGG 436

Query:   298 A-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTG 355
             A CG T T G  GT  A  A A    AAG CC  GCAAG AGAT ACCAT  GC GACTG
Sbjct:   437 AGCGCTTTGG--GTCCAGGA-ATGGTAAGACCA-GCAAGAAGAT-ACCATT-GCTGACTG 490

Query:   356 CGG 358
              GG
Sbjct:   491 TGG 493


>cbil|dbest|739655 AA101162 zn42g02.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=590
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 590

  Minus Strand HSPs:

 Score = 364 (54.6 bits), Expect = 1.7e-10, P = 1.7e-10
 Identities = 220/350 (62%), Positives = 220/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  C  CC  T CC TT TGG C  T G
Sbjct:   443 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCNACCAGTGCCATTATGG-CGGT-G 499

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAAT-ATACGGAAAAATGTGGATCCCCTG 11
              GA GTC CC CCC T AC CA    CC  G AAT A  C G  AAA   GGA CCC T 
Sbjct:   500 TGAAGTCACCACCC-TGACACATAAACCCTGGAATNANTCTGTGAAAGCAGGAACCCTTA 558

Query:    10 TA 9
             TA
Sbjct:   559 TA 560


>cbil|dbest|949846 AA308538 EST179358 5'-end
            Lib=841[Homo_sapiens||colon|KM12SM|KM12C(HCC)metastasis_into_mouse_
            (liver)|] Length=529 Author_cmt: cyclophilin A
            Length = 529

  Plus Strand HSPs:

 Score = 365 (54.8 bits), Expect = 1.7e-10, P = 1.7e-10
 Identities = 221/350 (63%), Positives = 221/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   170 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 228

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   229 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 284

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   285 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 339

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   340 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 397

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AG  GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   398 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGNAGGCATGAATATTGTGGAGGCCATGGA 456

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG 
Sbjct:   457 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGT 511

Query:   357 GG 358
             GG
Sbjct:   512 GG 513


>cbil|dbest|952788 AA311324 EST182218 5'-end
            Lib=711[Homo_sapiens|||T-lymphocyte||] Length=562 Author_cmt:
            cyclophilin A
            Length = 562

  Plus Strand HSPs:

 Score = 363 (54.5 bits), Expect = 1.9e-10, P = 1.9e-10
 Identities = 221/350 (63%), Positives = 221/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   170 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 228

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   229 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 284

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   285 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 339

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   340 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 397

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   398 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 456

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT A CAT  GC GACTG 
Sbjct:   457 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCAACATT-GCTGACTGT 511

Query:   357 GG 358
             GG
Sbjct:   512 GG 513


>cbil|dbest|1766364 AI027466 ow06c08.x1 3'
            Lib=417[Homo_sapiens|parathyroid_gland|parathyroid_tumor|||adult]
            Length=575 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 575

  Minus Strand HSPs:

 Score = 361 (54.2 bits), Expect = 2.3e-10, P = 2.3e-10
 Identities = 225/358 (62%), Positives = 225/358 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 450

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   451 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 508

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC  CC T AC CA    CC  G AATA T C G  AAA   GGA CCC T 
Sbjct:   509 A-A-GTCACCAACC-TGACACATAAACCCTGGAATAATTCTGTGAAAGCAGGAACCCTT- 564

Query:    10 TACGTCAACT 1
             TA   CAA T
Sbjct:   565 TATACCAAAT 574


>cbil|dbest|764957 AA126791 zn87f11.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=686 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 686

  Minus Strand HSPs:

 Score = 359 (53.9 bits), Expect = 2.4e-10, P = 2.4e-10
 Identities = 221/350 (63%), Positives = 221/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   444 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 501

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC  CC T AC CA    CC  G AATA T C G  AAA   GGA CCC T 
Sbjct:   502 A-A-GTCACCANCC-TGACACATAAACCCTGGAATAATTCTGTGAAAGCAGGAACCC-TA 557

Query:    10 TA 9
             TA
Sbjct:   558 TA 559


>cbil|dbest|845214 AA207193 zq73g05.r1 5'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=603 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 603

  Plus Strand HSPs:

 Score = 360 (54.0 bits), Expect = 2.5e-10, P = 2.5e-10
 Identities = 220/347 (63%), Positives = 220/347 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   168 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 226

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   227 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 282

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   283 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 337

Query:   184 AGG--ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A    ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   338 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 395

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   396 GGCAAGC-ATGTGGTGTTTGGCA-AGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 453

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTG 355
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG
Sbjct:   454 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTG 507


>cbil|dbest|1375735 AA670151 ab65b06.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=655 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 655

  Minus Strand HSPs:

 Score = 359 (53.9 bits), Expect = 2.5e-10, P = 2.5e-10
 Identities = 223/350 (63%), Positives = 223/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   219 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 273

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   274 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 332

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-AT-ATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT ATAAA  G   AC CATT GTGT  
Sbjct:   333 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGATAAACTGGGAAC-CATTTGTGTTG 389

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGA 129
               GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG 
Sbjct:   390 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGT 444

Query:   128 N-TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTA 71
               TC T T  AAA T  TC  CCATAG   GA T  CC CC  T  C TT TGG  T T 
Sbjct:   445 TCTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGGCATTATGGCGTGT- 502

Query:    70 GAGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCT 12
             GA A GTC CC CCC T AC CA    CC  G AATA T C G  AAA   GGA CCC T
Sbjct:   503 GA-A-GTCACCACCC-TGACACATAAACCTGG-AATAATTCTGTGAAAGCAGGAACCCTT 558

Query:    11 GTA 9
              TA
Sbjct:   559 ATA 561


>cbil|dbest|1344104 AA640636 nr22c03.r1 
            Lib=574[Homo_sapiens|||||45_years_old] Length=610 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 610

  Plus Strand HSPs:

 Score = 359 (53.9 bits), Expect = 2.7e-10, P = 2.7e-10
 Identities = 221/347 (63%), Positives = 221/347 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   163 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 221

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   222 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 277

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   278 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 332

Query:   184 AGG-A-CACGAATGCGTCGTC-CTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAA 238
             A   A CAC AATG  TC    CTTTT  AT T CA TG  A G C TG  GTGG TG A
Sbjct:   333 ACCCAACACAAATGGTTCCCAGCTTTTC-ATCTGCACTGCCAAGAC-TGA-GTGGTTGGA 389

Query:   239 TGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCC 297
             TGG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  
Sbjct:   390 TGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGG 448

Query:   298 A-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTG 355
             A CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG
Sbjct:   449 AGCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTG 503


>cbil|dbest|724784 AA088390 zl89d07.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=647 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 647

  Minus Strand HSPs:

 Score = 356 (53.4 bits), Expect = 3.5e-10, P = 3.5e-10
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   444 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 501

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA   CCC  G AATA T C G  AA    GGA CCC T 
Sbjct:   502 A-A-GTCACCACCC-TGACACATAACCCTGG-AATAATTCTGTGAAGCA-GGANCCC-TA 555

Query:    10 TA 9
             TA
Sbjct:   556 TA 557


>cbil|dbest|794806 AA156260 zo48c01.r1 5'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=573
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 573

  Plus Strand HSPs:

 Score = 357 (53.6 bits), Expect = 3.6e-10, P = 3.6e-10
 Identities = 219/350 (62%), Positives = 219/350 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   161 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 219

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   220 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 275

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   276 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 330

Query:   184 AGG-AC-ACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A  AC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   331 ACCCAATACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 388

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   389 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 447

Query:   299 CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGCGACTGCGG 358
             CG T T G  GT A   A A  CAA G CC  GCAAG AGA  ACCAT    GACTG GG
Sbjct:   448 CGCTTTGG--GTCAGG-A-ATGCAA-GACCA-GCAAGAAGANCACCATTNT-GACTGTGG 500


>cbil|dbest|1346769 AA643333 nr97e05.s1 3'
            Lib=1017[Homo_sapiens|prostate|epithelium_(cell_line)|||]
            Length=633 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 633

  Minus Strand HSPs:

 Score = 356 (53.4 bits), Expect = 3.6e-10, P = 3.6e-10
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   444 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 501

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATA-CGGAAAAATGT-GGATCCCCT 12
             A A GTC CC CCC T AC CA    CC  G AATA A C G  AAA    GGA CCC T
Sbjct:   502 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAAATCTGTGAAAGCAAGGA-CCCTT 557

Query:    11 GTA 9
              TA
Sbjct:   558 ATA 560


>cbil|dbest|794326 AA155781 zo49e09.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=631
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 631

  Minus Strand HSPs:

 Score = 356 (53.4 bits), Expect = 3.6e-10, P = 3.6e-10
 Identities = 220/350 (62%), Positives = 220/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   225 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   339 CCATCCAACCACTGCA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 397

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGTAAGAN- 128
              GT    C TT GC CAT   CAA GA GCC G C CGT  TG    A G  G AAG   
Sbjct:   398 -GTCCAGCATTTGC-CATGGACAA-GATGCCGGACCCGTA-TGCTTTAGGATG-AAGTTC 452

Query:   127 TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCC-CCGTTTCCGTTGTGGTCTCTAG 70
             TC T T  AAA T  TC  CCATAG   GA T   CC CC  T CC TT TGG  T T G
Sbjct:   453 TCATCTTCAAATTTCTCC-CCATAGATGGACTTGGCCACCAGTGCCATTATGGCGTGT-G 510

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC  CC T AC CA    CC  G AATA T C G  AAA   GGA CCCCT 
Sbjct:   511 A-A-GTCACCANCC-TGACACATAAACCTGG-AATAATTCTGTGAAAGCAGGAACCCCTA 566

Query:    10 TA 9
             TA
Sbjct:   567 TA 568


>cbil|dbest|955791 AA314411 EST186318 5'-end
            Lib=842[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=578 Author_cmt: cyclophilin A
            Length = 578

  Plus Strand HSPs:

 Score = 356 (53.4 bits), Expect = 3.9e-10, P = 3.9e-10
 Identities = 220/350 (62%), Positives = 220/350 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 450

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A    A   C AA G CC  GCAAG AGAT A CAT  GC GACTG 
Sbjct:   451 GCGCTTTGGGTCCAGGG-ATGGC-AA-GACCA-GCAAGAAGATCANCATT-GCTGACTGT 505

Query:   357 GG 358
             GG
Sbjct:   506 GG 507


>cbil|dbest|830782 AA191711 zp82e09.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=638 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 638

  Minus Strand HSPs:

 Score = 353 (53.0 bits), Expect = 4.9e-10, P = 4.9e-10
 Identities = 219/350 (62%), Positives = 219/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   239 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 293

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   294 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 352

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G  CTT  CA TG A AT  AAAA    GA  CATT GTGT  
Sbjct:   353 CCATCCAACCACT-CA-GTTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTG 410

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGTAAGAN 128
               GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG    GG   AAG  
Sbjct:   411 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTAGGATGAAGTT 465

Query:   127 -TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGA 69
              TC T T  AAA T TC  CC TAG   G  T  CC CC  T CC TT TGG  T T GA
Sbjct:   466 CTCATCTTCAAATT-TCTCCCCTAGATGGNCTTGCCACCAGTGCCATTATGGCGTGT-GA 523

Query:    68 GATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTGT 10
              A GTC CC CCC T AC CA     C  G AATA T C G  AAA   GGA CCC T T
Sbjct:   524 -A-GTCACCACCC-TGACACATAAANCCTGGAATAATTCTGTGAAAGCAGGAACCC-TAT 579

Query:     9 A 9
             A
Sbjct:   580 A 580


>cbil|dbest|1375457 AA669873 ag42c04.s1 3'
            Lib=931[Homo_sapiens||bone_marrow_stroma|||mixed] Length=614
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 614

  Minus Strand HSPs:

 Score = 353 (53.0 bits), Expect = 5.0e-10, P = 5.0e-10
 Identities = 219/344 (63%), Positives = 219/344 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   336 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 393

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   394 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 448

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   449 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 506

Query:    69 AGATGTCGCCTCCCAT-CACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCC 15
             A A GTC CC CCC   CAC  A  CCC G G AATA T C G  AAA   GGA CC
Sbjct:   507 A-A-GTCACCACCCTGGCACATAAACCCTG-G-AATAATTCTGTGAAAGCAGGAACC 559


>cbil|dbest|958246 AA316938 EST188592 5'-end
            Lib=841[Homo_sapiens||colon|KM12SM|KM12C(HCC)metastasis_into_mouse_
            (liver)|] Length=482 Author_cmt: cyclophilin A
            Length = 482

  Plus Strand HSPs:

 Score = 354 (53.1 bits), Expect = 5.8e-10, P = 5.8e-10
 Identities = 218/346 (63%), Positives = 218/346 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   143 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 201

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   202 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 257

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   258 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 312

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   313 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 370

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   371 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 429

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACT 354
              CG T T G T  A    A   C AA G CC  GCAAG AGAT ACCAT  GC GACT
Sbjct:   430 GCGCTTTGGGTCCAGGN-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACT 482


>cbil|dbest|794525 AA155979 zo48c01.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=625
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 625

  Minus Strand HSPs:

 Score = 349 (52.4 bits), Expect = 7.5e-10, P = 7.5e-10
 Identities = 217/344 (63%), Positives = 217/344 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GT T   
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTATTGG 394

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   395 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 449

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   450 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 507

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCC 15
             A A GTC CC CC   CAC  A  CCC G G AATA T C G  AAA   GGA CC
Sbjct:   508 A-A-GTCACCACCTGACACATAAACCCTG-G-AATAATTCTGTGAAANCAGGANCC 559


>cbil|dbest|860265 AA220938 zr01g10.s1 3'
            Lib=536[Homo_sapiens|brain|neuroepithelial_cells|||Ntera-2_neuroepi
            thelial_cells] Length=605 Author_cmt: gb:X52851_rna1
            PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 605

  Minus Strand HSPs:

 Score = 349 (52.4 bits), Expect = 7.8e-10, P = 7.8e-10
 Identities = 215/345 (62%), Positives = 215/345 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   225 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   339 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAANTGGGAACCATTTGTGTTGG 396

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGT-CG-TGTGGAATGGCGTAAG 130
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT   
Sbjct:   397 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTANGCTTTAGGATGAAGTTCT 453

Query:   129 ANTCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
               TC  TT  AA  T TC  CCA AG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   454 CATC--TTCAAATTTCTCC-CCANAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 509

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCC 14
             A A GTC CC CCC T AC CA     C  G A  AT C G  AAA   GGA CCC
Sbjct:   510 A-A-GTCACCACCC-TGACACATAAANCCTGGATAATTCTGTGAAAGAGGGANCCC 562


>cbil|dbest|1582992 AA857337 oh97c10.s1 3'
            Lib=1103[Homo_sapiens|pharynx|squamous_cell_carcinoma|||]
            Length=561 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 561

  Minus Strand HSPs:

 Score = 349 (52.4 bits), Expect = 8.4e-10, P = 8.4e-10
 Identities = 221/350 (63%), Positives = 221/350 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  A A T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   443 CTCATCTTCANATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 500

Query:    69 AGATGTCGCCTCCCATCACCCACGC-CCC-GCGCAATATACGGAAAAATGTGGATCCCCT 12
             A A GTC CC CCC T AC CA    CCC G G AATA  C G  AA    GGA CCC T
Sbjct:   501 A-A-GTCACCACCC-TGACACATTAACCCTGGGAAATAATCTGTGAAGCAGGGA-CCCTT 556

Query:    11 GTA 9
              TA
Sbjct:   557 ATA 559


>cbil|dbest|785707 AA147112 zo32g07.r1 5' Lib=486[Homo_sapiens|colon||||]
            Length=598 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 598

  Plus Strand HSPs:

 Score = 348 (52.2 bits), Expect = 8.7e-10, P = 8.7e-10
 Identities = 220/350 (62%), Positives = 220/350 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   169 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 227

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   228 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 283

Query:   127 ANT-CTTACGCCATTCCA-CACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAAC 182
             A   CTT   CC T     CA   CG G CCTGGC TC TTG   ATG GCAA   C   
Sbjct:   284 AGAACTTCATCCCTAAANGCATACCGGGTCCTGGCATC-TTGTCCATGGGCAAATGCTG- 341

Query:   183 GAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAA 238
             GA   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG A
Sbjct:   342 GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGA 399

Query:   239 TGG-ACGCTACGTTGCGTTT-GGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATC 296
             TGG A GC A GT G GTTT GGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT 
Sbjct:   400 TGGCAAGC-ATGTGGTGTTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATG 458

Query:   297 CA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACT 354
              A CG T T G T  A  A A   C AA G CC  GCAAG AGAT AC AT  GC GACT
Sbjct:   459 GAGCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCAC-ATT-GCTGACT 512

Query:   355 GCGG 358
             G GG
Sbjct:   513 GTGG 516


>cbil|dbest|130334 T69414 yc38c10.s1 3'
            Lib=252[Homo_sapiens|liver||||49_years_old] Length=538 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 538

  Minus Strand HSPs:

 Score = 349 (52.4 bits), Expect = 8.7e-10, P = 8.7e-10
 Identities = 205/324 (63%), Positives = 205/324 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   202 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 256

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   257 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 315

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GA  CATT GTGT  
Sbjct:   316 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAACCATTTGTGTTG 373

Query:   184 TCGTTGT-CGTT-GCACATCCCA-ATGACGCCAGGCGCGTCGTGTGGAATGGCG-T-AAG 130
               GT    C TT GC CAT   A A GA GCCAGG GC  CGT TG   T G G T AAG
Sbjct:   374 GGGTCCAGCATTTGC-CATGGGACAAGATGCCAGGGGCC-CGTATGCTTTAGGGATGAAG 431

Query:   129 AN-TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTA 71
                TC T T  AA  T T   CCATAG   G  T  CC CC  T CC TT TGG  T T 
Sbjct:   432 TTCTCATCTTCAATTTCTNC-CCATAGGTGGNCTTGCCACCAGTGCCCTTNTGGCGTGT- 489

Query:    70 GAGATGTCGCCTCCCATCACCCACGCCCCGCGCAAT 35
             GA A GTC CC CCC T AC CA   CC G G  AT
Sbjct:   490 GA-A-GTCACCACCC-TGACACATAACCTGGGNTAT 522


>cbil|dbest|1560597 AA838041 oe91h03.s1 
            Lib=988[Homo_sapiens|colon|colon_tumor|||] Length=529 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 529

  Minus Strand HSPs:

 Score = 349 (52.4 bits), Expect = 8.9e-10, P = 8.9e-10
 Identities = 201/311 (64%), Positives = 201/311 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 450

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TCG CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   451 CTCATCTTCAAATTTCTCG-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 508

Query:    69 AGATGTCGCCTCCCATCACCCA 48
             A A GTC CC CCC T AC CA
Sbjct:   509 A-A-GTCACCACCC-TGACACA 527


>cbil|dbest|279667 H19729 yn60f04.r1 5'
            Lib=300[Homo_sapiens|brain||||55-year_old] Length=473 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 473

  Plus Strand HSPs:

 Score = 350 (52.5 bits), Expect = 8.9e-10, P = 8.9e-10
 Identities = 222/350 (63%), Positives = 222/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   101 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 159

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   160 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 215

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   216 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 270

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   271 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 328

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGA-GTGATAGACGGCATGAATGTCGTGGAGGCCATCC 297
             GG A GC A GT G GTTTGG C A GTGA AGA GGCATGAAT T GTGGAGGCCAT  
Sbjct:   329 GGCAAGC-ATGTGGTGTTTGGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGG 387

Query:   298 -A-CGATGTAGATGTAAAAC-ACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GAC 353
              A CG T T G  GT  A   A    CAA G CC  GCAAG AGAT ACCAT  GC GAC
Sbjct:   388 GAGCGCTTTNGG-GTCCAGGGATTGGCAA-GACCA-GCAAGAAGATCACCATT-GCTGAC 443

Query:   354 TGCGG 358
             TG GG
Sbjct:   444 TGTGG 448


>cbil|dbest|1232144 AA581711 nn52c07.s1 3'
            Lib=991[Homo_sapiens|kidney|kidney_tumor|||] Length=598 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 598

  Minus Strand HSPs:

 Score = 347 (52.1 bits), Expect = 9.7e-10, P = 9.7e-10
 Identities = 221/351 (62%), Positives = 221/351 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCG-GCCAAACGCAACGTAGCGT 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT G GCCAAAC C AC T GC T
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTGTGCCAAACACCACAT-GCTT 329

Query:   241 -CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC 185
              CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT  
Sbjct:   330 GCCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTA 387

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGTAA 131
               GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT  
Sbjct:   388 GGGTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGTTC 445

Query:   130 GANTCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTA 71
                TC TTT  AA    TC  CCATAG   GA T  CC CC  T CC TT TGG  T T 
Sbjct:   446 TCATC-TTTC-AATTGCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT- 501

Query:    70 GAGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTG 11
             GA A GTC  C CC   CAC  A  CCC G G AATA  C G  AA    GGA CCC T 
Sbjct:   502 GA-A-GTCTACACCTGACACTAAA-CCCTG-G-AATAATCTGTGAAGCA-GGACCCCTTA 555

Query:    10 TAC 8
             TAC
Sbjct:   556 TAC 558


>cbil|dbest|830221 AA191136 zp86c10.r1 5'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=420 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 420

  Plus Strand HSPs:

 Score = 350 (52.5 bits), Expect = 1.0e-09, P = 1.0e-09
 Identities = 214/335 (63%), Positives = 214/335 (63%), Strand = Plus / Plus

Query:    24 TTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACATCTCTAGAGACCACAA 82
             TTT  C G AT ATT C  GG    TG GT A GGG GG GAC TC C A  G CCA AA
Sbjct:     1 TTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTTCAC-AC-G-CCATAA 56

Query:    83 CGGAAACGGG-GGTTACTCGTGCTATGGTC-GATATTTTCCAAACGANT-CTTACGCCAT 139
              GG A C GG GG  A TC   CTATGG   GA ATTT   A A GA   CTT   CC T
Sbjct:    57 TGGCACCTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-T 114

Query:   140 TCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATG 195
                 CA  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A CAC AATG
Sbjct:   115 AAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATG 170

Query:   196 CGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTG 252
               TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A GC A GT G
Sbjct:   171 GTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGG 227

Query:   253 CGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTA 311
              GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T T G T  A
Sbjct:   228 TGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCA 287

Query:   312 AAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
               A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   288 GGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 330


>cbil|dbest|1178691 AA532728 nj21e04.s1 3'
            Lib=927[Homo_sapiens|adrenal_gland|adrenal_adenoma|||] Length=547
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 547

  Minus Strand HSPs:

 Score = 347 (52.1 bits), Expect = 1.1e-09, P = 1.1e-09
 Identities = 213/335 (63%), Positives = 213/335 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGNT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   445 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 502

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAA 24
             A A GTC CC CCC T AC CA    CC  G AATA T C G  AAA
Sbjct:   503 A-A-GTCACCACCC-TGACACATAAGCCTGG-AATAATTCTGTGAAA 545


>cbil|dbest|1557737 AA836667 of53b10.s1 
            Lib=1080[Homo_sapiens|brain|substantia_nigra|||] Length=747
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 747

  Minus Strand HSPs:

 Score = 351 (52.7 bits), Expect = 1.1e-09, P = 1.1e-09
 Identities = 223/356 (62%), Positives = 223/356 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   242 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 296

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   297 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 355

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   356 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 413

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   414 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 468

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   469 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 526

Query:    69 AGATGTCGCCTCCCATCACCCACGC-CCCGCGCAATATACGGAAAAATGTGGATCCCCTG 11
             A A GTC C  CCC T AC CA    CCC  G A  AT C G   AA   GGA CCC T 
Sbjct:   527 A-A-GTCACA-CCC-TGACACATAAACCCTTGGATAATTCTGGTGAAGCAGGAACCCTTA 582

Query:    10 TACGTCAA 3
             TAC  CAA
Sbjct:   583 TACCCCAA 590


>cbil|dbest|1410384 AA703670 ag77a11.r1 5'
            Lib=525[Homo_sapiens|||||hNT_neurons] Length=540 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 540

  Minus Strand HSPs:

 Score = 347 (52.1 bits), Expect = 1.1e-09, P = 1.1e-09
 Identities = 207/325 (63%), Positives = 207/325 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   444 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 501

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA 34
             A A GTC CC CCC T AC CA    CC  G AATA
Sbjct:   502 A-A-GTCACCACCC-TGACACATAAACCCTGGAATA 534


>cbil|dbest|1551083 AA828948 od81d01.s1 
            Lib=887[Homo_sapiens||ovary|||] Length=504 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 504

  Plus Strand HSPs:

 Score = 347 (52.1 bits), Expect = 1.1e-09, P = 1.1e-09
 Identities = 221/350 (63%), Positives = 221/350 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   148 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 206

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   207 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 262

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   263 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 317

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   318 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 375

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GT TGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   376 GGCAAGC-ATGTGGTGTCTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 434

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCA-GC-GACTG 355
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACC  CA GC GACTG
Sbjct:   435 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACC--CATGCTGACTG 488

Query:   356 CGG 358
              GG
Sbjct:   489 TGG 491


>cbil|dbest|716225 AA081118 zn33h03.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=558
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 558

  Minus Strand HSPs:

 Score = 346 (51.9 bits), Expect = 1.1e-09, P = 1.1e-09
 Identities = 218/345 (63%), Positives = 218/345 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCCCA-ATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   A A GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGGACAAGATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 445

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   446 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGG-TGT-G 502

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCC 14
             A A GTC CC CCC T AC CA    CC  G AATA T C G  AAA   GGA CCC
Sbjct:   503 A-A-GTC-CCACCC-TGACACATAANCCTGG-AATAATTCTGTGAAAGCAGGAACCC 554


>cbil|dbest|1634900 AA906640 ok98h08.s1 3'
            Lib=1076[Homo_sapiens|lung|carcinoid|||] Length=599 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 599

  Plus Strand HSPs:

 Score = 345 (51.8 bits), Expect = 1.2e-09, P = 1.2e-09
 Identities = 219/350 (62%), Positives = 219/350 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   162 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 220

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA  A GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   221 CAC-AC-G-CCAGTATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 276

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   277 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 331

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG   TGG TG A 
Sbjct:   332 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGAA-TGGTTGGAA 389

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   390 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 448

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT ACCA C GC GACTG 
Sbjct:   449 GCGCTTTGGGTTCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCA-CTGCTGACTGT 503

Query:   357 GG 358
             GG
Sbjct:   504 GG 505


>cbil|dbest|1233159 AA581820 nn35e05.s1 3'
            Lib=990[Homo_sapiens||germ_cell_tumor|||] Length=552 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 552

  Minus Strand HSPs:

 Score = 345 (51.8 bits), Expect = 1.3e-09, P = 1.3e-09
 Identities = 213/335 (63%), Positives = 213/335 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 450

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   451 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 508

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAA 24
             A A GTC CC CC   CAC  A  CCC G G AATA T C G  AAA
Sbjct:   509 A-A-GTCACCCCCTGACACATAAACCCTG-G-AATAATTCTGTGAAA 551


>cbil|dbest|826763 AA186536 zp64h07.r1 5'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=490
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 490

  Plus Strand HSPs:

 Score = 346 (51.9 bits), Expect = 1.3e-09, P = 1.3e-09
 Identities = 218/350 (62%), Positives = 218/350 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:    94 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 152

Query:    68 CTCTAGAGACCACAACGGAAACGGG-GGTTACTCGTGCTATGGTC-GATATTTTCCAAAC 125
             C C A  G CCA AA GG A   GG GG  A TC   CTATGG   GA ATTT   A A 
Sbjct:   153 CAC-AC-G-CCATAATGGCACNTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGAT 208

Query:   126 GANT-CTTACGCCATTCCACACGACGCG-CC-TGGCGTCATTGGG-ATGTGCAACGACAA 181
             GA   CTT   CC T    CA  ACG G CC TGGC TC TTG   ATG GCAA   C  
Sbjct:   209 GAGAACTTCATCCNTAAAGCAT-ACGGGTCCNTGGCATC-TTGTCCATG-GCAAATGCCT 265

Query:   182 CGAGG--ACACGAATGCGTCGTCCTTTTAT-AT-TACAATGA-AGGCCATGTCGTGGATG 236
              GA    ACAC AATG  TC  C  TTT T AT T CA TG  A G C TG  GTGG TG
Sbjct:   266 GGACCCAACACAAATGGTTCCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTG 323

Query:   237 AATGG-ACGCTACGTTGCGTTT-GGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCA 294
              ATGG A GC A GT G GTTT GGC  AGTGA AGA GGCATGAAT   GTGGAGGCCA
Sbjct:   324 GATGGCAAGC-ATGTGGTGTTTTGGCAAAGTGAAAGAAGGCATGAATANTGTGGAGGCCA 382

Query:   295 TCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GA 352
             T  A CG T T G  GT  A  A    CAA G CC   CAAG AGATTACCA    C GA
Sbjct:   383 TGGAACGCTTTTGG-GTCCAGGAATGGCAA-GACCAGCCAAGAAGATTACCAATNCCTGA 440

Query:   353 CTG 355
             CTG
Sbjct:   441 CTG 443


>cbil|dbest|1347370 AA643934 np42e08.s1 3' Lib=894[Homo_sapiens||breast|||]
            Length=552 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 552

  Minus Strand HSPs:

 Score = 344 (51.6 bits), Expect = 1.4e-09, P = 1.4e-09
 Identities = 208/325 (64%), Positives = 208/325 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   221 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 275

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   276 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 334

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   335 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 392

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   393 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 447

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   448 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 505

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA 34
             A A GTC CC CCC T AC CA   CCC  G AATA
Sbjct:   506 A-A-GTCACC-CCC-TGACACATAACCCTGG-AATA 536


>cbil|dbest|785650 AA147099 zo32g07.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=684 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 684

  Minus Strand HSPs:

 Score = 344 (51.6 bits), Expect = 1.5e-09, P = 1.5e-09
 Identities = 220/350 (62%), Positives = 220/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T   C CC  T CC TT TGG  T T G
Sbjct:   443 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGGCACCAGTGCCATTATGGCGTGT-G 500

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATA-CGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CC   CAC  A  CCC G G AATA   C G  AAA   GGA CCC T 
Sbjct:   501 A-A-GTCACCACCTGACACATAAACCCTG-G-AATAANTCTGTGAAAGCAGGAACCC-TA 555

Query:    10 TA 9
             TA
Sbjct:   556 TA 557


>cbil|dbest|1131221 AA488379 ab39c10.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=544 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 544

  Minus Strand HSPs:

 Score = 343 (51.5 bits), Expect = 1.6e-09, P = 1.6e-09
 Identities = 207/326 (63%), Positives = 207/326 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   225 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   339 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 396

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   397 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 451

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   452 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 509

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATAT 33
             A A GTC CC CCC T AC CA    CC  G AA AT
Sbjct:   510 A-A-GTCACCACCC-TGACACATAAACCCTGGAAAAT 543


>cbil|dbest|1292026 AA599285 ag35b06.s1 3'
            Lib=931[Homo_sapiens||bone_marrow_stroma|||mixed] Length=581
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 581

  Minus Strand HSPs:

 Score = 342 (51.3 bits), Expect = 1.7e-09, P = 1.7e-09
 Identities = 220/351 (62%), Positives = 220/351 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGTAAG 130
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT   
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGTTT- 443

Query:   129 ANTCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
               TC T T  AA  T TC  CCATAG   GA T   C CC  T CC TT TGG  T T G
Sbjct:   444 -CTCATCTTCAATTTCTCC-CCATAGATGGACTTGGCACCAGTGCCATTATGGCGTGT-G 500

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTGT 10
             A A GTC CC CC   CAC  A  CCC G G AATA  C G  AA    GGA CCC T T
Sbjct:   501 A-A-GTCACCACCTGACACATAA-CCCTG-G-AATAATCTGTGAAGCA-GGACCCCTTAT 554

Query:     9 AC 8
             AC
Sbjct:   555 AC 556


>cbil|dbest|1157659 AA513008 nh92f12.s1 3' Lib=894[Homo_sapiens||breast|||]
            Length=574 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 574

  Minus Strand HSPs:

 Score = 342 (51.3 bits), Expect = 1.7e-09, P = 1.7e-09
 Identities = 218/350 (62%), Positives = 218/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCCTTAGGATGAAGTT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T    AAA T  TC  CCATAG   GA T  CC CC  T CC TT  GG  T T  
Sbjct:   445 CTCATCCTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTTAGGCGTGTTA 503

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCTG 11
             A A GTC CC CCC T AC CA    CC  G AATA T C    AAA   GGA CCC T 
Sbjct:   504 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAATTCCTGTAAAGCAGGAACCCTTA 560

Query:    10 TA 9
             TA
Sbjct:   561 TA 562


>cbil|dbest|1346587 AA643151 nr96c02.s1 3'
            Lib=1017[Homo_sapiens|prostate|epithelium_(cell_line)|||]
            Length=618 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 618

  Minus Strand HSPs:

 Score = 341 (51.2 bits), Expect = 1.7e-09, P = 1.7e-09
 Identities = 217/349 (62%), Positives = 217/349 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   228 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 282

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   283 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 341

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   342 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 399

Query:   183 CGTTGTCGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN- 128
              GT   C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG   
Sbjct:   400 -GTCCACATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTTC 454

Query:   127 TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGA 69
             TC T T  AAA T  TC  CCATAG   GA T  CCC C  T CC TT TGG  T T GA
Sbjct:   455 TCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCCACAGTGCCATTATGGCGTGT-GA 512

Query:    68 GATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTGT 10
              A GTC C  CC   CAC  A  CCC G   AA  T C G  AAA   GGA CCC T T
Sbjct:   513 -A-GTCACACCCTGACACATAAACCCTGGATAAN-T-CTGTGAAAGCAGGA-CCCTTAT 566


>cbil|dbest|433552 N32177 yy25a12.s1 3' Lib=367[Homo_sapiens||melanocyte|||]
            Length=603 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 603

  Minus Strand HSPs:

 Score = 341 (51.2 bits), Expect = 1.8e-09, P = 1.8e-09
 Identities = 219/350 (62%), Positives = 219/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   220 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 274

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   275 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACATTGCTTG 334

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T   CA TG A AT  AAAA    GA  CATT GTGT  
Sbjct:   335 CCATCCAACCACT-CA-GTCTTGGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTG 392

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGA 129
               GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG 
Sbjct:   393 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGT 447

Query:   128 N-TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTA 71
               TC T T  AAA T  TC  CCATAG   GA T   C CC  T CC TT TGG  T T 
Sbjct:   448 TCTCATCTTCAAATTTCTCC-CCATAGATGGACTTGNCACCAGTGCCATTATGGCGTGT- 505

Query:    70 GAGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCCT 12
             GA A GTC  C  CC T AC CA    CC  G AATA T C G  AAA   GGA CCC T
Sbjct:   506 GA-A-GTCAACANCC-TGACACATAANCCTGG-AATAATTCTGTGAAAGCAGGAACCCTT 561

Query:    11 GTA 9
              TA
Sbjct:   562 ATA 564


>cbil|dbest|1131246 AA488404 ab37f11.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=538 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 538

  Minus Strand HSPs:

 Score = 341 (51.2 bits), Expect = 2.0e-09, P = 2.0e-09
 Identities = 207/325 (63%), Positives = 207/325 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   445 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 502

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA 34
             A A GTC CC CC   CAC  A  CCC G G AATA
Sbjct:   503 A-A-GTCACCCCCTGACACATAAACCCTG-G-AATA 534


>cbil|dbest|351513 H50303 yo28b10.r1 5'
            Lib=300[Homo_sapiens|brain||||55-year_old] Length=400 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);contains LTR1 repetitive element ;
            Length = 400

  Plus Strand HSPs:

 Score = 342 (51.3 bits), Expect = 2.4e-09, P = 2.4e-09
 Identities = 202/316 (63%), Positives = 202/316 (63%), Strand = Plus / Plus

Query:    48 TGGGTGATGGGAGGCGACATCTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTAT 107
             TG GT A GGG GG GAC TC C A  G CCA AA GG A  GG GG  A TC   CTAT
Sbjct:     7 TGTGTCA-GGGTGGTGACTTCAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTAT 62

Query:   108 GGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATT 164
             GG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC TC TT
Sbjct:    63 GGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TT 118

Query:   165 GGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA- 219
             G   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA TG  
Sbjct:   119 GTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCC 176

Query:   220 AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATG 278
             A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GGCATG
Sbjct:   177 AAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATG 233

Query:   279 AATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGA 337
             AAT T GTGGAGGCCAT  A CG T T G T  A    A   C  AAG CC  GCAAG A
Sbjct:   234 AATATTGTGGAGGCCATGGAGCGCTTTNGGTCCAGGGAATNGC--AAGACCA-GCAAGAA 290

Query:   338 GATTACCATCAGC-GACTGCGGTGTCA 363
             GAT ACCAT  GC GACTG GG G CA
Sbjct:   291 GATCACCATT-GCTGACTGTGG-GACA 315


>cbil|dbest|1771374 AI032123 os76b07.s1 3'
            Lib=939[Homo_sapiens||germ_cell_tumor|||] Length=542 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 542

  Minus Strand HSPs:

 Score = 338 (50.7 bits), Expect = 2.7e-09, P = 2.7e-09
 Identities = 210/330 (63%), Positives = 210/330 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  C CCC  T C  TT TGG  T T G
Sbjct:   444 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCACCCAGTGCA-TTATGGCGTGT-G 500

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA-TACGG 29
             A A GTC CC CCC T AC CA    CC  G AATA TAC G
Sbjct:   501 A-A-GTCACCACCC-TGACACATAAACCCTGGAATAATACTG 539


>cbil|dbest|1157660 AA513009 nh92g01.s1 3' Lib=894[Homo_sapiens||breast|||]
            Length=571 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 571

  Minus Strand HSPs:

 Score = 336 (50.4 bits), Expect = 3.2e-09, P = 3.2e-09
 Identities = 220/350 (62%), Positives = 220/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAG-TAACCCCCGTTTCCGTTGTGGTCTCTA 71
              TC T T  AAA T  TC  CCATAG   GA  T  C CC GT  CC T  TGG  T T 
Sbjct:   445 CTCATCTTCAAATTTCTCC-CCATAGATGGACCTTGCACCAGTGCCCATA-TGGCGTGT- 501

Query:    70 GAGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTG 11
             GA A GTC C  CC   CAC  A  CCCCG G AA AT C G  AA   TGGA CCC T 
Sbjct:   502 GA-A-GTCACACCCTGACACATAAACCCCG-GAAAAATTCTGTGAAGC-TGGAACCC-TA 556

Query:    10 TA 9
             TA
Sbjct:   557 TA 558


>cbil|dbest|820332 AA181295 zp68f08.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=561
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 561

  Minus Strand HSPs:

 Score = 336 (50.4 bits), Expect = 3.2e-09, P = 3.2e-09
 Identities = 216/345 (62%), Positives = 216/345 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   219 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 273

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   274 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 332

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAA     GA  CATT GTGT   
Sbjct:   333 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAANCTGGGAACCATTTGTGTTGG 390

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   391 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 445

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACG-AGTAACCCCCGTTTCCGTTGTGGTCTCTA 71
              TC T T  AAA T  TC  CCATAG A G A T  CC CC  T CC  T TGG  T T 
Sbjct:   446 CTCATCTTCAAATTTCTCC-CCATAGAATGGACTTGCCACCAGTGCCANTATGGCGTGT- 503

Query:    70 GAGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATA-CGGAAAAATGTGGATCCC 14
             GA A GTC CC  CC T AC CA    CC  G AATA   C G  AAA   GGA CCC
Sbjct:   504 GA-A-GTCACCANCC-TGACACATAAACCCTGGAATAANTCTGTGAAAGCAGGAACCC 558


>cbil|dbest|945180 AA303872 EST16549 5'-end
            Lib=830[Homo_sapiens|aorta||endothelial_cell||adult] Length=404
            Author_cmt: cyclophilin A
            Length = 404

  Plus Strand HSPs:

 Score = 339 (50.9 bits), Expect = 3.3e-09, P = 3.3e-09
 Identities = 211/335 (62%), Positives = 211/335 (62%), Strand = Plus / Plus

Query:    24 TTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACATCTCTAGAGACCACAA 82
             TTT  C G AT ATT C  GG    TG GT A GGG GG GAC TC C A  G CCA AA
Sbjct:     2 TTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTTCAC-AC-G-CCATAA 57

Query:    83 CGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACGANT-CTTACGCCATT 140
              GG A  GG GG  A TC   CTATGG   GA ATTT   A A GA   CTT   CC T 
Sbjct:    58 TGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-TA 115

Query:   141 CCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGC 196
                CA  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A CAC AATG 
Sbjct:   116 AAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGG 171

Query:   197 GTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGC 253
              TC    TTTT  AT T CA TG  A G C TG  GTGG TG  TGG A GC A GT G 
Sbjct:   172 TTCCCAGTTTTTNATCTGCACTGCCAAGAC-TGA-GTGGTTGGNTGGCAAGC-ATGTGGT 228

Query:   254 GTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAA 312
             GTTTGGC  AGTGA AGA GGCATGA T T GTGGAGGCCAT  A CG T T G T  A 
Sbjct:   229 GTTTGGCAAAGTGAAAGAAGGCATGANTATTGTGGAGGCCATGGAGCGCTTTGGGTCCAG 288

Query:   313 AACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   289 GA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 330


>cbil|dbest|1453124 AA738152 nx12a08.s1 3'
            Lib=1049[Homo_sapiens||pooled_germ_cell_tumors|||] Length=477
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 477

  Minus Strand HSPs:

 Score = 337 (50.6 bits), Expect = 3.4e-09, P = 3.4e-09
 Identities = 195/308 (63%), Positives = 195/308 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   149 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 203

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   204 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 262

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   263 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 320

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGTAAGANT 127
              GT    C TT GC CAT   CAA GA GCCAGG  CG   TGT  A  G  G AAG  T
Sbjct:   321 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCGGTATGTTTAG-GATG-AAGTCT 375

Query:   126 CGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGAGA 67
             C T T  AA  T TC  CCATAG   GA T  CC C GT  CC TT TGG  T T GA A
Sbjct:   376 CATCTTCAAGTTCTCC-CCATAGATGGACTTGCCACAGTG-CCATTATGGCGTGT-GA-A 431

Query:    66 TGTCGCCTCCCATCAC 51
              GTC CC CC   CAC
Sbjct:   432 -GTCACCACCTGACAC 446


>cbil|dbest|947057 AA305673 EST176747 5'-end
            Lib=838[Homo_sapiens|colon|colon|Caco-2|Human_colon_adenocarcinoma;
            ATCC_HTB_37|] Length=447
            Length = 447

  Plus Strand HSPs:

 Score = 336 (50.4 bits), Expect = 4.1e-09, P = 4.1e-09
 Identities = 216/346 (62%), Positives = 216/346 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:    93 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 151

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   152 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 207

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   208 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 262

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   263 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 320

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   321 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 379

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGCGACT 354
              CG T T G  GT  A      C  AAG CC  GCAAG AGAT ACCAT    GACT
Sbjct:   380 GCGTT-TNG--GTCCAGGNTTGC--AAGACCA-GCAAG-AGATCACCATTGTTGACT 429


>cbil|dbest|1207862 AA557481 nk60g01.s1 3'
            Lib=941[Homo_sapiens||Schwannoma_tumor|||] Length=548 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 548

  Minus Strand HSPs:

 Score = 334 (50.1 bits), Expect = 4.1e-09, P = 4.1e-09
 Identities = 214/341 (62%), Positives = 214/341 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T   C CC  T CC TT TGG  T T G
Sbjct:   444 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGTCACCAGTGCCATTATGGCGTGT-G 501

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGA 18
             A A GTC CC CC   CAC  A  CCC G G AATA  C G  AAA   GGA
Sbjct:   502 A-A-GTCACCACCTGACACATAA-CCCTG-G-AATAATCTGTGAAAGCAGGA 548


>cbil|dbest|1292886 AA600145 ae50d04.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=522 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 522

  Minus Strand HSPs:

 Score = 334 (50.1 bits), Expect = 4.3e-09, P = 4.3e-09
 Identities = 200/311 (64%), Positives = 200/311 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGTAAG 130
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT   
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGTTCT 445

Query:   129 ANTCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
               TC TT  GA   T TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   446 CATC-TTCAGATT-TCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 501

Query:    69 AGATGTCGCCTCCCATCACCCA 48
             A A GTC CC CCC T AC CA
Sbjct:   502 A-A-GTC-CCACCC-TGACACA 519


>cbil|dbest|1583786 AA858131 oe41g03.s1 3'
            Lib=1017[Homo_sapiens|prostate|epithelium_(cell_line)|||]
            Length=514 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 514

  Minus Strand HSPs:

 Score = 334 (50.1 bits), Expect = 4.3e-09, P = 4.3e-09
 Identities = 182/282 (64%), Positives = 182/282 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 394

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TGG  T G  T AAG  
Sbjct:   395 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGGTTTAGGATGAAGTT 449

Query:   127 -TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGG 77
              TC T T  AAA T  C  CCATAG   GA T  CC CC  T CC TT TGG
Sbjct:   450 CTCATCTTCAAATTTGCTCCCATAGATGGACTTGCCACCAGTGCCATTATGG 501


>cbil|dbest|1429539 AA722276 ag85c11.r1 5'
            Lib=525[Homo_sapiens|||||hNT_neurons] Length=529 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 529

  Minus Strand HSPs:

 Score = 333 (50.0 bits), Expect = 4.7e-09, P = 4.7e-09
 Identities = 195/303 (64%), Positives = 195/303 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   231 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 285

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   286 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 344

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   345 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 402

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   403 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 457

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   458 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 515

Query:    69 AGATGTCGCCTCCC 56
             A A GTC CC CCC
Sbjct:   516 A-A-GTCACCACCC 527


>cbil|dbest|1233671 AA583157 nn37b12.s1 3'
            Lib=990[Homo_sapiens||germ_cell_tumor|||] Length=521 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 521

  Minus Strand HSPs:

 Score = 333 (50.0 bits), Expect = 4.8e-09, P = 4.8e-09
 Identities = 195/303 (64%), Positives = 195/303 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 394

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   395 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 449

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   450 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 507

Query:    69 AGATGTCGCCTCCC 56
             A A GTC CC CCC
Sbjct:   508 A-A-GTCACCACCC 519


>cbil|dbest|948231 AA306921 EST177844 5'-end
            Lib=719[Homo_sapiens|||T-lymphocyte||] Length=500 Author_cmt:
            similar to cyclophilin A
            Length = 500

  Plus Strand HSPs:

 Score = 332 (49.8 bits), Expect = 5.5e-09, P = 5.5e-09
 Identities = 208/334 (62%), Positives = 208/334 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   173 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 231

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTCGATATTTTCCAAACGA 127
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG  GA A  TT  AA  GA
Sbjct:   232 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGG-GAGAAATTTGAA--GA 285

Query:   128 NTCTTACGCCATTCCACA-CG-ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
                  AC  CAT C A A C  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   286 TGNGAACTTCATCCTAAAGCATACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 342

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   343 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 400

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AG  GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   401 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGNNGGCATGAATATTGTGGAGGCCATGGA 459

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTA 342
              CG T T G T  A  A A   C AA G CC  GCAAG AGAT A
Sbjct:   460 GCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCA 500


>cbil|dbest|1204381 AA554013 nk35e08.s1 3' Lib=938[Homo_sapiens|colon|tumor|||]
            Length=527 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 527

  Minus Strand HSPs:

 Score = 331 (49.7 bits), Expect = 5.8e-09, P = 5.8e-09
 Identities = 197/308 (63%), Positives = 197/308 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   336 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 393

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   394 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 448

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   449 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 506

Query:    69 AGATGTCGCCTCCCATCAC 51
             A A GTC CC CC   CAC
Sbjct:   507 A-A-GTCACCACCTGACAC 523


>cbil|dbest|1273792 AA595110 no32a07.s1 3'
            Lib=994[Homo_sapiens|prostate|prostate_tumor|||] Length=527
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 527

  Minus Strand HSPs:

 Score = 331 (49.7 bits), Expect = 5.8e-09, P = 5.8e-09
 Identities = 219/350 (62%), Positives = 219/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   174 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 228

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   229 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 287

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   288 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 345

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   346 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 400

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T   C CC  T CC TT  GG  T T G
Sbjct:   401 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGGCACCAGTGCCATTAAGGCGTGT-G 458

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCTGT 10
             A A GTC C  CCC T AC CA G  CC  G AATAT C G  AA    GGA CCC T T
Sbjct:   459 A-A-GTCACA-CCC-TGACACATGAGCCTGG-AATATTCTGTGAAGCA-GGA-CCCTTAT 511

Query:     9 A 9
             A
Sbjct:   512 A 512


>cbil|dbest|1640044 AA911985 og21f09.s1 3'
            Lib=1081[Homo_sapiens|peripheral_nervous_system|dorsal_root_ganglio
            n|||] Length=639 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 639

  Minus Strand HSPs:

 Score = 328 (49.2 bits), Expect = 6.9e-09, P = 6.9e-09
 Identities = 218/347 (62%), Positives = 218/347 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAAACATTTGTGTTGG 394

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   395 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 449

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTG-TGGTCTCTA 71
              TC T T  AAA T  TC  CCA AG A GA T  CCC C   T C TT  TGG  T T 
Sbjct:   450 CTCATCTTCAAATTTCTCC-CCAAAG-ATGACTTGCCCACCAGTGCATTAATGGCTTGT- 506

Query:    70 GAGATGTCGCCTCCCATCACCC-ACGCCCCGCGCAATA-TACGGAAAAATGTGGATCCCC 13
             GA A GT  C  CCC   A C  A  CCCCG G AATA T C G  AAA G GG   CCC
Sbjct:   507 GAAA-GTAACAACCCTGAAACTTAAACCCCGGG-AATAATTCTGTGAAAGGAGGGAACCC 564

Query:    12 T 12
             T
Sbjct:   565 T 565


>cbil|dbest|825756 AA187503 zp65g12.r1 5'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=538
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 538

  Plus Strand HSPs:

 Score = 329 (49.4 bits), Expect = 7.0e-09, P = 7.0e-09
 Identities = 215/347 (61%), Positives = 215/347 (61%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   162 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 220

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTCGATATTTTCCAAACGA 127
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG  GA A  TT  AAA GA
Sbjct:   221 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGG-GAGAAATTTGAAA-GA 275

Query:   128 NTCTTACGCCATTCCACA-CG-ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
                  AC  CAT C A A C  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   276 TGAGAACTTCATCCTAAAGCATACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 332

Query:   184 AGG--ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A    ACAC AATG  TC    TTTT  A  T CA TG  A G C TG  GTGG TG AT
Sbjct:   333 ACCCAACACAAATGGTTCCCAGTTTTTCAACTGCACTGNCAAGAC-TGA-GTGGTTGGAT 390

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTT GC  AGTGA AGA GGCATGAAT T GTGGA GCCAT  A
Sbjct:   391 GGCAAGC-ATGTGGTGTTTTGCAAAGTGA-AGAAGGCATGAATATTGTGGANGCCATGGA 448

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTG 355
              CG   T G T  A  A A   C AA G CC  GC AG AGAT ACCA   GC GACTG
Sbjct:   449 GCGCCTTGGGTCCAGGA-ATGGC-AA-GACCA-GCCAGAAGATNACCANT-GCTGACTG 502


>cbil|dbest|1228327 AA580074 nl79h03.s1 3' Lib=895[Homo_sapiens||breast|||]
            Length=550 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 550

  Minus Strand HSPs:

 Score = 328 (49.2 bits), Expect = 7.6e-09, P = 7.6e-09
 Identities = 196/308 (63%), Positives = 196/308 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   228 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 282

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   283 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 341

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC- 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   342 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 399

Query:   184 -TCGTTGTCGTTGCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              T    G   TTGC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   400 GTACCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 455

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   456 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 513

Query:    69 AGATGTCGCCTCCCATCAC 51
             A A GTC CC CC   CAC
Sbjct:   514 A-A-GTCACCACCTGACAC 530


>cbil|dbest|1131241 AA488399 ab37f06.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=538 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 538

  Minus Strand HSPs:

 Score = 328 (49.2 bits), Expect = 7.7e-09, P = 7.7e-09
 Identities = 194/302 (64%), Positives = 194/302 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 450

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   451 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 508

Query:    69 AGATGTCGCCTCC 57
             A A GTC CC CC
Sbjct:   509 A-A-GTCACCCCC 519


>cbil|dbest|1229866 AA578756 nk93e02.s1 3' Lib=938[Homo_sapiens|colon|tumor|||]
            Length=557 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 557

  Minus Strand HSPs:

 Score = 326 (48.9 bits), Expect = 9.2e-09, P = 9.2e-09
 Identities = 196/310 (63%), Positives = 196/310 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   220 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 274

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   275 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 333

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   334 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 391

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   392 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 446

Query:   127 -TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTG-GTCTCTAG 70
              TC T T  AAA T TC  CCATAG   GA T  CC C GT  CC TT TG GT T  AG
Sbjct:   447 CTCATCTTCAAATT-TCTCCCATAGATGGACTTGCCACAGTG-CCATTATGCGTGTGAAG 504

Query:    69 AGATGTCGCCTCCCATCACCC 49
               A   C    C CAT ACCC
Sbjct:   505 TCACCACCTGACACATAACCC 525


>cbil|dbest|947183 AA305873 EST176873 5'-end
            Lib=719[Homo_sapiens|||T-lymphocyte||] Length=554 Author_cmt:
            similar to cyclophilin A
            Length = 554

  Plus Strand HSPs:

 Score = 326 (48.9 bits), Expect = 9.3e-09, P = 9.3e-09
 Identities = 190/300 (63%), Positives = 190/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   228 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 286

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   287 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 342

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   343 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 397

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   398 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 455

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   456 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 514

Query:   299 -CGATGTAGAT 308
              CG T T G T
Sbjct:   515 GCGCTTTNGGT 525


>cbil|dbest|1046785 AA405073 zu12f06.r1 5' Lib=628[Homo_sapiens|||||]
            Length=549 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 549

  Plus Strand HSPs:

 Score = 326 (48.9 bits), Expect = 9.3e-09, P = 9.3e-09
 Identities = 218/350 (62%), Positives = 218/350 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   155 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 213

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   214 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 269

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   270 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 324

Query:   184 AGG-AC-ACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A  AC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   325 ACCCAATACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 382

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   383 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 441

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGC 356
              CG T T G  GT A   A    CA A C    GCAAG AGAT AC AT  GC GACTG 
Sbjct:   442 GCGCTNTTGG-GTCAGGAATGTGCAGA-CA---GCAAGAAGATCAC-ATT-GCTGACTGT 494

Query:   357 GG 358
             GG
Sbjct:   495 GG 496


>cbil|dbest|954641 AA313332 EST185227 5'-end
            Lib=840[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=491 Author_cmt: cyclophilin A
            Length = 491

  Plus Strand HSPs:

 Score = 326 (48.9 bits), Expect = 1.0e-08, P = 1.0e-08
 Identities = 208/334 (62%), Positives = 208/334 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 450

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTA 342
              CG T T G T  A    A   C AA G CC  GCAAG AGAT A
Sbjct:   451 GCGCTTTGGGTCCAGGG-ATGGC-AA-GACCA-GCAAGAAGATCA 491


>cbil|dbest|958049 AA316720 EST188411 5'-end
            Lib=841[Homo_sapiens||colon|KM12SM|KM12C(HCC)metastasis_into_mouse_
            (liver)|] Length=491 Author_cmt: cyclophilin A
            Length = 491

  Plus Strand HSPs:

 Score = 326 (48.9 bits), Expect = 1.0e-08, P = 1.0e-08
 Identities = 208/334 (62%), Positives = 208/334 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 450

Query:   299 -CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTA 342
              CG T T G T  A    A   C AA G CC  GCAAG AGAT A
Sbjct:   451 GCGCTTTGGGTCCAGGG-ATGGC-AA-GACCA-GCAAGAAGATCA 491


>cbil|dbest|1204483 AA554115 nk35g11.s1 3' Lib=938[Homo_sapiens|colon|tumor|||]
            Length=533 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 533

  Minus Strand HSPs:

 Score = 325 (48.8 bits), Expect = 1.1e-08, P = 1.1e-08
 Identities = 175/271 (64%), Positives = 175/271 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGTCGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN- 128
              GT   C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG   
Sbjct:   396 GGTCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTTC 451

Query:   127 TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGT 88
             TC T T  AAA T TC  CCATAG   GA T  CC C GT
Sbjct:   452 TCATCTTCAAATT-TCTCCCATAGATGGACTTGCCACAGT 490


>cbil|dbest|115978 T61895 yb93d08.s1 3'
            Lib=252[Homo_sapiens|liver||||49_years_old] Length=500 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 500

  Minus Strand HSPs:

 Score = 325 (48.8 bits), Expect = 1.1e-08, P = 1.1e-08
 Identities = 185/282 (65%), Positives = 185/282 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCG-T-AAGA 129
              GT    C TT GC CAT   CAA GA GCCAGG GC  CGT TG   T G G T AAG 
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGG-GCC-CGTATGCTTTAGGGATGAAGT 443

Query:   128 N-TCGTTTGGAAAATA-TCGACCATAGCACG-AGTAACCCCCGTTTCCGTTGTGG 77
               TC T T  AAA T  TC  CCATAG A G A T  CC CC  T CC TT TGG
Sbjct:   444 TCTCATCTTCAAATTTCTCC-CCATAGGATGGACTTGCCACCAGTGCCATTATGG 497


>cbil|dbest|351401 H50191 yo27b12.r1 5'
            Lib=300[Homo_sapiens|brain||||55-year_old] Length=491 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);contains LTR1 repetitive element ;
            Length = 491

  Plus Strand HSPs:

 Score = 325 (48.8 bits), Expect = 1.2e-08, P = 1.2e-08
 Identities = 197/308 (63%), Positives = 197/308 (63%), Strand = Plus / Plus

Query:    48 TGGGTGATGGGAGGCGACATCTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTAT 107
             TG GT A GGG GG GAC TC C A  G CCA AA GG A  GG GG  A TC   CTAT
Sbjct:     8 TGTGTCA-GGGTGGTGACTTCAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTAT 63

Query:   108 GGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATT 164
             GG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC TC TT
Sbjct:    64 GGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TT 119

Query:   165 GGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA- 219
             G   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA TG  
Sbjct:   120 GTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCC 177

Query:   220 AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATG 278
             A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GGCATG
Sbjct:   178 AAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATG 234

Query:   279 AATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGA 337
             AAT T GTGGAGGCCAT  A CG T T G T  A    A   C AA G CC  GCAAG A
Sbjct:   235 AATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGG-ATGGC-AA-GACCA-GCAAGAA 290

Query:   338 GATTACCATCAGC-GACTG 355
             GAT ACCAT  GC GACTG
Sbjct:   291 GATCACCATT-GCTGACTG 308


>cbil|dbest|1229761 AA578651 ni48c04.s1 3'
            Lib=914[Homo_sapiens|lung|lung_tumor|||] Length=577 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 577

  Minus Strand HSPs:

 Score = 323 (48.5 bits), Expect = 1.2e-08, P = 1.2e-08
 Identities = 209/325 (64%), Positives = 209/325 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   220 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 274

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   275 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 333

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   334 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 391

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTCGTG-TGGAATGGCGTAAGA 129
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  TG T  AA G  G AAG 
Sbjct:   392 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTA-TGCTTTAA-GATG-AAGT 445

Query:   128 N-TCGTTTGGAAAATA-TCGACCATAGCACGAGTA-ACCCCCGTTTCCGTTGTGGTCTCT 72
               TC T T  AAA T  TC  CCATAG   GA T  AC CC GT  C  TT TGG  T T
Sbjct:   446 TCTCATCTTCAAATTTCTCC-CCATAGATGGACTTGACACCAGTGGCA-TTATGGCGTGT 503

Query:    71 AGAGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA 34
              G  A GTC CC CC   CAC  A G CCCG G AATA
Sbjct:   504 -GN-A-GTCACCACCTGACACATA-GACCCG-G-AATA 535


>cbil|dbest|958255 AA316947 EST188600 5'-end
            Lib=841[Homo_sapiens||colon|KM12SM|KM12C(HCC)metastasis_into_mouse_
            (liver)|] Length=468 Author_cmt: cyclophilin A
            Length = 468

  Plus Strand HSPs:

 Score = 324 (48.6 bits), Expect = 1.4e-08, P = 1.4e-08
 Identities = 190/300 (63%), Positives = 190/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   169 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 227

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   228 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 283

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   284 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 338

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   339 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 396

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   397 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 455

Query:   299 -CGATGTAGAT 308
              CG T T G T
Sbjct:   456 GCGCTTTGGGT 466


>cbil|dbest|955472 AA314143 EST186011 5'-end
            Lib=842[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=466 Author_cmt: cyclophilin A
            Length = 466

  Plus Strand HSPs:

 Score = 324 (48.6 bits), Expect = 1.4e-08, P = 1.4e-08
 Identities = 190/300 (63%), Positives = 190/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 450

Query:   299 -CGATGTAGAT 308
              CG T T G T
Sbjct:   451 GCGCTTTGGGT 461


>cbil|dbest|955426 AA314117 EST185967 5'-end
            Lib=842[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=461 Author_cmt: cyclophilin A
            Length = 461

  Plus Strand HSPs:

 Score = 324 (48.6 bits), Expect = 1.4e-08, P = 1.4e-08
 Identities = 190/300 (63%), Positives = 190/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 450

Query:   299 -CGATGTAGAT 308
              CG T T G T
Sbjct:   451 GCGCTTTGGGT 461


>cbil|dbest|1056758 AA412697 zu12f06.s1 3' Lib=628[Homo_sapiens|||||]
            Length=542 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 542

  Minus Strand HSPs:

 Score = 322 (48.3 bits), Expect = 1.4e-08, P = 1.4e-08
 Identities = 206/325 (63%), Positives = 206/325 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-AT-ATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT A AAA  G   AC CATT G  T  
Sbjct:   336 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAGAAACTGGGAAC-CATTTGAATTG 392

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGA 129
               GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG 
Sbjct:   393 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCCTTAGGATGAAGT 447

Query:   128 N-TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTA 71
               TC T TG AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T 
Sbjct:   448 TCTCATCTGCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT- 505

Query:    70 GAGATGTCGCCTCCCATCACCCACGCCCCGCGCAATA 34
             GA A GTC CC  CC T AC CA    CC  G AATA
Sbjct:   506 GA-A-GTCACCAACC-TGACACATAAACCCTGGAATA 539


>cbil|dbest|508604 W01619 za36d08.r1 5'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=461 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 461

  Plus Strand HSPs:

 Score = 323 (48.5 bits), Expect = 1.5e-08, P = 1.5e-08
 Identities = 189/300 (63%), Positives = 189/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   156 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 214

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   215 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 270

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   271 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 325

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C  G  GTGG TG AT
Sbjct:   326 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTNGA-GTGGTTGGAT 384

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   385 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 443

Query:   299 -CGATGTAGAT 308
              CG T T G T
Sbjct:   444 GCGCTTTGGGT 454


>cbil|dbest|948474 AA307166 EST178073 5'-end
            Lib=840[Homo_sapiens|colon|colon|KM12C|KM12C(HCC)-parental_human_co
            lon_carcinoma;Dukes_B2|] Length=452 Author_cmt: cyclophilin A
            Length = 452

  Plus Strand HSPs:

 Score = 323 (48.5 bits), Expect = 1.6e-08, P = 1.6e-08
 Identities = 183/287 (63%), Positives = 183/287 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCAT 295
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCAT 447


>cbil|dbest|1583893 AA858238 oe43e10.s1 3'
            Lib=1017[Homo_sapiens|prostate|epithelium_(cell_line)|||]
            Length=468 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 468

  Minus Strand HSPs:

 Score = 320 (48.0 bits), Expect = 2.0e-08, P = 2.0e-08
 Identities = 192/302 (63%), Positives = 192/302 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   170 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 224

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   225 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 283

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   284 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 341

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   342 -GTCAAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 396

Query:   127 -TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGA 69
              TC T T  AAA T TC  CCATAG   GA T   C  C  T CC TT TGG  T T GA
Sbjct:   397 CTCATCTTCAAATT-TCTCCCATAGATGGACTTGGCAACAGTGCCATTATGGCGTGT-GA 454

Query:    68 GATGTCGCCTCC 57
              AT TC CC CC
Sbjct:   455 -AT-TCACCACC 464


>cbil|dbest|1167726 AA523107 ni44b07.s1 3'
            Lib=914[Homo_sapiens|lung|lung_tumor|||] Length=531 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 531

  Minus Strand HSPs:

 Score = 318 (47.7 bits), Expect = 2.2e-08, P = 2.2e-08
 Identities = 200/318 (62%), Positives = 200/318 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC  T TGG  T T G
Sbjct:   445 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCCATATGGCGTGT-G 502

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCG 41
             A A GTC C  CC   CAC  A  CCC G
Sbjct:   503 A-A-GTCCCAACCTGACACTTAACCCCTG 529


>cbil|dbest|1226564 AA576164 nm60a03.s1 3'
            Lib=986[Homo_sapiens|breast|breast_tumor|||] Length=470 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 470

  Minus Strand HSPs:

 Score = 319 (47.9 bits), Expect = 2.3e-08, P = 2.3e-08
 Identities = 193/302 (63%), Positives = 193/302 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   170 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 224

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   225 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 283

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   284 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 341

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGTAAG 130
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT   
Sbjct:   342 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGTTCT 398

Query:   129 ANTCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
               TC TT  GA   T TC  CCATAG   GA T  CCC C  T CC TT TGG  T T G
Sbjct:   399 CATC-TTCAGATT-TCTCC-CCATAGATGGACTTGCCCACAGTGCCATTATGGCGTGT-G 454

Query:    69 AGATGTCGCCTCC 57
             A A GTC C  CC
Sbjct:   455 A-A-GTCACACCC 465


>cbil|dbest|1327839 AA629565 ad46a12.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=519 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 519

  Minus Strand HSPs:

 Score = 318 (47.7 bits), Expect = 2.3e-08, P = 2.3e-08
 Identities = 198/313 (63%), Positives = 198/313 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   209 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 263

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   264 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 322

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   323 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 380

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA   CAGG  C  CGT TG   T G  T AAG  
Sbjct:   381 -GTCCAGCATTTGC-CATGGACAA-GATNGCAGGACC--CGTATGCTTTAGGATGAAGTT 435

Query:   127 -TCGTTTGGAAAATATCGACC-ATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  A A T TC ACC ATAG   GA T  CC C GT  CC T  TGG C  T G
Sbjct:   436 CTCATCTTCANATT-TCTACCCATAGATGGACTTGCCACAGTGGCCATA-TGGGCG-T-G 491

Query:    69 AGATGTCGCCTCCCATCACCCACG 46
              GA GTC CC CCC T AC CA G
Sbjct:   492 TGAGGTCACCACCC-TGACACATG 514


>cbil|dbest|1421211 AA714498 nw23f06.s1 3'
            Lib=1051[Homo_sapiens|tonsil|germinal_center_B-cells|||] Length=508
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 508

  Minus Strand HSPs:

 Score = 318 (47.7 bits), Expect = 2.3e-08, P = 2.3e-08
 Identities = 182/282 (64%), Positives = 182/282 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   336 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 393

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   394 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 448

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGG 77
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG
Sbjct:   449 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGG 500


>cbil|dbest|830109 AA190588 zp86c10.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=505 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 505

  Minus Strand HSPs:

 Score = 318 (47.7 bits), Expect = 2.3e-08, P = 2.3e-08
 Identities = 182/282 (64%), Positives = 182/282 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGG 77
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG
Sbjct:   445 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGG 496


>cbil|dbest|1560253 AA838555 oe39d04.s1 
            Lib=1017[Homo_sapiens|prostate|epithelium_(cell_line)|||]
            Length=504 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 504

  Minus Strand HSPs:

 Score = 318 (47.7 bits), Expect = 2.3e-08, P = 2.3e-08
 Identities = 182/282 (64%), Positives = 182/282 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGG 77
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG
Sbjct:   443 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGG 494


>cbil|dbest|1233316 AA581977 nn36b01.s1 3'
            Lib=990[Homo_sapiens||germ_cell_tumor|||] Length=523 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 523

  Minus Strand HSPs:

 Score = 317 (47.6 bits), Expect = 2.5e-08, P = 2.5e-08
 Identities = 195/308 (63%), Positives = 195/308 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   215 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 269

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   270 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 328

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   329 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 386

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   387 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 441

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  A A T  TC  CCATAG   GA T  CC CC  T  C TT TGG  T T G
Sbjct:   442 CTCATCTTCANATTTCTCC-CCATAGATGGACTTGCCACCAGTNGCATTATGGCGTGT-G 499

Query:    69 AGATGTCGCCTCCCATCAC 51
             A A GTC CC CC   CAC
Sbjct:   500 A-A-GTCACCACCTGACAC 516


>cbil|dbest|1721305 AA984846 am93h07.s1 3'
            Lib=629[Homo_sapiens||schizophrenic_brain_S-11_frontal_lobe|||34_ye
            ars_old] Length=469 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 469

  Plus Strand HSPs:

 Score = 318 (47.7 bits), Expect = 2.5e-08, P = 2.5e-08
 Identities = 190/300 (63%), Positives = 190/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG--ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A    ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGCA-AGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGA 449

Query:   299 -CGATGTAGAT 308
              CG T T G T
Sbjct:   450 GCGCTTTGGGT 460


>cbil|dbest|1721303 AA984844 am93h05.s1 3'
            Lib=629[Homo_sapiens||schizophrenic_brain_S-11_frontal_lobe|||34_ye
            ars_old] Length=470 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 470

  Plus Strand HSPs:

 Score = 317 (47.6 bits), Expect = 2.8e-08, P = 2.8e-08
 Identities = 189/300 (63%), Positives = 189/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   164 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 222

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   223 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 278

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   279 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 333

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   334 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 391

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GC A GT G GTTTGG   AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A
Sbjct:   392 GGCAAGC-ATGTGGTGTTTGGAAAAGTGANAGAAGGCATGAATATTGTGGAGGCCATGGA 450

Query:   299 -CGATGTAGAT 308
              CG T T G T
Sbjct:   451 GCGCTTTGGGT 461


>cbil|dbest|826744 AA186644 zp63h12.r1 5'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=479
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 479

  Plus Strand HSPs:

 Score = 316 (47.4 bits), Expect = 3.0e-08, P = 3.0e-08
 Identities = 184/287 (64%), Positives = 184/287 (64%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   160 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 218

Query:    68 CTCTAGAGACCACAACGGAAACG-GG-GGTTACTCGTGCTATGGTC-GATATTTTCCAAA 124
             C C A  G CCA AA GG A CG GG GG  A TC   CTATGG   GA ATTT   A A
Sbjct:   219 CAC-AC-G-CCATAATGGCA-CGTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGA 273

Query:   125 CGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAA 181
              GA   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C  
Sbjct:   274 TGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTT 329

Query:   182 CGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGA 237
              GA   A CAC AATG GT     TTTT  A  T CA TG  A G C TG  GTGG TG 
Sbjct:   330 GGACCCAACACAAATG-GTNCCAGTTTTTCANCTGCACTGCCAAGACTTGA-GTGGTTGG 387

Query:   238 ATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCAT 295
             ATGG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT
Sbjct:   388 ATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCAT 445


>cbil|dbest|953030 AA311505 EST182444 5'-end
            Lib=719[Homo_sapiens|||T-lymphocyte||] Length=467 Author_cmt:
            cyclophilin A
            Length = 467

  Plus Strand HSPs:

 Score = 316 (47.4 bits), Expect = 3.1e-08, P = 3.1e-08
 Identities = 182/287 (63%), Positives = 182/287 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   174 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 232

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   233 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 288

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   289 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 343

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   344 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 401

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCAT 295
             GG A GC A GT G GTTTGGC  AGTGA AG  GGCATGAAT T GTGGAGGCCAT
Sbjct:   402 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGNAGGCATGAATATTGTGGAGGCCAT 457


>cbil|dbest|1847716 AI089246 qb09a05.x1 3'
            Lib=474[Homo_sapiens|uterus||||adult] Length=515 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 515

  Minus Strand HSPs:

 Score = 315 (47.3 bits), Expect = 3.1e-08, P = 3.1e-08
 Identities = 191/299 (63%), Positives = 191/299 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G   T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   336 CCATCCAACCACT-CA-GTATTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 393

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   394 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTNTAGGATGAAGTT 448

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T CC TT TGG  T T G
Sbjct:   449 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATGGCGTGT-G 506

Query:    69 AGATGTCGCC 60
             A A GTC CC
Sbjct:   507 A-A-GTCACC 514


>cbil|dbest|702166 AA070258 zm69b07.r1 5'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=465 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 465

  Plus Strand HSPs:

 Score = 314 (47.1 bits), Expect = 3.8e-08, P = 3.8e-08
 Identities = 190/300 (63%), Positives = 190/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   162 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 220

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   221 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 276

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGG-CGTCATTGGG-ATGTGCAACGACAAC 182
             A   CTT   CC T    CA  ACG G CCTGG C TC TTG   ATG GCAA   C   
Sbjct:   277 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGGCATC-TTGTCCATG-GCAAATGCTG- 331

Query:   183 GAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAA 238
             GA   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG A
Sbjct:   332 GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGA 389

Query:   239 TGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCC 297
             TGG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  
Sbjct:   390 TGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGG 448

Query:   298 A-CGATGTAGAT 308
             A CG T T G T
Sbjct:   449 AGCGCTTTGGGT 460


>cbil|dbest|105419 T52137 yb29h08.r1 5'
            Lib=251[Homo_sapiens|spleen|fetal_spleen|||fetal] Length=368
            Author_cmt: similar to gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN)
            Length = 368

  Plus Strand HSPs:

 Score = 315 (47.3 bits), Expect = 4.4e-08, P = 4.4e-08
 Identities = 185/291 (63%), Positives = 185/291 (63%), Strand = Plus / Plus

Query:    56 GGGAGGCGACATCTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GAT 114
             GGG GG GAC TC C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA 
Sbjct:     1 GGGTGGTGACTTCAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAA 57

Query:   115 ATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGT 171
             ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG 
Sbjct:    58 ATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG- 112

Query:   172 GCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATG 227
             GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG
Sbjct:   113 GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TG 170

Query:   228 TCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGT 286
               GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GT
Sbjct:   171 A-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGT 228

Query:   287 GGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCA 345
             GGAGGCCAT  A CG T T G T  A    A   C  AAG CC  GCAAG AGAT ACCA
Sbjct:   229 GGAGGCCATGGAGCGCTTTGGGTCCAGGGAATNGC--AAGACCA-GCAAGAAGATCACCA 285

Query:   346 T 346
             T
Sbjct:   286 T 286


>cbil|dbest|321705 R87887 yo47b03.r1 5'
            Lib=299[Homo_sapiens|brain||||55-year_old] Length=418 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 418

  Plus Strand HSPs:

 Score = 313 (47.0 bits), Expect = 4.7e-08, P = 4.7e-08
 Identities = 181/282 (64%), Positives = 181/282 (64%), Strand = Plus / Plus

Query:    77 CCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACGANT-CTTAC 134
             CCA AA  G A  GG GG  A TC   CTATGG   GA ATTT   A A GA   CTT  
Sbjct:     6 CCATAANNGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATGAGAACTTCA 64

Query:   135 GCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A-CAC 190
              CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A CAC
Sbjct:    65 TCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCAACAC 119

Query:   191 GAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACGCTA 247
              AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A GC A
Sbjct:   120 AAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-A 176

Query:   248 CGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATGTAG 306
              GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T T G
Sbjct:   177 TGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGG 236

Query:   307 ATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   237 GTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 284


>cbil|dbest|1326158 AA628414 af26c08.s1 3' Lib=843[Homo_sapiens|||||8-9_weeks]
            Length=475 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 475

  Plus Strand HSPs:

 Score = 311 (46.7 bits), Expect = 5.1e-08, P = 5.1e-08
 Identities = 181/287 (63%), Positives = 181/287 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   181 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 239

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   240 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 295

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACA--A 181
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   A
Sbjct:   296 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTGGA 351

Query:   182 CGAGGACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             C     CAC AA G  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   352 CCCCACCACAAAGGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 409

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCAT 295
             GG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT
Sbjct:   410 GGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCAT 465


>cbil|dbest|831316 AA192420 zp91b05.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=717 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 717

  Minus Strand HSPs:

 Score = 316 (47.4 bits), Expect = 5.2e-08, P = 5.2e-08
 Identities = 222/358 (62%), Positives = 222/358 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACATGGCTTG 336

Query:   241 CCATTC-ATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTC 186
             CCATTC A CCAC  CA G  CTT  CA TG A AT  AAAA    GA  CATT GTGT 
Sbjct:   337 CCATTCCAACCACT-CA-GTTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTT 394

Query:   185 CTCGTTGTCGTT-GCACATCC-CAATGACG-CCAGGCGCGTCGTGTGGAATGGCGT-AAG 130
                GT   C TT G  CAT   CAA GA G CCAGG  C  CGT TGG  T G  T AAG
Sbjct:   395 GG-GTCCGCATTTGGCCATGGACAA-GATGGCCAGGAACC-CGTATGGCTTAGGATGAAG 451

Query:   129 ANTCG--TT-TGGAAAATATCGACC-ATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCT 74
               TC   TT T  AAA T TC  CC ATAG   GA     CC C   T  G   T  T  
Sbjct:   452 TTTCTCATTCTTCAAATTTTCTCCCCATAGATGGAACTGGCCACCAGTG-GCCATTATGG 510

Query:    73 CTAGAGATGT-CGCCTCCCATCACCCACGCCCCGCGCAATA-TACGGAAAAATGTGGATC 16
             C  G GA GT C CC CCC   AC CA    CC CG AATA T CG  AAA  G GGA C
Sbjct:   511 CGTGTGAAGTTCACCACCCTGAACACATAAACC-CGGAATAATTCGTGAAA--GCGGAAC 567

Query:    15 CCCTGTACGTCAA 3
             CC T TA   CAA
Sbjct:   568 CC-TATAACCCAA 579


>cbil|dbest|105306 T52024 yb29h08.s1 3'
            Lib=251[Homo_sapiens|spleen|fetal_spleen|||fetal] Length=499
            Author_cmt: similar to gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN)
            Length = 499

  Minus Strand HSPs:

 Score = 310 (46.5 bits), Expect = 5.4e-08, P = 5.4e-08
 Identities = 168/256 (65%), Positives = 168/256 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GA  CATT GTGT  
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAACCATTTGTGTTG 394

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGA 129
               GT    C TT GC CAT   C A GA GCCAGG GC  CGT TG   T G GT AAG 
Sbjct:   395 GGGTCCAGCATTTGC-CATGGGCCAGGATGCCAGGGGCC-CGTATGCTTTAGGGTGAAGT 452

Query:   128 N-TCGTTTGGAAAATA-TCGACCATAG 104
               TC T T  AAA T  TC  CC TAG
Sbjct:   453 TCTCATCTTCAAATTTCTCC-CCNTAG 478


>cbil|dbest|826737 AA186637 zp63g12.r1 5'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=486
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 486

  Plus Strand HSPs:

 Score = 310 (46.5 bits), Expect = 5.6e-08, P = 5.6e-08
 Identities = 182/288 (63%), Positives = 182/288 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   163 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 221

Query:    68 CTCTAGAGACCACAACGGAA-ACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAAC 125
             C C A  G CCA AA GG A A GG GG  A TC   CTATGG   GA ATTT   A A 
Sbjct:   222 CAC-AC-G-CCATAATGGCACATGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGAT 277

Query:   126 GANT-CTTACGCC-ATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACA- 180
             GA   CTT   CC A   CA AC  CG G CCTGGC TC TTG   ATG   AA G    
Sbjct:   278 GAGAACTTCATCCTAAAGCATAC--CGGGTCCTGGCATC-TTGTCCATGNCAAATGCTGG 334

Query:   181 ACGAGGACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAA 238
             AC    ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG A
Sbjct:   335 ACCCA-ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGA 391

Query:   239 TGG-ACGC-TACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCAT 295
             TGG A GC T  G TG  TTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT
Sbjct:   392 TGGCAAGCATGTGGTGGTTTTGGCANAGTGAAAGAAGGCATGAATATTGTGGAGGCCAT 450


>cbil|dbest|1149892 AA505262 nh82g06.s1 3' Lib=894[Homo_sapiens||breast|||]
            Length=567 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 567

  Minus Strand HSPs:

 Score = 308 (46.2 bits), Expect = 5.9e-08, P = 5.9e-08
 Identities = 220/350 (62%), Positives = 220/350 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-AT-ATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT ATAAA  G   AC CATT GTGT  
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGATAAACTGGGAAC-CATTTGTGTTG 387

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGA 129
               GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG 
Sbjct:   388 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGT 442

Query:   128 N-TCGTTTGGAAAATATCGACCATAGC-ACG-AGTAACCCCCGTTTCCGTTGTGGTCTCT 72
               TC T T  A A T TCG CC  AGC A G A T   C  C  T CC TT TGG  T T
Sbjct:   443 TCTCATCTTCATATT-TCGCCCC-AGCGATGGACTTGGCAGCAGTGCCATTATGGCGTGT 500

Query:    71 AGAGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACGGAAAAATGTGGATCCCCT 12
              GA A GTC C  CCC T AC CA    CC  G AATA  C G   AA G GG T CCCT
Sbjct:   501 -GA-A-GTCACA-CCC-TGACACATAAACCTGG-AATAATCCGTGGAA-GCGG-TACCCT 552

Query:    11 GTA 9
              TA
Sbjct:   553 ATA 555


>cbil|dbest|1526118 AA804288 nw31g02.s1 3'
            Lib=1051[Homo_sapiens|tonsil|germinal_center_B-cells|||] Length=531
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 531

  Minus Strand HSPs:

 Score = 308 (46.2 bits), Expect = 6.3e-08, P = 6.3e-08
 Identities = 192/304 (63%), Positives = 192/304 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   233 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 287

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   288 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 346

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   347 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 404

Query:   183 CGTTGTCGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN- 128
              GT   C TT GC CAT   CAA GA G CAGG  C  CGT TG   T G  T AAG   
Sbjct:   405 -GTCAGCATTTGC-CATGGACAA-GATGACAGGA-CA-CGTATGCTTTAGGATGAAGTTC 459

Query:   127 TCGTTTGGAAAATATCGACC-ATAGCACGAGTA-ACCCCCGTTTCCGTTGTGGTCTCTAG 70
             TC T T  A AAT TC  CC ATAG   GA T  AC CC GT  C GT  TGG  T T G
Sbjct:   460 TCATCTT-ACAATTTCTCCCCATAGATGGACTTGACACCAGTGACAGTA-TGGCGTGT-G 516

Query:    69 AGATGTCGCCTCCCA 55
             AG    C CCT  CA
Sbjct:   517 AGTCACCACCTGACA 531


>cbil|dbest|724899 AA088556 zl89d07.r1 5' Lib=486[Homo_sapiens|colon||||]
            Length=497 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 497

  Plus Strand HSPs:

 Score = 308 (46.2 bits), Expect = 6.7e-08, P = 6.7e-08
 Identities = 190/300 (63%), Positives = 190/300 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   176 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 234

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   235 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 290

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   291 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 345

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   346 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 403

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGAC-GGCATGAATGTCGTGGAGGCCATCC 297
             GG A GC A GT G GTTTGGC  AGTGA AGA  GGCATGAAT T GTGGAGGCCAT  
Sbjct:   404 GGCAAGC-ATGTGGTGTTTGGCA-AGTGAAAGAAAGGCATGAATATTGTGGAGGCCATGG 461

Query:   298 A-CGATGTAGAT 308
             A CG T T G T
Sbjct:   462 AGCGCTTTGGGT 473


>cbil|dbest|1233126 AA581787 nn39e11.s1 3'
            Lib=990[Homo_sapiens||germ_cell_tumor|||] Length=444 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 444

  Minus Strand HSPs:

 Score = 309 (46.4 bits), Expect = 6.8e-08, P = 6.8e-08
 Identities = 169/255 (66%), Positives = 169/255 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   115 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 169

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   170 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 228

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA GG CTT  CA TG A AT  AAAA    GA  CATT GTGT  
Sbjct:   229 CCATCCAACCACT-CA-GGTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTG 286

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGA 129
               GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG 
Sbjct:   287 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGT 341

Query:   128 N-TCGTTTGGAAAATATCGACCATAG 104
               TC T T  AAA T TC  CCATAG
Sbjct:   342 TCTCATCTTCAAATT-TCTCCCATAG 366


>cbil|dbest|1495862 AA774081 ac36a03.s1 3'
            Lib=525[Homo_sapiens|||||hNT_neurons] Length=488 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 488

  Minus Strand HSPs:

 Score = 308 (46.2 bits), Expect = 6.8e-08, P = 6.8e-08
 Identities = 174/269 (64%), Positives = 174/269 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   336 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 393

Query:   183 CGTTGTCGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN- 128
              GT   C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG   
Sbjct:   394 -GTCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTTC 448

Query:   127 TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCC 90
             TC T T  AAA T  TC  CCATAG   GA T  CC CC
Sbjct:   449 TCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACC 486


>cbil|dbest|789210 AA151947 zo02h07.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=547 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 547

  Minus Strand HSPs:

 Score = 306 (45.9 bits), Expect = 7.5e-08, P = 7.5e-08
 Identities = 166/254 (65%), Positives = 166/254 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACATGGCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTTC-ATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T C A TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   337 CCATCCAACCACTTCA-GTCTTNCCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTCGTGTGGAATGGCGTAAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  TG    A G  G AAG  
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTA-TGCTTTANGNTG-AAGTT 450

Query:   127 -TCGTTTGGAAAATA-TCGACCATA 105
              TC T T  AAA T  TC  CCATA
Sbjct:   451 CTCATCTTNAAATTTCTCC-CCATA 474


>cbil|dbest|1328062 AA629788 ad44a01.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=429 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 429

  Plus Strand HSPs:

 Score = 308 (46.2 bits), Expect = 7.8e-08, P = 7.8e-08
 Identities = 180/280 (64%), Positives = 180/280 (64%), Strand = Plus / Plus

Query:    79 ACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACGANT-CTTACGC 136
             A AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A GA   CTT   C
Sbjct:     1 ATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATGAGAACTTCATC 59

Query:   137 CATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A-CACGA 192
             C T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A CAC A
Sbjct:    60 C-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCAACACAA 114

Query:   193 ATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACGCTACG 249
             ATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A GC A G
Sbjct:   115 ATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATG 171

Query:   250 TTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATGTAGAT 308
             T G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T T G T
Sbjct:   172 TGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGT 231

Query:   309 GTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
               A  A A   C AA G CC  GCAAGGAGAT ACCA   GC GACTG GG
Sbjct:   232 CCAGGA-ATGGC-AA-GACCA-GCAAGGAGATCACCAAT-GCTGACTGTGG 277


>cbil|dbest|301278 H40227 yn85f12.r1 5'
            Lib=300[Homo_sapiens|brain||||55-year_old] Length=483 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 483

  Plus Strand HSPs:

 Score = 305 (45.8 bits), Expect = 9.4e-08, P = 9.4e-08
 Identities = 181/287 (63%), Positives = 181/287 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   152 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 210

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   211 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 266

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   267 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 321

Query:   184 AGG--ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A    ACAC  ATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   322 ACCCAACACANATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 379

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGT-GATAGACGGCATGAATGTCGTGGAGGCCAT 295
             GG A GC   GT G GTTTGGC  AGT GA AGA GGCATGAAT T GTGGAGGCCAT
Sbjct:   380 GGCAAGCATNGTGGTGTTTGGCAAAGTNGAAAGAAGGCATGAATATTGTGGAGGCCAT 437


>cbil|dbest|804143 AA165509 zo81b06.s1 3'
            Lib=510[Homo_sapiens|||||adult,_64_years] Length=574 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 574

  Minus Strand HSPs:

 Score = 303 (45.5 bits), Expect = 9.8e-08, P = 9.8e-08
 Identities = 207/344 (60%), Positives = 207/344 (60%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   232 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTACCAT-TCCTGGACC-CAA-AGC 286

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   287 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 345

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC 185
             C AT CA CCAC  CA G C T   CA TG A AT  AAAA    GA  CATT G GT  
Sbjct:   346 CNATCCAACCACT-CA-GTCTTGGGCAGTGCAGATGAAAAACTGGGAACCATTTGGGTTG 403

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTCGTGTGGAATGGCGTAAGA 129
               GT    C TT GC CAT   CAA GA GCCAGG C CGT  TG    A GG   AAG 
Sbjct:   404 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTA-TGCTTTAGGGATGAAGT 459

Query:   128 N-TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
                C T T  AA  T  C  CCA AG   GA T   C CC     C  T TGG  T T  
Sbjct:   460 TCNCATNTTNAATTTCNCCCCCANAGANGGACTTGNCNCCANGGGCCATATGGNGTGTTN 519

Query:    69 AGATGTCGCCTCCCATCACCCACG-CCCCGCGCAATATACGGAAAAATGTGGATCC 15
             AG  GTC CC CCC T AC CA    CCCG G AA  T   G  AAA G GGA CC
Sbjct:   520 AG--GTC-CC-CCCNTGACACATAANCCCGGGAAANTTTTTGTTAAAGGGGGACCC 571


>cbil|dbest|1312439 AA614738 np53e07.s1 3' Lib=894[Homo_sapiens||breast|||]
            Length=549 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 549

  Minus Strand HSPs:

 Score = 303 (45.5 bits), Expect = 1.0e-07, P = 1.0e-07
 Identities = 207/333 (62%), Positives = 207/333 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GT T   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTATTGG 389

Query:   183 CGTTGT-CGTTGCACATCC-CAATGACGCCAGG-CGCGTCGTG-TGGAATGGCGTAAGAN 128
              GT    C TTGC CAT   CAA GA GCCAGG C CGT  TG T  AA G  G AAG  
Sbjct:   390 -GTCCAGCATTGC-CATGGACAA-GATGCCAGGACCCGTA-TGCTTTAA-GATG-AAGTT 443

Query:   127 -TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGA 69
              TC T T  AA  T TC  CCATAG   GA T  C  CC  T CC T   GG  T T GA
Sbjct:   444 CTCATCTTCAATTTCTCC-CCATAGATGGACTTGCAACCAGTGCCATAA-GGCGTGT-GA 500

Query:    68 GATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACG-GAAA 26
              A GTC CC CC   CAC  A  CC  G   AAT T  G GAAA
Sbjct:   501 -A-GTCACCACCTGACACATAAACCTGGAATAAT-TCTGTGAAA 541


>cbil|dbest|1698162 AA961807 or41e04.s1 3'
            Lib=1049[Homo_sapiens||pooled_germ_cell_tumors|||] Length=523
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 523

  Minus Strand HSPs:

 Score = 303 (45.5 bits), Expect = 1.1e-07, P = 1.1e-07
 Identities = 175/281 (62%), Positives = 175/281 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA   ATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGGAAAACTGGGAACAATTTGTGTTGG 395

Query:   183 CGTTGTCGTT-GCACATCCCAATGACGCCAGGCGCGTCGTGTGGAATGGCGTAAGANTCG 125
              GT   C TT GCA A   CAA GA GC AGG  C  CG  TG    GG   A G  TC 
Sbjct:   396 -GTCAGCATTTGCA-AGGACAA-GATGC-AGGAAC--CGGATGCTTAGGATGAGGTCTCA 449

Query:   124 TTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTG 78
             T T  AAA T TC  CCATAG   GA T  CC CC  T CC TT TG
Sbjct:   450 TCTTCAAATTCTCC-CCATAGATGGACTTGCCACCAGTGCCATTATG 495


>cbil|dbest|991283 AA349974 EST56963 5'-end
            Lib=688[Homo_sapiens|brain||||infant] Length=453 Author_cmt:
            cyclophilin A
            Length = 453

  Plus Strand HSPs:

 Score = 304 (45.6 bits), Expect = 1.1e-07, P = 1.1e-07
 Identities = 182/287 (63%), Positives = 182/287 (63%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   160 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 218

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   219 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 274

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   275 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 329

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   330 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 387

Query:   240 GG-ACGCTACGTTGCGTTT-GGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCAT 295
             GG A GC A GT G GTTT GGC  AGTGA AGA GGCATGAAT T  TGGAGGCCAT
Sbjct:   388 GGCAAGC-ATGTGGTGTTTTGGCAAAGTGAAAGAAGGCATGAATATTTTGGAGGCCAT 444


>cbil|dbest|1202481 AA552113 nk05f09.s1 3' Lib=937[Homo_sapiens|colon|tumor|||]
            Length=552 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 552

  Minus Strand HSPs:

 Score = 302 (45.3 bits), Expect = 1.1e-07, P = 1.1e-07
 Identities = 194/309 (62%), Positives = 194/309 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 394

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   395 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 449

Query:   127 -TCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAGA 69
              TC T T  AAA T TC   CATAG   GA T   C  C  T C  TT TGG  T T GA
Sbjct:   450 CTCATCTTCAAATT-TCTCGCATAGATGGACTTGGCAGCAGTGCAATTATGGCGTGT-GA 507

Query:    68 GATGTCGCCTC-C-CATCACC 50
             G    C CCT  C CAT ACC
Sbjct:   508 GTCACCACCTGACACATAACC 528


>cbil|dbest|534327 W26508 30e3 
            Lib=433[Homo_sapiens|eye|retina|||adult] Length=400
            Length = 400

  Plus Strand HSPs:

 Score = 304 (45.6 bits), Expect = 1.3e-07, P = 1.3e-07
 Identities = 180/284 (63%), Positives = 180/284 (63%), Strand = Plus / Plus

Query:    75 GACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACGANT-CTT 132
             GA  A AA GGA   GG GG  A TC   CTATGG   GA ATTT   A A GA   CTT
Sbjct:     8 GAGAATAATGGACT-GGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATGAGAACTT 65

Query:   133 ACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A-C 188
                CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A C
Sbjct:    66 CATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCAAC 120

Query:   189 ACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACGC 245
             AC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A GC
Sbjct:   121 ACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAAGC 178

Query:   246 TACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATGT 304
              A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T T
Sbjct:   179 -ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTT 237

Query:   305 AGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGCGACTGCGG 358
              G T  A  A A   C AA G CC  GCAAG AGAT ACCAT    GACTG GG
Sbjct:   238 GGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATTGNTGACTGTGG 287


>cbil|dbest|1198586 AA548546 nk50a06.s1 3'
            Lib=939[Homo_sapiens||germ_cell_tumor|||] Length=558 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 558

  Minus Strand HSPs:

 Score = 300 (45.0 bits), Expect = 1.4e-07, P = 1.4e-07
 Identities = 206/332 (62%), Positives = 206/332 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGC  TCT TCACT   CCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCGTTCTTTCACTTTTCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT C  CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCGACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAAACATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGTAAG 130
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATGG GT   
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGGAGTTCT 445

Query:   129 ANTCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
               TC T    AA  T TC  CCATAG   GA T  CC  C  T CC TT TGG  T T G
Sbjct:   446 CATCCTCA--AATTTCTCC-CCATAGATGGACTTGCCAGCAGTGCCATTATGGCGTGT-G 501

Query:    69 AGATGTCGCCTCCCATCACCCACGCCCCGCGCAATATACG-GAA 27
             A A GTC C  CCC   A   A  CCCCG   AA AT CG GAA
Sbjct:   502 A-A-GTCACAGCCCGGGAATTAAACCCCGGATAA-ATCCGTGAA 542


>cbil|dbest|1583535 AA857880 oh99d09.s1 3'
            Lib=1103[Homo_sapiens|pharynx|squamous_cell_carcinoma|||]
            Length=483 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 483

  Minus Strand HSPs:

 Score = 301 (45.2 bits), Expect = 1.4e-07, P = 1.4e-07
 Identities = 167/255 (65%), Positives = 167/255 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGA-CGCCAGGCGCGTCGTGTGGAATGGCGTAAGAN 128
              GT    C TT GC CAT   CAA GA CGCCAGG  CGT  TG    A G  G AAG  
Sbjct:   396 -GTCAAGCATTTGC-CATGGACAA-GATCGCCAGGACCGTA-TGCTTTAGGATG-AAGTT 450

Query:   127 -TCGTTTGGAAAATATCGACCATAG 104
              TC T T  A AAT TC  CCATAG
Sbjct:   451 CTCATCTT-ACAATTTCTCCCATAG 474


>cbil|dbest|717400 AA082168 zn42g02.r1 5'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=461
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 461

  Plus Strand HSPs:

 Score = 300 (45.0 bits), Expect = 1.7e-07, P = 1.7e-07
 Identities = 188/300 (62%), Positives = 188/300 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:   146 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 204

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAACG 126
             C C A  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT   A A G
Sbjct:   205 CAC-AC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGA-AGATG 260

Query:   127 ANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             A   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   G
Sbjct:   261 AGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-G 315

Query:   184 AGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   316 ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 373

Query:   240 GGAC-GCTACGTTGCGTTTGGCCGA-GTGATAGACGGCATGAATGTCGTGGAGGCCATCC 297
             GG   GC A GT G GTTTGG C A GTGA AGA GGCATGA T T GTGGAGGCCAT  
Sbjct:   374 GGCNAGC-ATGTGGTGTTTGGGCAAAGTGAAAGAAGGCATGANTATTGTGGAGGCCATGG 432

Query:   298 A-CGATGTAGAT 308
             A CG T T G T
Sbjct:   433 AGCGCTTTGGGT 444


>cbil|dbest|1263770 AA586394 no56g09.s1 3'
            Lib=995[Homo_sapiens||synovial_sarcoma|||] Length=526 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 526

  Minus Strand HSPs:

 Score = 298 (44.7 bits), Expect = 1.8e-07, P = 1.8e-07
 Identities = 196/311 (63%), Positives = 196/311 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGTAAG 130
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT   
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGTTCT 446

Query:   129 ANTCGTTTGGAAAATATCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGGTCTCTAG 70
               TC TT  GA   T TC  CCATAG   GA T  CC  C  T C   T TGG  T T G
Sbjct:   447 CATC-TTCAGATT-TCTCC-CCATAGATGGACTTGCCAACAGTGCACATATGGCGTGT-G 502

Query:    69 AGATGTCGCCTCCCATCACCCA 48
             A A GTC C  CCC T AC CA
Sbjct:   503 A-A-GTCACA-CCC-TGACACA 520


>cbil|dbest|1367543 AA661937 nt96e09.s1 
            Lib=919[Homo_sapiens||metastatic_prostate_bone_lesion|||]
            Length=469 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 469

  Plus Strand HSPs:

 Score = 299 (44.9 bits), Expect = 1.8e-07, P = 1.8e-07
 Identities = 165/251 (65%), Positives = 165/251 (65%), Strand = Plus / Plus

Query:   108 GGTCGATATTTTCCAAACGANT-CTTACGCC-ATTCCACACGACGCGCCTGGCGTCATTG 165
             GGTCGA ATTT   A A GA   CTT   CC A  CCA AC   G  CCTGGC TC TTG
Sbjct:     1 GGTCGACATTTGA-AGATGAGAACTTCATCCTAAACCATACTG-GT-CCTGGCATC-TTG 56

Query:   166 GG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-A 220
                ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA TG  A
Sbjct:    57 TCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCA 114

Query:   221 GGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGA 279
              G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GGCATGA
Sbjct:   115 AGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGA 171

Query:   280 ATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAG 338
             AT T GTGGAGGCCAT  A CG T T G T  A  A A   C AA G CC  GCAAG AG
Sbjct:   172 ATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAG 227

Query:   339 ATTACCATCAGC-GACTGCGG 358
             AT ACCAT  GC GACTG GG
Sbjct:   228 ATCACCATT-GCTGACTGTGG 247


>cbil|dbest|1638259 AA910302 og80d10.s1 3'
            Lib=1104[Homo_sapiens|ovary|serous_adenocarcinoma|||] Length=467
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 467

  Minus Strand HSPs:

 Score = 299 (44.9 bits), Expect = 1.8e-07, P = 1.8e-07
 Identities = 161/251 (64%), Positives = 161/251 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   336 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 393

Query:   183 CGTTGTCGTT-GCACATCCCAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGANTC 126
              GTT  C TT GC  A   CAA GA GCC GG  C  CGT TGG  T G  T AAG  TC
Sbjct:   394 -GTTCACATTTGCCAAGGACAA-GATGCCCGGACC--CGTATGGCTTAGGATGAAG-TTC 448

Query:   125 GTTTGGAAAATATCGACC 108
                T   AAAT TC  CC
Sbjct:   449 CCATCTTAAATTTCTCCC 466


>cbil|dbest|836061 AA196975 zq60h01.s1 3'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=483 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 483

  Minus Strand HSPs:

 Score = 298 (44.7 bits), Expect = 2.0e-07, P = 2.0e-07
 Identities = 174/269 (64%), Positives = 174/269 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCC 90
              TC T T  AAA T  TC  CCATAG   GA T  CC CC
Sbjct:   443 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACC 481


>cbil|dbest|1843905 AI085525 qf24a08.x1 3'
            Lib=1331[Homo_sapiens|brain|anaplastic_oligodendroglioma|||]
            Length=483 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 483

  Minus Strand HSPs:

 Score = 298 (44.7 bits), Expect = 2.0e-07, P = 2.0e-07
 Identities = 174/269 (64%), Positives = 174/269 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 444

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCC 90
              TC T T  AAA T  TC  CCATAG   GA T  CC CC
Sbjct:   445 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACC 483


>cbil|dbest|835605 AA196519 zq59f05.s1 3'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=512 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 512

  Minus Strand HSPs:

 Score = 297 (44.6 bits), Expect = 2.0e-07, P = 2.0e-07
 Identities = 181/282 (64%), Positives = 181/282 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATA-AAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  A AAA    GA  CATT GTGT  
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGGANAAACTGGGAACCATTTGTGTTG 389

Query:   184 --TCGTTGTCGTTGCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGA 129
               TC       TTGC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG 
Sbjct:   390 GGTCCAGCATTTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGT 445

Query:   128 N-TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCC-GTTTCCGTTGTGG 77
               TC T T  AAA T  TC  CCATAG   GA T  CC  C GT  CC TT TGG
Sbjct:   446 TCTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCANCAGTGGCCATTATGG 499


>cbil|dbest|1605695 AA878854 of88a12.s1 3'
            Lib=1077[Homo_sapiens|liver|hepatic_adenoma|||] Length=695
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 695

  Minus Strand HSPs:

 Score = 302 (45.3 bits), Expect = 2.3e-07, P = 2.3e-07
 Identities = 182/282 (64%), Positives = 182/282 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   226 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 280

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   281 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 339

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   340 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 397

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   398 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 452

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAG-TAACCCCCGTTTCCGTTGTGG 77
              TC T T  AAAAT  TC  CCATA    GAG T  C CC GT  CC TT  GG
Sbjct:   453 CTCATCTTCAAAATTCTCC-CCATAATG-GAGCTTGCACCAGTGGCCTTTAGGG 504


>cbil|dbest|1344790 AA641322 nr91a07.s1 3'
            Lib=1017[Homo_sapiens|prostate|epithelium_(cell_line)|||]
            Length=361 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 361

  Minus Strand HSPs:

 Score = 299 (44.9 bits), Expect = 2.4e-07, P = 2.4e-07
 Identities = 175/271 (64%), Positives = 175/271 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:    50 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 104

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   105 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 163

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   164 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 221

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   222 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 276

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGT 88
              TC T T  AAA T  TC  CCATAG   GA T  C CC GT
Sbjct:   277 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCACCAGT 317


>cbil|dbest|857967 AA218635 zq14b05.s1 3' Lib=552[Homo_sapiens|||||] Length=487
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 487

  Minus Strand HSPs:

 Score = 294 (44.1 bits), Expect = 2.9e-07, P = 2.9e-07
 Identities = 166/255 (65%), Positives = 166/255 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCCCA-ATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGTAAG 130
              GT    C TT GC CAT   A A GA GCCAGG C CGT  G T T G ATG  GT   
Sbjct:   388 -GTCCAGCATTTGC-CATGGGACAAGATGCCAGGACCCGTATGCTTTAGGATGAAGTTCT 445

Query:   129 ANTCGTTTGGAAAATATCGACCATAG 104
               TC TT   AA  T TC  CCATAG
Sbjct:   446 CATCCTTCA-AATTTCTCC-CCATAG 469


>cbil|dbest|1604984 AA878143 oi04a08.s1 3'
            Lib=1103[Homo_sapiens|pharynx|squamous_cell_carcinoma|||]
            Length=480 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 480

  Minus Strand HSPs:

 Score = 294 (44.1 bits), Expect = 3.0e-07, P = 3.0e-07
 Identities = 170/261 (65%), Positives = 170/261 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGTC 241
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   240 -CATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
              CAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 TCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TGG  T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGGTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAG 98
              TC T T  AAA T  TC  CCATAG   GAG
Sbjct:   444 GTCATCTTCAAATTTCTCC-CCATAGATGGAG 474


>cbil|dbest|136150 T73793 yc54a04.s1 3'
            Lib=252[Homo_sapiens|liver||||49_years_old] Length=472 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 472

  Minus Strand HSPs:

 Score = 294 (44.1 bits), Expect = 3.0e-07, P = 3.0e-07
 Identities = 154/227 (67%), Positives = 154/227 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTAATAT-AAAAG--GACGACGCATTCGTGTC 186
             CCAT CA CCAC  CA GGC T  CA TG A  AT AAAA   G  GA  CATT GTGT 
Sbjct:   332 CCATCCAACCACT-CAGGGCTTGGCAGTGCAGGATGAAAAACTGGGGAACCATTTGTGTT 390

Query:   185 CTCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGT-GGAATGG 136
                GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T GG ATGG
Sbjct:   391 GG-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGGCCCGTATGCTTTAGGGATGG 444


>cbil|dbest|1201323 AA550955 nj35a07.s1 3'
            Lib=927[Homo_sapiens|adrenal_gland|adrenal_adenoma|||] Length=470
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 470

  Minus Strand HSPs:

 Score = 292 (43.8 bits), Expect = 3.7e-07, P = 3.7e-07
 Identities = 166/255 (65%), Positives = 166/255 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT T G  T G  T AAG  
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGA-C--CGTATNGCTTAGGATGAAGTC 443

Query:   127 TCGTTTGGAAAATATCGACCATAG 104
             TC T T  AA  T TC  CCATAG
Sbjct:   444 TCATCTTCAATTTCTC--CCATAG 465


>cbil|dbest|1226683 AA576283 nm60g04.s1 3'
            Lib=986[Homo_sapiens|breast|breast_tumor|||] Length=473 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 473

  Minus Strand HSPs:

 Score = 291 (43.7 bits), Expect = 4.1e-07, P = 4.1e-07
 Identities = 167/255 (65%), Positives = 167/255 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAG 104
              TC T T  AAA T  TC  CCATAG
Sbjct:   444 CTCATCTTCAAATTTCTCC-CCATAG 468


>cbil|dbest|1631998 AA903967 ob16c04.s1 3' Lib=1045[Homo_sapiens|kidney||||]
            Length=472 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 472

  Minus Strand HSPs:

 Score = 291 (43.7 bits), Expect = 4.1e-07, P = 4.1e-07
 Identities = 167/255 (65%), Positives = 167/255 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 443

Query:   127 -TCGTTTGGAAAATA-TCGACCATAG 104
              TC T T  AAA T  TC  CCATAG
Sbjct:   444 CTCATCTTCAAATTTCTCC-CCATAG 468


>cbil|dbest|1719887 AA983428 or45f01.s1 3'
            Lib=1049[Homo_sapiens||pooled_germ_cell_tumors|||] Length=503
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 503

  Minus Strand HSPs:

 Score = 290 (43.5 bits), Expect = 4.3e-07, P = 4.3e-07
 Identities = 156/237 (65%), Positives = 156/237 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   271 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 325

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   326 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 384

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   385 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 442

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTCGTGTGGAATGGCGTAAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  TG   AA G  G AAG  
Sbjct:   443 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTA-TGCTTAAGGATG-AAGTC 497

Query:   127 TCGTTT 122
             TC T T
Sbjct:   498 TCATCT 503


>cbil|dbest|815362 AA176371 zp30h04.s1 3'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=451 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 451

  Minus Strand HSPs:

 Score = 291 (43.7 bits), Expect = 4.3e-07, P = 4.3e-07
 Identities = 151/227 (66%), Positives = 151/227 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACATTGCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   C A GA GC AGG C CGT  G T T G ATGG GT
Sbjct:   389 -GTCNAGCATTTGC-CATGGGCCA-GATGCNAGGACNCGTATGCTTTAGGATGGAGT 442


>cbil|dbest|810080 AA171787 zo97a02.r1 5'
            Lib=510[Homo_sapiens|||||adult,_64_years] Length=437 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 437

  Plus Strand HSPs:

 Score = 291 (43.7 bits), Expect = 4.5e-07, P = 4.5e-07
 Identities = 167/255 (65%), Positives = 167/255 (65%), Strand = Plus / Plus

Query:   104 CTATGGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGT 160
             CTATGG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC T
Sbjct:    11 CTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCAT 67

Query:   161 CATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAA 216
             C TTG   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA 
Sbjct:    68 C-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCAC 124

Query:   217 TGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGG 274
             TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GG
Sbjct:   125 TGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGG 181

Query:   275 CATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCA 333
             CATGAAT T GTGGAGGCCAT  A CG T T G T  A  A A   C AA G CC  GCA
Sbjct:   182 CATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCA 237

Query:   334 AGGAGATTACCATCAGC-GACTGCGG 358
             AG AGAT ACCAT  GC GACTG GG
Sbjct:   238 AGAAGATCACCATT-GCTGACTGTGG 262


>cbil|dbest|940875 AA299336 EST12090 5'-end
            Lib=693[Homo_sapiens|uterus||||adult] Length=387 Author_cmt:
            cyclophilin A
            Length = 387

  Plus Strand HSPs:

 Score = 291 (43.7 bits), Expect = 5.1e-07, P = 5.1e-07
 Identities = 167/255 (65%), Positives = 167/255 (65%), Strand = Plus / Plus

Query:   104 CTATGGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGT 160
             CTATGG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC T
Sbjct:     4 CTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCAT 60

Query:   161 CATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAA 216
             C TTG   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA 
Sbjct:    61 C-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCAC 117

Query:   217 TGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGG 274
             TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GG
Sbjct:   118 TGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGG 174

Query:   275 CATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCA 333
             CATGAAT T GTGGAGGCCAT  A CG T T G T  A  A A   C AA G CC  GCA
Sbjct:   175 CATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCA 230

Query:   334 AGGAGATTACCATCAGC-GACTGCGG 358
             AG AGAT ACCAT  GC GACTG GG
Sbjct:   231 AGAAGATCACCATT-GCTGACTGTGG 255


>cbil|dbest|1658871 AA927108 oi58f02.s1 3'
            Lib=1103[Homo_sapiens|pharynx|squamous_cell_carcinoma|||]
            Length=486 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 486

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.5e-07, P = 5.5e-07
 Identities = 166/255 (65%), Positives = 166/255 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   388 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACC--CGTATGCCTTAGGATGAAGTT 442

Query:   127 -TCGTTTGGAAAATA-TCGACCATAG 104
              TC T T  AAA T  T   CCATAG
Sbjct:   443 CTCATCTTCAAATTTCTTCCCCATAG 468


>cbil|dbest|943165 AA301713 EST14900 5'-end
            Lib=815[Homo_sapiens|aorta||endothelial_cell||adult] Length=353
            Author_cmt: cyclophilin A
            Length = 353

  Plus Strand HSPs:

 Score = 291 (43.7 bits), Expect = 5.5e-07, P = 5.5e-07
 Identities = 167/255 (65%), Positives = 167/255 (65%), Strand = Plus / Plus

Query:   104 CTATGGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGT 160
             CTATGG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC T
Sbjct:     9 CTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCAT 65

Query:   161 CATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAA 216
             C TTG   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA 
Sbjct:    66 C-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCAC 122

Query:   217 TGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGG 274
             TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GG
Sbjct:   123 TGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGG 179

Query:   275 CATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCA 333
             CATGAAT T GTGGAGGCCAT  A CG T T G T  A  A A   C AA G CC  GCA
Sbjct:   180 CATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCA 235

Query:   334 AGGAGATTACCATCAGC-GACTGCGG 358
             AG AGAT ACCAT  GC GACTG GG
Sbjct:   236 AGAAGATCACCATT-GCTGACTGTGG 260


>cbil|dbest|818511 AA179515 zp48d12.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=482 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 482

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.5e-07, P = 5.5e-07
 Identities = 166/255 (65%), Positives = 166/255 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   336 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 393

Query:   183 CGTTGT-CGTT-GCACATCCCA-ATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   A A GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   394 -GTCCAGCATTTGC-CATGGGACAAGATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 449

Query:   127 -TCGT-TTGGAAAATATCGACCATAG 104
              TC T TT  AA  T TC  CCATAG
Sbjct:   450 CTCATCTTCCAATTTCTCC-CCATAG 474


>cbil|dbest|1345069 AA641633 nr80b12.s1 3'
            Lib=1016[Homo_sapiens|prostate|invasive_tumor_(cell_line)|||]
            Length=472 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 472

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.7e-07, P = 5.7e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 449


>cbil|dbest|871920 AA232221 zr25e06.s1 3'
            Lib=536[Homo_sapiens|brain|neuroepithelial_cells|||Ntera-2_neuroepi
            thelial_cells] Length=469 Author_cmt: gb:X52851_rna1
            PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 469

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.7e-07, P = 5.7e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   239 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 293

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   294 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 352

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   353 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 410

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   411 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 464


>cbil|dbest|1233498 AA582159 nn44e03.s1 3'
            Lib=990[Homo_sapiens||germ_cell_tumor|||] Length=467 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 467

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.7e-07, P = 5.7e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 449


>cbil|dbest|772383 AA132313 zo17g07.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=465 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 465

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.7e-07, P = 5.7e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 394

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   395 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 448


>cbil|dbest|1324251 AA626507 ab50d10.r1 5'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=460 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);contains Alu repetitive element;
            Length = 460

  Plus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.8e-07, P = 5.8e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Plus / Plus

Query:   133 ACGCCATTCCACA-CG-ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A 187
             AC  CAT C A A C  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A
Sbjct:    10 ACTTCATCCTAAAGCATACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCA 66

Query:   188 -CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
              CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    67 ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 124

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:   125 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 183

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   184 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 235


>cbil|dbest|1328083 AA629809 ad44c03.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=460 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);contains Alu repetitive element;
            Length = 460

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.8e-07, P = 5.8e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   221 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 275

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   276 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 334

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   335 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAAACATTTGTGTTGG 392

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   393 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 446


>cbil|dbest|1829954 AI075018 oq97g09.x1 3'
            Lib=988[Homo_sapiens|colon|colon_tumor|||] Length=457 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 457

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.8e-07, P = 5.8e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   219 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 273

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   274 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 332

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   333 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 390

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   391 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 444


>cbil|dbest|827306 AA187031 zp62g07.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=456
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 456

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.9e-07, P = 5.9e-07
 Identities = 144/213 (67%), Positives = 144/213 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GA  CATT GTGT  
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAACCATTTGTGTTT 395

Query:   184 TCGTTGT-CGTT--GCACATCC-CAATGACGCCAGG-CGCGT 148
               GT    C TT  GC CAT   CAA GA GCCAGG C CGT
Sbjct:   396 GGGTCCAGCATTTTGCCCATGGACAA-GATGCCAGGACCCGT 436


>cbil|dbest|1232556 AA582535 nn50f10.s1 3'
            Lib=991[Homo_sapiens|kidney|kidney_tumor|||] Length=453 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 453

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 5.9e-07, P = 5.9e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 449


>cbil|dbest|825535 AA187292 zp60d02.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=445
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 445

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 6.0e-07, P = 6.0e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   389 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 442


>cbil|dbest|738684 AA100337 zl81h12.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=444 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 444

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 6.0e-07, P = 6.0e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 389

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   390 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 443


>cbil|dbest|820143 AA181106 zp67c09.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=420
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 420

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 6.4e-07, P = 6.4e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   174 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 228

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   229 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 287

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   288 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 345

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   346 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 399


>cbil|dbest|1409433 AA702813 zi90d01.s1 3'
            Lib=452[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=438 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 438

  Minus Strand HSPs:

 Score = 287 (43.1 bits), Expect = 6.8e-07, P = 6.8e-07
 Identities = 143/211 (67%), Positives = 143/211 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   225 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   339 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 396

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGT 148
              GT    C TT GC CAT   CAA GA GCCAGG C CGT
Sbjct:   397 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGT 433


>cbil|dbest|826547 AA186446 zp70h03.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=484
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 484

  Minus Strand HSPs:

 Score = 286 (42.9 bits), Expect = 6.8e-07, P = 6.8e-07
 Identities = 146/215 (67%), Positives = 146/215 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   209 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 263

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   264 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTT 322

Query:   241 -CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAG-GACGA-CGCATTCGTG 188
              CCAT CA CCAC  CA G C TT  CA TG A AT  AAAA  G  GA C CATT GTG
Sbjct:   323 GCCATCCAACCACTTCA-GTCTTTGGCAGTGCAGATGAAAAACTGGGGAACCCATTTGTG 381

Query:   187 TCCTCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGT 148
             T    GT    C TT GC CAT   CAA GA GCCAGG C CGT
Sbjct:   382 TTTGGGTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGT 423


>cbil|dbest|702493 AA070523 zm58a02.r1 5' Lib=494[Homo_sapiens|||||] Length=417
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 417

  Plus Strand HSPs:

 Score = 287 (43.1 bits), Expect = 7.1e-07, P = 7.1e-07
 Identities = 143/211 (67%), Positives = 143/211 (67%), Strand = Plus / Plus

Query:   148 ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCC 203
             ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A CAC AATG  TC    
Sbjct:    16 ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAG 72

Query:   204 TTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGC 260
             TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC
Sbjct:    73 TTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGC 129

Query:   261 CGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAA 319
               AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T T G T  A  A A   
Sbjct:   130 AAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGG 188

Query:   320 CCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
             C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   189 C-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 224


>cbil|dbest|772329 AA132462 zo07g12.r1 5'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=414
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 414

  Plus Strand HSPs:

 Score = 287 (43.1 bits), Expect = 7.2e-07, P = 7.2e-07
 Identities = 143/211 (67%), Positives = 143/211 (67%), Strand = Plus / Plus

Query:   148 ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCC 203
             ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A CAC AATG  TC    
Sbjct:     9 ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAG 65

Query:   204 TTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGC 260
             TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC
Sbjct:    66 TTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGC 122

Query:   261 CGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAA 319
               AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T T G T  A  A A   
Sbjct:   123 AAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGG 181

Query:   320 CCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
             C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   182 C-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 217


>cbil|dbest|1430493 AA723160 zg88e02.s1 3'
            Lib=424[Homo_sapiens|heart||||19_weeks] Length=459 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 459

  Minus Strand HSPs:

 Score = 286 (42.9 bits), Expect = 7.2e-07, P = 7.2e-07
 Identities = 150/226 (66%), Positives = 150/226 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCCCAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   A  GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   389 -GTCCAGCATTTGC-CATGGAACAGATGCCAGGACCCGTATGCTTTAGGATGAAGT 442


>cbil|dbest|682404 AA056565 zl66g02.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=456 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 456

  Minus Strand HSPs:

 Score = 286 (42.9 bits), Expect = 7.2e-07, P = 7.2e-07
 Identities = 150/226 (66%), Positives = 150/226 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG--GACGACGCATTCGTGTC 186
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA   G  GA  CATT GTGT 
Sbjct:   331 CCATCCAACCACTTCA-GTCTTGGCAGTGCAGATGGAAAAACTGGGGAACCATTTGTGTT 389

Query:   185 CTCGTTGT-CGTT-GCACATCCCAATGACGCCAGG-CGCGTC-G-TGTGGAATGG 136
                GT    C TT GC CAT    A GA GCCAGG C CGT  G T T G ATGG
Sbjct:   390 GG-GTCCAGCATTTGC-CATGGANAAGATGCCAGGACCCGTATGCTTTAGGATGG 442


>cbil|dbest|1231886 AA581453 nd88g12.s1 3'
            Lib=996[Homo_sapiens||bulk_alveolar_tumor|||] Length=455
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 455

  Minus Strand HSPs:

 Score = 286 (42.9 bits), Expect = 7.2e-07, P = 7.2e-07
 Identities = 148/226 (65%), Positives = 148/226 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   214 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 268

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   269 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 327

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   328 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAA-CATTTGTGTTGG 384

Query:   183 CGTTGTCGTTGCACATCCCAATGACGCCAGG-CGCGTCG-TGTGGAATGGCGT 133
              GT   C TTGC CAT    A GA GC AGG C CG  G T T GA TG  GT
Sbjct:   385 GGTCAGCATTGC-CATGGACAGGATGC-AGGACCCGATGCTTTAGA-TGAAGT 434


>cbil|dbest|477368 N71274 za36d08.s1 3'
            Lib=262[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=441 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 441

  Minus Strand HSPs:

 Score = 286 (42.9 bits), Expect = 7.5e-07, P = 7.5e-07
 Identities = 140/206 (67%), Positives = 140/206 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   227 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 281

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   282 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACATTGCTTG 341

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GA  CATT GTGT  
Sbjct:   342 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAACCATTTGTGTTG 399

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG 153
               GT    C TT GC CAT   CAA GA GCCAGG
Sbjct:   400 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGG 431


>cbil|dbest|786985 AA152368 zo07b07.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=468
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 468

  Minus Strand HSPs:

 Score = 285 (42.8 bits), Expect = 7.8e-07, P = 7.8e-07
 Identities = 151/227 (66%), Positives = 151/227 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A   C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAAAGCC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   339 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 396

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   397 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 450


>cbil|dbest|702067 AA069956 zm69b07.s1 3'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=453 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 453

  Minus Strand HSPs:

 Score = 285 (42.8 bits), Expect = 8.1e-07, P = 8.1e-07
 Identities = 151/227 (66%), Positives = 151/227 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCCCA-ATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   A A GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   389 -GTCCAGCATTTGC-CATGGGACAAGATGCCAGGACCCGTATGCTTTAGGATGAAGT 443


>cbil|dbest|434924 N33549 yy04e04.s1 3' Lib=367[Homo_sapiens||melanocyte|||]
            Length=481 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 481

  Minus Strand HSPs:

 Score = 284 (42.6 bits), Expect = 8.4e-07, P = 8.4e-07
 Identities = 152/228 (66%), Positives = 152/228 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   228 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 282

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   283 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 341

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T   CA TG A AT  AAAA    GA  CATT GTGT  
Sbjct:   342 CCATCCAACCACTTCA-GTCTTGGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTG 400

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
               GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   401 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 455


>cbil|dbest|859077 AA219762 zr01g10.r1 5'
            Lib=536[Homo_sapiens|brain|neuroepithelial_cells|||Ntera-2_neuroepi
            thelial_cells] Length=478 Author_cmt: gb:X52851_rna1
            PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 478

  Plus Strand HSPs:

 Score = 284 (42.6 bits), Expect = 8.5e-07, P = 8.5e-07
 Identities = 188/300 (62%), Positives = 188/300 (62%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGAT-GGGAGGCGACA 66
             TA A GGG TCC   TTT  C G AT ATT C  GG    TG GT    GGG GG G C 
Sbjct:   172 TATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTTTCAGGGTGGTG-CT 230

Query:    67 TCTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAAC 125
             TC C A  G CCA AA GGA   GG GG  A TC   CTATGG   GA ATTT   A A 
Sbjct:   231 TCAC-AC-G-CCATAATGGACT-GGTGGA-AGTCCATCTATGGGGAGAAATTTGA-AGAT 284

Query:   126 GANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAAC 182
             GA   CTT   CC T    CA  ACG G CCTGGC TC TTG   ATG GCAA   C   
Sbjct:   285 GAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG- 339

Query:   183 GAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAA 238
             GA   A CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG A
Sbjct:   340 GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGA 397

Query:   239 TGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCC 297
             TGG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  
Sbjct:   398 TGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGG 456

Query:   298 A-CGATGTAGAT 308
             A CG T T G T
Sbjct:   457 AGCGCTTTGGGT 468


>cbil|dbest|1012292 AA370754 EST82714 5'-end
            Lib=787[Homo_sapiens|prostate||||adult,_21_yrs] Length=287
            Author_cmt: cyclophilin A
            Length = 287

  Plus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 9.3e-07, P = 9.3e-07
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Plus / Plus

Query:   133 ACGCCATTCCACA-CG-ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A 187
             AC  CAT C A A C  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A
Sbjct:    15 ACTTCATCCTAAAGCATACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCA 71

Query:   188 -CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
              CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    72 ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 129

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:   130 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 188

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   189 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 240


>cbil|dbest|1375814 AA670230 ae94g09.s1 3'
            Lib=931[Homo_sapiens||bone_marrow_stroma|||mixed] Length=432
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 432

  Minus Strand HSPs:

 Score = 284 (42.6 bits), Expect = 9.4e-07, P = 9.4e-07
 Identities = 142/211 (67%), Positives = 142/211 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCAT-TCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CAT T GTGT  
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATCTTGTGTTG 388

Query:   184 TCGTT-GT-CGTTGCACATCCCAATGACGCCAGG-CGCGT 148
               GT  G  C TTGCA    C AA GA GCCAGG C CGT
Sbjct:   389 GGGTCAGCACTTTGCATGGAC-AA-GATGCCAGGACCCGT 426


>cbil|dbest|1159606 AA514890 nh72a04.s1 
            Lib=892[Homo_sapiens||prostate|||] Length=485 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 485

  Minus Strand HSPs:

 Score = 282 (42.3 bits), Expect = 1.0e-06, P = 1.0e-06
 Identities = 164/255 (64%), Positives = 164/255 (64%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   235 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 289

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCA AC C AC T GC T 
Sbjct:   290 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAGACACCACAT-GCTTG 348

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G  CT  CA TG A AT  AAAA  G  GA  C TT GTGT  
Sbjct:   349 CCATCCAACCACT-CA-GTTCTGGCAGTGCAGATGAAAAACTGGGGAACCTTTGGTGTTG 406

Query:   184 TCGTT-GTCGTTGCACATCCCAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGANT 127
               GT  G C TTGC CAT    A GA GCCAG C C  CGT TG   TGG GT AAG  T
Sbjct:   407 G-GTCAGGCATTGC-CATGGACA-GATGCCAGAC-C--CGTATGCTTTGG-GTGAAG-TT 458

Query:   126 CGTTTGGAAAATATCGACCATAG 104
             C   T   AAAT T   CCAT G
Sbjct:   459 CTCATCTTAAATTTTTCCCATGG 481


>cbil|dbest|772330 AA132463 zo07g12.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=433
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 433

  Minus Strand HSPs:

 Score = 283 (42.5 bits), Expect = 1.0e-06, P = 1.0e-06
 Identities = 143/211 (67%), Positives = 143/211 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GA  CATT GTGT  
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAACCATTTGTGTTG 387

Query:   184 TCGTTGT-CGTT-GCACATCCCA-ATGACGCCAGG-CGCGT 148
               GT    C TT GC CAT   A A GA GCCAGG C CGT
Sbjct:   388 G-GTCCAGCATTTGC-CATGGGACAAGATGCCAGGACCCGT 426


>cbil|dbest|662580 AA045841 zl67b11.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=433 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 433

  Minus Strand HSPs:

 Score = 282 (42.3 bits), Expect = 1.2e-06, P = 1.2e-06
 Identities = 144/212 (67%), Positives = 144/212 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   219 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 273

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   274 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 332

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAG-GACGACGCATTCGTGTC 186
             CCAT CA CCAC  CA G C T   CA TG A AT  AAAA  G  GA  CATT GTGT 
Sbjct:   333 CCATCCAACCACTCCA-GTCTTGGGCAGTGCAGATGAAAAACTGGGGAACCATTTGTGTT 391

Query:   185 CTCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGT 148
                GT    C TT GC CAT   CAA GA GCCAGG C CGT
Sbjct:   392 GG-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGT 430


>cbil|dbest|79941 T29908 EST99745 3'-end Lib=224[Homo_sapiens|pancreas||||]
            Length=470 Author_cmt: cyclophilin A (HT:2074)
            Length = 470

  Minus Strand HSPs:

 Score = 281 (42.2 bits), Expect = 1.2e-06, P = 1.2e-06
 Identities = 147/217 (67%), Positives = 147/217 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   225 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T G  T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GNTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTC-GTGTC 186
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GAC CATT  GTGT 
Sbjct:   339 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAC-CATTTTGTGTT 395

Query:   185 CTCGTTGT-CGTT-GCACATC-CCAATGACGCCAGGCGCGTCGTGTG 142
                GT    C TT GC CAT   CAA GA GCCAGG GC  CGT TG
Sbjct:   396 GGGGTCCAGCATTTGC-CATGGNCAA-GATGCCAGG-GCC-CGTATG 438


>cbil|dbest|1347843 AA644407 zu85a10.s1 3' Lib=628[Homo_sapiens|||||]
            Length=420 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 420

  Minus Strand HSPs:

 Score = 281 (42.2 bits), Expect = 1.3e-06, P = 1.3e-06
 Identities = 139/206 (67%), Positives = 139/206 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 388

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG 153
              GTT   C TT GC CAT   CAA GA G CAGG
Sbjct:   389 -GTTCAGCATTTGC-CATGGACAA-GATGACAGG 419


>cbil|dbest|1021239 AA379930 EST92825 5'-end
            Lib=667[Homo_sapiens|skin||||adult] Length=334 Author_cmt:
            cyclophilin A
            Length = 334

  Plus Strand HSPs:

 Score = 283 (42.5 bits), Expect = 1.3e-06, P = 1.3e-06
 Identities = 167/255 (65%), Positives = 167/255 (65%), Strand = Plus / Plus

Query:   104 CTATGGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGT 160
             CTATGG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC T
Sbjct:     8 CTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCAT 64

Query:   161 CATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAA 216
             C TTG   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA 
Sbjct:    65 C-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTNATCTGCAC 121

Query:   217 TGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGG 274
             TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GG
Sbjct:   122 TGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGG 178

Query:   275 CATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCA 333
             CATGAAT T GTGGAGGCCAT  A CG T T G T  A  A A   C AA G CC  GCA
Sbjct:   179 CATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCA 234

Query:   334 AGGAGATTACCATCAGC--GACTGCGG 358
             AG AGAT ACCAT  GC  GACTG GG
Sbjct:   235 AGAAGATCACCATT-GCTTGACTGTGG 260


>cbil|dbest|997971 AA356663 EST65248 5'-end
            Lib=724[Homo_sapiens|||T-lymphocyte||] Length=328 Author_cmt:
            cyclophilin A
            Length = 328

  Plus Strand HSPs:

 Score = 283 (42.5 bits), Expect = 1.4e-06, P = 1.4e-06
 Identities = 167/255 (65%), Positives = 167/255 (65%), Strand = Plus / Plus

Query:   104 CTATGGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGT 160
             CTATGG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC T
Sbjct:     9 CTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCAT 65

Query:   161 CATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAA 216
             C TTG   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA 
Sbjct:    66 C-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCAC 122

Query:   217 TGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGG 274
             TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GG
Sbjct:   123 TGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGG 179

Query:   275 CATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCA 333
             CATGAAT T GTGGAGGCCAT  A CG T T G T  A  A A   C AA G CC  GCA
Sbjct:   180 CATGAATATTGTGGAGGCCATGGAGCGCTTTNGGTCCAGGA-ATGGC-AA-GACCA-GCA 235

Query:   334 AGGAGATTACCATCAGC-GACT-GCGG 358
             AG AGAT ACCAT  GC GACT G GG
Sbjct:   236 AGAAGATCACCATT-GCTGACTTGTGG 261


>cbil|dbest|785880 AA147348 zo39c04.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=426
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 426

  Minus Strand HSPs:

 Score = 280 (42.0 bits), Expect = 1.4e-06, P = 1.4e-06
 Identities = 142/211 (67%), Positives = 142/211 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 387

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGT 148
              GT    C TT GC CAT   C A GA GCCAGG C CGT
Sbjct:   388 -GTCCAGCATTTGC-CATGGACNA-GATGCCAGGACCCGT 424


>cbil|dbest|595825 W87520 zh67f11.r1 5'
            Lib=452[Homo_sapiens|Liver_and_Spleen||||20_week-post_conception_fe
            tus] Length=471 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 471

  Plus Strand HSPs:

 Score = 279 (41.9 bits), Expect = 1.4e-06, P = 1.4e-06
 Identities = 213/350 (60%), Positives = 213/350 (60%), Strand = Plus / Plus

Query:     9 TACAGGGGATCCACATTTTTCCGTAT-ATTGCGCGGGGCGTGGGTGATGGGAGGCGACAT 67
             TA A G G TCC   TTT  C G AT ATT C  GG    TG GT A GGG GG GAC T
Sbjct:     7 TATAAGAGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCA-GGGTGGTGACTT 65

Query:    68 CTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GATATTTTCCAAAC- 125
             C  TA  G CCA AA GG A  GG GG  A TC   CTATGG   GA ATTT    A   
Sbjct:    66 CA-TAC-G-CCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGATGATGA 122

Query:   126 GANTCTTACGCC-ATTCCACACGACGCGCCTGGCGTCATTGGG-ATGTGCAACGACAACG 183
             GA  CTT   CC A   CA AC A G  CCTGGC T  TTG   ATG GCAA   C   G
Sbjct:   123 GAA-CTTCATCCTAAAGCATAC-AGGT-CCTGGCATG-TTGTCCATG-GCAAATGCTG-G 176

Query:   184 AGG--ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAAT 239
             A    A AC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG AT
Sbjct:   177 ACCCAATACAAATGGTTCCCAGTTTTTAATCTGCACTGCCAAGAC-TGA-GTGGTTGGAT 234

Query:   240 GG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA 298
             GG A GCT  GT G  TTTGGC   GTGA   ACGGCATGAAT T GTGGAGGCCAT  A
Sbjct:   235 GGCAAGCTT-GTGGTCTTTGGCAAGGTGA---ACGGCATGAATATTGTGGAGGCCATGGA 290

Query:   299 C-GATGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAG-CGACTGC 356
               G T T G TGT  A  A    CAA G CC  GC AG AGAT ACCAT    CGACTG 
Sbjct:   291 GTGCTTT-G-TGTCCAGGAATGGCAA-GACCG-GCCAGAAGATCACCATTGCTCGACTGT 346

Query:   357 GG 358
             GG
Sbjct:   347 GG 348


>cbil|dbest|1654196 AA922406 oi53c02.s1 3'
            Lib=1102[Homo_sapiens|tongue|squamous_cell_carcinoma_from_base_of_t
            ongue|||] Length=448 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 448

  Minus Strand HSPs:

 Score = 279 (41.9 bits), Expect = 1.5e-06, P = 1.5e-06
 Identities = 139/211 (65%), Positives = 139/211 (65%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   229 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 283

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   284 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 342

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   343 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAA-CATTTGTGTTGG 399

Query:   183 CGTTGTCGTTGCACATCCCAATGACGCCAGGCGCGT 148
              GT   C TT C CAT   AA GA GC AGG  CGT
Sbjct:   400 -GTCAGCATTTC-CATGGAAA-GATGC-AGGACCGT 431


>cbil|dbest|1590869 AA865532 oh30d08.s1 3'
            Lib=991[Homo_sapiens|kidney|kidney_tumor|||] Length=419 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 419

  Minus Strand HSPs:

 Score = 279 (41.9 bits), Expect = 1.6e-06, P = 1.6e-06
 Identities = 119/172 (69%), Positives = 119/172 (69%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GAC CATT GTGT
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAC-CATTTGTGT 383


>cbil|dbest|827638 AA188612 zp78a07.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=461 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 461

  Minus Strand HSPs:

 Score = 278 (41.7 bits), Expect = 1.6e-06, P = 1.6e-06
 Identities = 152/227 (66%), Positives = 152/227 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T   CA TG A AT  AAAA    GA  CATT GTGT  
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTG 395

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
               GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   396 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 450


>cbil|dbest|453578 N48049 yy99b09.s1 3'
            Lib=390[Homo_sapiens||multiple_sclerosis_lesions|||Age_46]
            Length=449 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 449

  Minus Strand HSPs:

 Score = 278 (41.7 bits), Expect = 1.7e-06, P = 1.7e-06
 Identities = 152/227 (66%), Positives = 152/227 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACG-ACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    G A  CATT GTGT  
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGGAAAAACTGGGAACCATTTGTGTTG 387

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
               GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   388 G-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 442


>cbil|dbest|1133927 AA489257 ab36a11.r1 5'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=389 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 389

  Plus Strand HSPs:

 Score = 279 (41.9 bits), Expect = 1.8e-06, P = 1.8e-06
 Identities = 119/172 (69%), Positives = 119/172 (69%), Strand = Plus / Plus

Query:   187 ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             ACAC AATG GTC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    31 ACACAAATG-GTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 87

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:    88 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 146

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   147 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 198


>cbil|dbest|969793 AA328567 EST32063 5'-end
            Lib=730[Homo_sapiens|||||embryo,_12_wks] Length=280 Author_cmt:
            cyclophilin A
            Length = 280

  Plus Strand HSPs:

 Score = 282 (42.3 bits), Expect = 1.8e-06, P = 1.8e-06
 Identities = 168/260 (64%), Positives = 168/260 (64%), Strand = Plus / Plus

Query:   104 CTATGGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGT 160
             CTATGG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC T
Sbjct:     9 CTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCAT 65

Query:   161 CATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAA 216
             C TTG   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA 
Sbjct:    66 C-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCAC 122

Query:   217 TGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGG 274
             TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GG
Sbjct:   123 TGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGG 179

Query:   275 CATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCA 333
             CATGAAT T GTGGAGGCCAT  A CG T T G T  A    A   C  AAG CC  GCA
Sbjct:   180 CATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGGAATGGC--AAGACCA-GCA 236

Query:   334 AGGAGATTACCATCAGC-GACTGCGGTGTCA 363
              G AGAT ACCAT  GC GACTG GG G CA
Sbjct:   237 NGAAGATCACCATT-GCTGACTGTGG-GACA 265


>cbil|dbest|458776 N53247 yy99b09.r1 5'
            Lib=390[Homo_sapiens||multiple_sclerosis_lesions|||Age_46]
            Length=301 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 301

  Plus Strand HSPs:

 Score = 281 (42.2 bits), Expect = 1.8e-06, P = 1.8e-06
 Identities = 149/226 (65%), Positives = 149/226 (65%), Strand = Plus / Plus

Query:   133 ACGCCATTCCACA-CG-ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACA-ACGAGGA 187
             AC  CAT C A A C  ACG G CCTGGC TC TTG   ATG   AA G    AC    A
Sbjct:     1 ACTTCATCCTAAAGCATACGGGTCCTGGCATC-TTGTCCATGGNAAATGCTGGACCCA-A 58

Query:   188 CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACG 244
             CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A G
Sbjct:    59 CACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAAG 116

Query:   245 CTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATG 303
             C A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T 
Sbjct:   117 C-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTT 175

Query:   304 TAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
             T G T  A  A A   C AA G CC  GCAAG AGAT A CAT  GC GACTG GG
Sbjct:   176 TGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCANCATT-GCTGACTGTGG 226


>cbil|dbest|1002577 AA361248 EST70521 5'-end
            Lib=706[Homo_sapiens|||T-lymphocyte||] Length=260 Author_cmt:
            cyclophilin A
            Length = 260

  Plus Strand HSPs:

 Score = 282 (42.3 bits), Expect = 1.9e-06, P = 1.9e-06
 Identities = 166/255 (65%), Positives = 166/255 (65%), Strand = Plus / Plus

Query:   104 CTATGGTC-GATATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGT 160
             CTATGG   GA ATTT   A A GA   CTT   CC T    CA  ACG G CCTGGC T
Sbjct:     9 CTATGGGGAGAAATTTGA-AGATGAGAACTTCATCC-TAAAGCAT-ACGGGTCCTGGCAT 65

Query:   161 CATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCCTTTTATAT-TACAA 216
             C TTG   ATG GCAA   C   GA   A CAC AATG  TC    TTTT  AT T CA 
Sbjct:    66 C-TTGTCCATG-GCAAATGCTG-GACCCAACACAAATGGTTCCCAGTTTTTCATCTGCAC 122

Query:   217 TGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGG 274
             TG  A G C TG  GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GG
Sbjct:   123 TGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGG 179

Query:   275 CATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAACCAAAGCCCCTGCA 333
             CATGAAT T GTGGAGGCCAT  A CG T T G T  A  A A   C AA G CC  GCA
Sbjct:   180 CATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGGC-AA-GACCA-GCA 235

Query:   334 AGGAGATTACCATCAGC-GACTGCGG 358
             AG AGAT ACCAT  GC GACT  GG
Sbjct:   236 AGAAGATCACCATT-GCTGACTTTGG 260


>cbil|dbest|977138 AA335880 EST40395 5'-end
            Lib=715[Homo_sapiens|epididymis||||adult] Length=393 Author_cmt:
            cyclophilin A
            Length = 393

  Plus Strand HSPs:

 Score = 277 (41.6 bits), Expect = 2.1e-06, P = 2.1e-06
 Identities = 141/211 (66%), Positives = 141/211 (66%), Strand = Plus / Plus

Query:   148 ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A-CACGAATGCGTCGTCC 203
             ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A CAC AATG  TC    
Sbjct:    13 ACGGGTCCTGGCATC-TTGTCCATG-GCAAATNCTG-GACCCAACACAAATGGTTCCCAG 69

Query:   204 TTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-ACGCTACGTTGCGTTTGGC 260
             TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A GC A GT G  TTTGGC
Sbjct:    70 TTTTTNATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAAGC-ATGTGGTNTTTGGC 126

Query:   261 CGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGATGTAGATGTAAAACACAA 319
               AGTGA AGA GGCATGA T T GTGGAGGCCAT  A CG T T G T  A  A A   
Sbjct:   127 AAAGTGAAAGAAGGCATGANTATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGA-ATGG 185

Query:   320 CCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
             C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   186 C-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 221


>cbil|dbest|785268 AA146734 zo34d12.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=433 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 433

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.1e-06, P = 2.1e-06
 Identities = 144/211 (68%), Positives = 144/211 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   220 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 274

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   275 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTT 333

Query:   241 -CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTC 186
              CCAT CA CCAC  CA G C TT  CA TG A AT  AAAA    GA  CATT GTGT 
Sbjct:   334 GCCATCCAACCACT-CA-GTCTTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTT 391

Query:   185 CTCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGT 148
                GT    C TT GC CAT   CAA GA GCCAGG C CGT
Sbjct:   392 GG-GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGT 430


>cbil|dbest|1298059 AA603403 np14c12.s1 
            Lib=575[Homo_sapiens|||||45_years_old] Length=429 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 429

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.2e-06, P = 2.2e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   230 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 284

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   285 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 343

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  A AA    GA GCATT GTGT
Sbjct:   344 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAGAACTGGGAAGCATTTGTGT 398


>cbil|dbest|710780 AA075585 zm88a04.r1 5'
            Lib=510[Homo_sapiens|||||adult,_64_years] Length=424 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 424

  Plus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.2e-06, P = 2.2e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Plus / Plus

Query:   187 ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    35 ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 92

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:    93 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 151

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   152 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 203


>cbil|dbest|621932 AA011065 ze21b09.r1 5'
            Lib=424[Homo_sapiens|heart||||19_weeks] Length=422 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 422

  Plus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.2e-06, P = 2.2e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Plus / Plus

Query:   187 ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    34 ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 91

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:    92 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 150

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   151 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 202


>cbil|dbest|737209 AA099283 zl77g07.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=416 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 416

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.2e-06, P = 2.2e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   225 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 279

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   280 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 338

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   339 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 393


>cbil|dbest|1583858 AA858203 oe43c06.s1 3'
            Lib=1017[Homo_sapiens|prostate|epithelium_(cell_line)|||]
            Length=503 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 503

  Minus Strand HSPs:

 Score = 285 (42.8 bits), Expect = 2.3e-06, P = 2.3e-06
 Identities = 179/282 (63%), Positives = 179/282 (63%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 395

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   CAA GA   CAGG  C  CGT TG   T G  T AAG  
Sbjct:   396 -GTCCAGCATTTGC-CATGGACAA-GATTGCAGGACC--CGTATGCTTTAGGATGAAGTT 450

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAGTAACCCCCGTTTCCGTTGTGG 77
              TC T T  AAA T  TC  CCATAG   GA T  CC CC  T C  TT TGG
Sbjct:   451 CTCATCTTCAAATTTCTCC-CCATAGATGGACTTGCCACCAGTGCA-TTATGG 501


>cbil|dbest|1326003 AA628259 af98h05.s1 3' Lib=628[Homo_sapiens|||||]
            Length=404 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 404

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.3e-06, P = 2.3e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   234 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 288

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   289 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 347

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   348 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 402


>cbil|dbest|738437 AA100278 zl81e06.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=401 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 401

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.3e-06, P = 2.3e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 386


>cbil|dbest|770162 AA130503 zo06e11.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=399
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 399

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.3e-06, P = 2.3e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   226 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 280

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   281 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 339

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   340 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 394


>cbil|dbest|1328093 AA629819 ad44d08.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=442 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 442

  Minus Strand HSPs:

 Score = 275 (41.3 bits), Expect = 2.3e-06, P = 2.3e-06
 Identities = 139/206 (67%), Positives = 139/206 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   227 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 281

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   282 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 340

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   341 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAA-CATTTGTGTTGG 397

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG 153
              GT    C TT GC CAT   CAA GA GCCAGG
Sbjct:   398 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGG 428


>cbil|dbest|1131974 AA486399 ab36a11.s1 3'
            Lib=527[Homo_sapiens|||||HeLa_S3_cell_line] Length=393 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 393

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.4e-06, P = 2.4e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   215 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 269

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   270 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 328

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   329 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 383


>cbil|dbest|1583077 AA857422 oh98c05.s1 3'
            Lib=1103[Homo_sapiens|pharynx|squamous_cell_carcinoma|||]
            Length=392 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 392

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.4e-06, P = 2.4e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   222 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 276

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   277 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 335

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   336 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 390


>cbil|dbest|1421542 AA714829 nv47d09.r1 
            Lib=883[Homo_sapiens||Ewing's_sarcoma|||] Length=390 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 390

  Minus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.4e-06, P = 2.4e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   200 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 254

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   255 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 313

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   314 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 368


>cbil|dbest|1041782 AA401598 zu62e08.r1 5' Lib=628[Homo_sapiens|||||]
            Length=388 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 388

  Plus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 2.4e-06, P = 2.4e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Plus / Plus

Query:   187 ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    32 ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 89

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:    90 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 148

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   149 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 200


>cbil|dbest|768957 AA133612 zl92c07.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=449 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 449

  Minus Strand HSPs:

 Score = 274 (41.1 bits), Expect = 2.6e-06, P = 2.6e-06
 Identities = 140/212 (66%), Positives = 140/212 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCG-TGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT G TGT  
Sbjct:   332 CCATCCAACCACT-CAAGTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGGTGTTG 390

Query:   184 --TCGTTGTCGTTGCACATCC-CAATGACGCCAGG-CGCG 149
               TC   G   TT   CAT   CAA GA GCCAGG C CG
Sbjct:   391 GGTCCCAGCAATTTGNCATGGACAA-GATGCCAGGACCCG 429


>cbil|dbest|993660 AA352353 EST60336 5'-end
            Lib=765[Homo_sapiens|||T-lymphocyte||adult] Length=310 Author_cmt:
            cyclophilin A
            Length = 310

  Plus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 3.0e-06, P = 3.0e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Plus / Plus

Query:   187 ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:     9 ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 66

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:    67 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 125

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   126 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 177


>cbil|dbest|827279 AA187156 zp62c06.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=456
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 456

  Minus Strand HSPs:

 Score = 272 (40.8 bits), Expect = 3.1e-06, P = 3.1e-06
 Identities = 144/213 (67%), Positives = 144/213 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 271

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   272 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 330

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T   CA TG A AT  AAAA    GA  CATT GTGT  
Sbjct:   331 CCATCCAACCACT-CA-GTCTTGGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTG 388

Query:   184 TCGTTGT-CGTT--GCACATC--CCAATGACGCCAGG-CGCGT 148
               GT    C TT  GC CAT   CCAA GA GCCAGG C CGT
Sbjct:   389 GGGTCCAGCATTTTGC-CATGGACCAA-GATGCCAGGACCCGT 429


>cbil|dbest|796707 AA158063 zo43h05.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=420
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);contains Alu repetitive element;
            Length = 420

  Minus Strand HSPs:

 Score = 272 (40.8 bits), Expect = 3.4e-06, P = 3.4e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT G  T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGGCAT-TCCTGGACC-CAAAAGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGTC 241
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTT 337

Query:   240 -CATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTC-GTGT 187
              CAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT  GTGT
Sbjct:   338 GCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGGAAAACTGGGAACCATTTTGTGT 393


>cbil|dbest|738145 AA100073 zl80c08.s1 3' Lib=486[Homo_sapiens|colon||||]
            Length=416 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 416

  Minus Strand HSPs:

 Score = 272 (40.8 bits), Expect = 3.4e-06, P = 3.4e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACG-ACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    G A  CATT GTGT
Sbjct:   337 CCATCCAACCACTTCA-GTCTTGGCAGTGCAGATGAAAAACTTGGGAACCATTTGTGT 393


>cbil|dbest|1004452 AA363145 EST72954 5'-end
            Lib=683[Homo_sapiens|ovary||||adult] Length=260 Author_cmt:
            cyclophilin A
            Length = 260

  Plus Strand HSPs:

 Score = 276 (41.4 bits), Expect = 3.6e-06, P = 3.6e-06
 Identities = 150/226 (66%), Positives = 150/226 (66%), Strand = Plus / Plus

Query:   133 ACGCCATTCCACA-CG-ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A 187
             AC  CAT C A A C  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A
Sbjct:    26 ACTTCATCCTAAAGCATACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCA 82

Query:   188 -CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
              CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG  TGG A 
Sbjct:    83 ACACAAATGGTTCCCAGTTTTTNATCTGCACTGCCAAGAC-TGA-GTGGTTGGNTGGCAA 140

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGA T T GTGGAGGCCAT  A CG T
Sbjct:   141 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGANTATTGTGGAGGCCATGGAGCGCT 199

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   200 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 251


>cbil|dbest|1368947 AA663441 ab83e10.s1 3' Lib=552[Homo_sapiens|||||]
            Length=486 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 486

  Minus Strand HSPs:

 Score = 278 (41.7 bits), Expect = 3.7e-06, P = 3.7e-06
 Identities = 152/227 (66%), Positives = 152/227 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   221 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 275

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   276 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 334

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACG-ACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    G A  CATT GTGT  
Sbjct:   335 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGGAAAAACTGGGAACCATTTGTGTTG 392

Query:   184 TCGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
               GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   393 G-GTCAAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 447


>cbil|dbest|739671 AA101179 zn35d08.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=456
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 456

  Minus Strand HSPs:

 Score = 270 (40.5 bits), Expect = 3.8e-06, P = 3.8e-06
 Identities = 144/217 (66%), Positives = 144/217 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   215 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 269

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   270 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 328

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTAAT-ATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG  AT A  AA  G  GA  CATT GTGT   
Sbjct:   329 CCATCCAACCACT-CA-GTCTTGGCAGTGAGATGAGNAACTGGGGAACCATTTGTGTTGG 386

Query:   183 CGTTGT-CGTT-GCACATC--CCAATGACGCCAGGCGCGTCGTGTG 142
              GT    C TT GC CAT    CAA GA GCCAGG  C  CGT TG
Sbjct:   387 -GTCCAGCATTTGC-CATGGANCAA-GATGCCAGGGACC-CGTATG 428


>cbil|dbest|765471 AA127497 zn81e02.s1 3'
            Lib=537[Homo_sapiens|lung|lung_carcinoma||NCI-H69|cell_line_NCI-H69
            ] Length=446 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 446

  Minus Strand HSPs:

 Score = 269 (40.4 bits), Expect = 4.3e-06, P = 4.3e-06
 Identities = 143/211 (67%), Positives = 143/211 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   224 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 278

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   279 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 337

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAG-GACGACGCATTCGTGTC 186
             CCAT CA CCAC  CA G C T   CA TG A AT  AAAA  G   AC CATT GTGT 
Sbjct:   338 CCATCCAACCACT-CA-GTCTTGGGCAGTGCAGATGAAAAACTGGNAAC-CATTTGTGTT 394

Query:   185 CTCGTTGT-CGTT-GCACATCCCA-ATGACGCCAGG-CGCGT 148
                GT    C TT GC CAT   A A GA GCCAGG C CGT
Sbjct:   395 GG-GTCCAGCATTTGC-CATGGGACAAGATGCCAGGACCCGT 434


>cbil|dbest|969137 AA327912 EST31315 5'-end
            Lib=730[Homo_sapiens|||||embryo,_12_wks] Length=347 Author_cmt:
            cyclophilin A
            Length = 347

  Plus Strand HSPs:

 Score = 271 (40.7 bits), Expect = 4.5e-06, P = 4.5e-06
 Identities = 117/172 (68%), Positives = 117/172 (68%), Strand = Plus / Plus

Query:   187 ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    22 ACACAAATGGTTCCCAGTTTTTNATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 79

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGA T T GTGGAGGCCAT  A CG T
Sbjct:    80 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGANTATTGTGGAGGCCATGGAGCGCT 138

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   139 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 190


>cbil|dbest|1613668 AA886602 ny46c04.s1 
            Lib=919[Homo_sapiens||metastatic_prostate_bone_lesion|||]
            Length=371 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 371

  Minus Strand HSPs:

 Score = 270 (40.5 bits), Expect = 4.7e-06, P = 4.7e-06
 Identities = 116/164 (70%), Positives = 116/164 (70%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   209 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 263

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   264 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 322

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAA--GGACGACGC 195
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  GG CGACGC
Sbjct:   323 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGTCGACGC 371


>cbil|dbest|1430822 AA723559 ah24b05.s1 3'
            Lib=417[Homo_sapiens|parathyroid_gland|parathyroid_tumor|||adult]
            Length=537 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 537

  Minus Strand HSPs:

 Score = 289 (43.4 bits), Expect = 4.9e-06, P = 4.9e-06
 Identities = 199/318 (62%), Positives = 199/318 (62%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTACTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 394

Query:   183 CGTTGT-CGTT-GCACATCCCAAT-GACGCCAGGCGCGTCGTGTGGAATGGCGT-AAGAN 128
              GT    C TT GC CAT   A T GA GCCAGG  C  CGT TG   T G  T AAG  
Sbjct:   395 -GTCCAGCATTTGC-CATGG-ACTAGATGCCAGGACC--CGTATGCTTTAGGATGAAGTT 449

Query:   127 -TCGTTTGGAAAATA-TCGACCATAGCACGAG-TAACCCCCGTTTCCGTTGTGGTCTCTA 71
              TC T    AAA T  TC  CCAT G   GA  T  CC CC  T CC T  TGG  T T 
Sbjct:   450 CTCATACTCAAATTTCTCC-CCATGGATGGACATTGCCACCAGTGCCTTAATGGCGTGT- 507

Query:    70 GAGATGTCGCCTCCCAT-CACCCACGCCCCG 41
             GA A GTC CC CCC   CAC  A  CCC G
Sbjct:   508 GA-A-GTCACCACCCTGGCACATAAACCCTG 536


>cbil|dbest|959925 AA318546 EST20716 5'-end
            Lib=735[Homo_sapiens|spleen||||adult,_23_yrs] Length=307
            Author_cmt: cyclophilin A
            Length = 307

  Plus Strand HSPs:

 Score = 271 (40.7 bits), Expect = 5.1e-06, P = 5.1e-06
 Identities = 117/172 (68%), Positives = 117/172 (68%), Strand = Plus / Plus

Query:   187 ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    15 ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 72

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:    73 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 131

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A    A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   132 TTGGGTCCAGGN-ATNGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 183


>cbil|dbest|1422335 AA715622 nv51h03.r1 
            Lib=883[Homo_sapiens||Ewing's_sarcoma|||] Length=461 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 461

  Minus Strand HSPs:

 Score = 267 (40.1 bits), Expect = 5.1e-06, P = 5.1e-06
 Identities = 117/172 (68%), Positives = 117/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   269 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 323

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCA AC C AC T GC T 
Sbjct:   324 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAGACACCACAT-GCTTG 382

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   383 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 437


>cbil|dbest|1005983 AA364602 EST75299 5'-end
            Lib=734[Homo_sapiens|pineal_body||||adult] Length=304 Author_cmt:
            cyclophilin A
            Length = 304

  Plus Strand HSPs:

 Score = 271 (40.7 bits), Expect = 5.1e-06, P = 5.1e-06
 Identities = 117/172 (68%), Positives = 117/172 (68%), Strand = Plus / Plus

Query:   187 ACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    18 ACACAAATGGTTCCCAGTTTTTNATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 75

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGA T T GTGGAGGCCAT  A CG T
Sbjct:    76 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGANTATTGTGGAGGCCATGGAGCGCT 134

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   135 TTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 186


>cbil|dbest|304446 H43395 yp09h04.r1 5' Lib=298[Homo_sapiens|breast||||adult]
            Length=445 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 445

  Plus Strand HSPs:

 Score = 267 (40.1 bits), Expect = 5.3e-06, P = 5.3e-06
 Identities = 147/223 (65%), Positives = 147/223 (65%), Strand = Plus / Plus

Query:   133 ACGCCATTCCACA-CG-ACGCG-CCTGGCGTCATTGGG-ATGTGCAACGACAACGAGG-A 187
             AC  CAT C A A C  ACG G CCTGGC TC TTG   ATG GCAA   C   GA   A
Sbjct:     1 ACTTCATCCTAAAGCATACGGGTCCTGGCATC-TTGTCCATG-GCAAATGCTG-GACCCA 57

Query:   188 -CACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
              CAC AATG  TC    TTTT  AT T CA TG  A G C TG  GTGG TG ATGG A 
Sbjct:    58 ACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTGGTTGGATGGCAA 115

Query:   244 GCTACGTTGCGTTT-GGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGA 301
             GC A GT G GTTT GGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG 
Sbjct:   116 GC-ATGTGGTGTTTCGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGC 174

Query:   302 TGTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGCGACT 354
             T T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT    GACT
Sbjct:   175 TTTGGGTCCAGGA-ATGGC-AA-GACCA-GCAAGAAGATCACCATTNCTGACT 223


>cbil|dbest|772289 AA132422 zo07a11.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=436
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 436

  Minus Strand HSPs:

 Score = 266 (39.9 bits), Expect = 6.0e-06, P = 6.0e-06
 Identities = 118/172 (68%), Positives = 118/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT--CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T   CA TG A AT  AAAA    GA  CATT GTGT
Sbjct:   330 CCATCCAACCACT-CA-GTCTTGGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGT 385


>cbil|dbest|1767424 AI028733 ov92h02.x1 3' Lib=628[Homo_sapiens|||||]
            Length=423 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 423

  Minus Strand HSPs:

 Score = 266 (39.9 bits), Expect = 6.2e-06, P = 6.2e-06
 Identities = 116/170 (68%), Positives = 116/170 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   228 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 282

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   283 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 341

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGT 189
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GT
Sbjct:   342 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGT 394


>cbil|dbest|1214315 AA563932 nk23a07.s1 3' Lib=938[Homo_sapiens|colon|tumor|||]
            Length=542 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 542

  Minus Strand HSPs:

 Score = 288 (43.2 bits), Expect = 6.6e-06, P = 6.6e-06
 Identities = 152/226 (67%), Positives = 152/226 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   220 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 274

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   275 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 333

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGTCCT 184
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GTGT   
Sbjct:   334 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTGTTGG 391

Query:   183 CGTTGT-CGTT-GCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
              GT    C TT GC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   392 -GTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 445


>cbil|dbest|1041653 AA400081 zu62e08.s1 3' Lib=628[Homo_sapiens|||||]
            Length=389 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 389

  Minus Strand HSPs:

 Score = 266 (39.9 bits), Expect = 6.8e-06, P = 6.8e-06
 Identities = 116/170 (68%), Positives = 116/170 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   223 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 277

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   278 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 336

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGT 189
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GT
Sbjct:   337 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGT 389


>cbil|dbest|260275 H00395 yj23b09.r1 5'
            Lib=271[Homo_sapiens|placenta||||placenta_obtained_at_birth_(full_t
            erm)] Length=403 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL
            CIS-TRANS ISOMERASE A (HUMAN);
            Length = 403

  Plus Strand HSPs:

 Score = 265 (39.8 bits), Expect = 7.2e-06, P = 7.2e-06
 Identities = 117/171 (68%), Positives = 117/171 (68%), Strand = Plus / Plus

Query:   188 CACGAATGCGTCGTCCTTTTAT-AT-TACAATGA-AGGCCATGTCGTGGATGAATGG-AC 243
             CAC AATG GT   C  TTT T AT T CA TG  A G C TG  GT G TG ATGG A 
Sbjct:     2 CACAAATGGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA-GTNGTTGGATGGCAA 59

Query:   244 GCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGGAGGCCATCCA-CGAT 302
             GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGGAGGCCAT  A CG T
Sbjct:    60 GC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCT 118

Query:   303 GTAGATGTAAAACACAACCAAAGCCCCTGCAAGGAGATTACCATCAGC-GACTGCGG 358
              T G T  A  A A   C AA G CC  GCAAG AGAT ACCAT  GC GACTG GG
Sbjct:   119 TTGGGTCCAGGA-ATNGC-AA-GACCA-GCAAGAAGATCACCATT-GCTGACTGTGG 170


>cbil|dbest|1158342 AA513702 nh80b11.s1 3' Lib=894[Homo_sapiens||breast|||]
            Length=428 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 428

  Minus Strand HSPs:

 Score = 264 (39.6 bits), Expect = 7.6e-06, P = 7.6e-06
 Identities = 116/172 (67%), Positives = 116/172 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T   T   AC  C A A C
Sbjct:   217 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCATTCCTGGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTGTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CA T GTGT
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCACTTGTGT 386


>cbil|dbest|796303 AA157750 zo46b01.s1 3'
            Lib=523[Homo_sapiens|||||umbilical_vein,_1_passage] Length=416
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 416

  Minus Strand HSPs:

 Score = 264 (39.6 bits), Expect = 7.8e-06, P = 7.8e-06
 Identities = 120/172 (69%), Positives = 120/172 (69%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   219 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 273

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   274 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 332

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-AT-ATAAAAG-GACGACGCATTC-GTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT A AAAA  G  GA  CATT  GTGT
Sbjct:   333 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAAACTGGGGAACCATTTTGTGT 390


>cbil|dbest|994773 AA353465 EST61598 5'-end
            Lib=765[Homo_sapiens|||T-lymphocyte||adult] Length=249 Author_cmt:
            cyclophilin A
            Length = 249

  Plus Strand HSPs:

 Score = 268 (40.2 bits), Expect = 8.6e-06, P = 8.6e-06
 Identities = 148/240 (61%), Positives = 148/240 (61%), Strand = Plus / Plus

Query:    56 GGGAGGCGACATCTCTAGAGACCACAACGGAAACGGGGGTTACTCGTGCTATGGTC-GAT 114
             GG AGG    A  TC A A  CCA AA GG A  GG GG  A TC   CTATGG   GA 
Sbjct:     1 GGCAGGGNTGACTTC-ACACGCCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAA 59

Query:   115 ATTTTCCAAACGANT-CTTACGCCATTCCACACGACGCG-CCTGGCGTCATTGGG-ATGT 171
             ATTT   A A GA   CTT C  C T    CA  ACG G CCTGG  TC TTG   ATG 
Sbjct:    60 ATTTGA-AGATGAGAACTT-CATCNTAAAGCAT-ACGGGTCCTGGNATC-TTGTCCATGG 115

Query:   172 GCAACGACAACGAGGACACGAATGCGTCGTCCTTTTATAT-TACAATGA-AGGCCATGTC 229
               AA G         ACAC AATG  TC    TTTT  AT T CA TG  A G C TG  
Sbjct:   116 NAAATGNTGGNCCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGAC-TGA- 173

Query:   230 GTGGATGAATGG-ACGCTACGTTGCGTTTGGCCGAGTGATAGACGGCATGAATGTCGTGG 288
             GTGG TG ATGG A GC A GT G GTTTGGC  AGTGA AGA GGCATGAAT T GTGG
Sbjct:   174 GTGGTTGGATGGCAAGC-ATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGG 232

Query:   289 AGGCCAT 295
             AGGCCAT
Sbjct:   233 AGGCCAT 239


>cbil|dbest|948180 AA306872 EST177797 5'-end
            Lib=719[Homo_sapiens|||T-lymphocyte||] Length=384 Author_cmt:
            similar to cyclophilin A
            Length = 384

  Minus Strand HSPs:

 Score = 262 (39.3 bits), Expect = 1.0e-05, P = 1.0e-05
 Identities = 116/172 (67%), Positives = 116/172 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T   C  C A A C
Sbjct:   200 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGNCC-CAA-AGC 254

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   255 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 313

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GT T
Sbjct:   314 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTNT 368


>cbil|dbest|1146022 AA501392 ne66e10.s1 
            Lib=881[Homo_sapiens||alveolar_rhabdomyosarcoma|||] Length=379
            Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A
            (HUMAN);
            Length = 379

  Minus Strand HSPs:

 Score = 260 (39.0 bits), Expect = 1.4e-05, P = 1.4e-05
 Identities = 108/155 (69%), Positives = 108/155 (69%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   216 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 270

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   271 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 329

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAA 204
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA
Sbjct:   330 CCATCCAACCACTTCA-GTCTTGGCAGTGCAGATGAAAAA 368


>cbil|dbest|953842 AA312394 EST183199 5'-end
            Lib=719[Homo_sapiens|||T-lymphocyte||] Length=416 Author_cmt:
            cyclophilin A
            Length = 416

  Minus Strand HSPs:

 Score = 259 (38.9 bits), Expect = 1.4e-05, P = 1.4e-05
 Identities = 115/172 (66%), Positives = 115/172 (66%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT  TTGC GG  CTT    T   T   AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTNTTGCTGGT-CTTGCCATTCCTGGGACC-CAA-AGC 273

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   274 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 332

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GT T
Sbjct:   333 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTNT 387


>cbil|dbest|709450 AA074238 zm75g12.s1 3'
            Lib=502[Homo_sapiens|||||Ntera-2/RA_neuroepithelial_cells]
            Length=495 Author_cmt: gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS
            ISOMERASE A (HUMAN);
            Length = 495

  Minus Strand HSPs:

 Score = 277 (41.6 bits), Expect = 1.4e-05, P = 1.4e-05
 Identities = 153/228 (67%), Positives = 153/228 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   244 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 298

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   299 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 357

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGTCC 185
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GA  CATT  TGT  
Sbjct:   358 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAACCATTT-TGTGT 414

Query:   184 TCGTTGTCG---TTGCACATCC-CAATGACGCCAGG-CGCGTC-G-TGTGGAATGGCGT 133
             T G T   G   TTGC CAT   CAA GA GCCAGG C CGT  G T T G ATG  GT
Sbjct:   415 TGGGTCCAGCATTTGC-CATGGACAA-GATGCCAGGACCCGTATGCTTTAGGATGAAGT 471


>cbil|dbest|1232621 AA582600 nn51a07.s1 3'
            Lib=991[Homo_sapiens|kidney|kidney_tumor|||] Length=414 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 414

  Minus Strand HSPs:

 Score = 258 (38.7 bits), Expect = 1.6e-05, P = 1.6e-05
 Identities = 116/172 (67%), Positives = 116/172 (67%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   220 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 274

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATG C TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   275 GCTCCATGGCCTCCACAATATTCATGGCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 333

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAGGACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA    GA  CATT GT T
Sbjct:   334 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGAACCATTTGTAT 388


>cbil|dbest|1381818 AA680212 ac82e03.s1 3'
            Lib=249[Homo_sapiens|lung||||72_years] Length=415 Author_cmt:
            gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);
            Length = 415

  Minus Strand HSPs:

 Score = 257 (38.6 bits), Expect = 1.8e-05, P = 1.8e-05
 Identities = 117/172 (68%), Positives = 117/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T  AC  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGACC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGGCCTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T GC T 
Sbjct:   273 GCTCCATGGCCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GCTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CA-TTGTAATATAAAAGGACG-ACGCATTCGTGT 187
             CCAT CA CCA   CA G C T  CA TTG A  A AAAA    G A  CATT GTGT
Sbjct:   332 CCATCCAACCAAT-CA-GTCTTGGCAGTTGCAGAAGAAAAACTGGGAACCATTTGTGT 387


>cbil|dbest|998587 AA357115 EST65976 3'-end
            Lib=710[Homo_sapiens|||T-lymphocyte||] Length=390 Author_cmt:
            cyclophilin A
            Length = 390

  Minus Strand HSPs:

 Score = 257 (38.6 bits), Expect = 1.9e-05, P = 1.9e-05
 Identities = 117/172 (68%), Positives = 117/172 (68%), Strand = Minus / Plus

Query:   358 CCGCAGTC-GCTGATGGTAATCTCCTTGCAGGGGCTTTGGTTGTGTTTTACATCTACATC 300
             CC CAGTC GC  ATGGT ATCT CTTGC GG  CTT    T T  T   C  C A A C
Sbjct:   218 CCACAGTCAGCA-ATGGTGATCTTCTTGCTGGT-CTTGCCAT-TCCTGGNCC-CAA-AGC 272

Query:   299 G-TGGATGGCCTCCACGACATTCATGCCGTCTATCACTCGGCCAAACGCAACGTAGCGT- 242
             G T  ATGG CTCCAC A ATTCATGCC TCT TCACT  GCCAAAC C AC T G  T 
Sbjct:   273 GCTCCATGGNCTCCACAATATTCATGCCTTCTTTCACTTTGCCAAACACCACAT-GNTTG 331

Query:   241 CCATTCATCCACGACATGGCCTT-CATTGTA-ATATAAAAG-GACGACGCATTCGTGT 187
             CCAT CA CCAC  CA G C T  CA TG A AT  AAAA  G  GAC CATT GTGT
Sbjct:   332 CCATCCAACCACT-CA-GTCTTGGCAGTGCAGATGAAAAACTGGGGAC-CATTTGTGT 386


WARNING:  HSPs involving 90 database sequences were not reported due to the
          limiting value of parameter B = 250.


Parameters:
  P=6
  V=250
  B=250

  ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same
               q=10  r=10      0.104  0.0151  0.0600

  Query
  Strand MatID  Length  Eff.Length   E     S  W   T  X     E2  S2
   +1      0      522       521      10. 121 11 N/A 73   0.021 79
                                                  87   0.025 115
   -1      0      522       521      10. 121 11 N/A 73   0.021 79
                                                  87   0.025 115


Statistics:

  Database:  /usr/local/db/others/blast/dbEST
    Title:  /usr/local/db/others/blast/dbEST
    Release date:  unknown
    Posted date:  10:29 AM EDT Sep 6, 1998
    Format:  BLAST
  # of letters in database:  680,019,941
  # of sequences in database:  1,803,623
  # of database sequences satisfying E:  340
  No. of states in DFA:  245 (245 KB)
  Total size of DFA:  258 KB (320 KB)
  Time to generate neighborhood:  0.01u 0.01s 0.02t  Elapsed: 00:00:00
  No. of processors used:  6
  Search cpu time:  20.53u 2.52s 23.05t  Elapsed: 00:00:06
  Total cpu time:  20.98u 62.05s 83.03t  Elapsed: 00:01:07
  Start:  Fri Sep 25 14:51:24 1998   End:  Fri Sep 25 14:52:31 1998

WARNINGS ISSUED:  2

Date: 17:13:46 on Mon 18 Dec 117.