blastn_self_files/1688751_blastn.Z


BLASTN 1.4.8MP [1-Jun-95] [Build 09:04:03 Jun  6 1995]

Reference:  Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers,
and David J. Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol.
215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  1688751
        (269 letters)

Database:  consensus
           3685 sequences; 1,458,175 total letters.
Searching..................................................done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

 1688751  (1 EST) Length=269                                  1289  2.3e-104  1
 1765614  (1 EST) Length=249                                   330  8.7e-21   1
 CcruzaQ_830  (5 EST) Length=766                               230  4.7e-15   2
 CcruzaQ_1640  (3 EST) Length=766                              266  7.3e-15   1
 1804749  (1 EST) Length=430                                   178  2.0e-07   1
 1206502  (1 EST) Length=357                                   117  4.4e-07   2
 1831876  (1 EST) Length=312                                   157  1.1e-05   1
 1602068  (1 EST) Length=266                                   146  9.3e-05   1
 1606324  (1 EST) Length=505                                   120  0.018     1
 1785373  (1 EST) Length=148                                   117  0.021     1
 1744275  (1 EST) Length=278                                    95  0.89      1
 CcruzaQ_335  (5 EST) Length=558                                92  0.99      1



>1688751  (1 EST) Length=269
  Length = 269

  Plus Strand HSPs:

 Score = 1289 (356.2 bits), Expect = 2.3e-104, P = 2.3e-104
 Identities = 261/269 (97%), Positives = 261/269 (97%), Strand = Plus / Plus

Query:     1 AGGCACNAGGTTNGTCCTTGTCTTTACTCTCGTGTTCTTCTAAAAAAATTGATTGCCGGC 60
             |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 AGGCACNAGGTTNGTCCTTGTCTTTACTCTCGTGTTCTTCTAAAAAAATTGATTGCCGGC 60

Query:    61 ACTTAGTACGGTAACACNTGCCCCCANATCTCATGGTGTTGCAACCGTGTCCCAGCAANA 120
             ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
Sbjct:    61 ACTTAGTACGGTAACACNTGCCCCCANATCTCATGGTGTTGCAACCGTGTCCCAGCAANA 120

Query:   121 CGCGGCTGGCCCGTGCGCTGGTTGATGCCGTCAGCCCTGCACCAACAACAATCCCGTGAT 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 CGCGGCTGGCCCGTGCGCTGGTTGATGCCGTCAGCCCTGCACCAACAACAATCCCGTGAT 180

Query:   181 GGACGGACGCATCGCTGACTGCGGGCTTCCCCCGANAATACGGAGCAATTGGCCCTGGCA 240
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct:   181 GGACGGACGCATCGCTGACTGCGGGCTTCCCCCGANAATACGGAGCAATTGGCCCTGGCA 240

Query:   241 CCACGGCNAGGTGGCCGGCATCGCNAAGG 269
             ||||||| |||||||||||||||| ||||
Sbjct:   241 CCACGGCNAGGTGGCCGGCATCGCNAAGG 269


>1765614  (1 EST) Length=249
  Length = 249

  Plus Strand HSPs:

 Score = 330 (91.2 bits), Expect = 8.7e-21, P = 8.7e-21
 Identities = 104/153 (67%), Positives = 104/153 (67%), Strand = Plus / Plus

Query:    19 TGTCTTTACTCTCGTGTTCTTCTAAAAAAATTGATTGCCGGCACTTAGTACGGTAACACN 78
             | | |||| | |  |  | || |   |||   | | |   || |  | | || |||||| 
Sbjct:    10 TTTTTTTATTGTTTTTGTGTTTTCCCAAATAAGTTCGATTGCTCACACTGCGTTAACACC 69

Query:    79 TGCCCCCANATCTCATGGTGTTGCAACCGTGTCCCAGCAANACGCGGCTGGCCCGTGCGC 138
               ||||||  || ||| | |||  ||| || ||||||||  |||||||||||||  ||||
Sbjct:    70 CACCCCCAGGTCCCATTGCGTTATAACTGTATCCCAGCAGGACGCGGCTGGCCCAGGCGC 129

Query:   139 TGGTTGATGCCGTCAGCCCTGCACCAACAACAA 171
             || ||||||||| ||||||||  || |||| ||
Sbjct:   130 TGTTTGATGCCGCCAGCCCTGTGCCCACAAAAA 162


>CcruzaQ_830  (5 EST) Length=766
  Length = 766

  Minus Strand HSPs:

 Score = 230 (63.6 bits), Expect = 4.7e-15, Sum P(2) = 4.7e-15
 Identities = 56/70 (80%), Positives = 56/70 (80%), Strand = Minus / Plus

Query:   251 CCTNGCCGTGGTGCCAGGGCCAATTGCTCCGTATTNTCGGGGGAAGCCCGCAGTCAGCGA 192
             |||  ||| || ||||||||||||||||||||||| |||||| ||||| | |  |||| |
Sbjct:   537 CCTCACCGCGGCGCCAGGGCCAATTGCTCCGTATTGTCGGGGAAAGCCAGGANCCAGCAA 596

Query:   191 TGCGTCCGTC 182
             ||  ||| ||
Sbjct:   597 TGTTTCCCTC 606

 Score = 99 (27.4 bits), Expect = 4.7e-15, Sum P(2) = 4.7e-15
 Identities = 23/27 (85%), Positives = 23/27 (85%), Strand = Minus / Plus

Query:   171 TTGTTGTTGGTGCAGGGCTGACGGCAT 145
             | | ||||||  |||||||||||||||
Sbjct:   616 TGGCTGTTGGCACAGGGCTGACGGCAT 642


>CcruzaQ_1640  (3 EST) Length=766
  Length = 766

  Minus Strand HSPs:

 Score = 266 (73.5 bits), Expect = 7.3e-15, P = 7.3e-15
 Identities = 68/88 (77%), Positives = 68/88 (77%), Strand = Minus / Plus

Query:   269 CCTTNGCGATGCCGGCCACCTNGCCGTGGTGCCAGGGCCAATTGCTCCGTATTNTCGGGG 210
             || | || ||||||||||||    ||||| ||||||| | ||||| ||||||| ||||||
Sbjct:   250 CCCTGGCAATGCCGGCCACCGCAGCGTGGCGCCAGGGTCGATTGCCCCGTATTGTCGGGG 309

Query:   209 GAAGCCCGCAGTCAGCGATGCGTCCGTC 182
             |||||| | || |||| ||   ||| ||
Sbjct:   310 GAAGCCAGGAGCCAGCAATATTTCCCTC 337


>1804749  (1 EST) Length=430
  Length = 430

  Minus Strand HSPs:

 Score = 178 (49.2 bits), Expect = 2.0e-07, P = 2.0e-07
 Identities = 46/60 (76%), Positives = 46/60 (76%), Strand = Minus / Plus

Query:   112 GGACACGGTTGCAACACCATGAGATNTGGGGGCANGTGTTACCGTACTAAGTGCCGGCAA 53
             | |||| |||| ||||||||||| | || ||||  ||||| ||||| || | |||  |||
Sbjct:    17 GCACACAGTTGTAACACCATGAGGTCTGAGGGCGCGTGTTGCCGTAATACGGGCCATCAA 76


>1206502  (1 EST) Length=357
  Length = 357

  Plus Strand HSPs:

 Score = 117 (32.3 bits), Expect = 4.4e-07, Sum P(2) = 4.4e-07
 Identities = 25/27 (92%), Positives = 25/27 (92%), Strand = Plus / Plus

Query:   145 ATGCCGTCAGCCCTGCACCAACAACAA 171
             || ||||||||||||| ||||||||||
Sbjct:    42 ATACCGTCAGCCCTGCGCCAACAACAA 68

 Score = 112 (30.9 bits), Expect = 4.4e-07, Sum P(2) = 4.4e-07
 Identities = 26/31 (83%), Positives = 26/31 (83%), Strand = Plus / Plus

Query:   115 GCAANACGCGGCTGGCCCGTGCGCTGGTTGA 145
             | || |||||| ||| ||| |||||||||||
Sbjct:    11 GAAAGACGCGGTTGGTCCGGGCGCTGGTTGA 41

 Score = 95 (26.3 bits), Expect = 3.1e-05, Sum P(2) = 3.1e-05
 Identities = 21/24 (87%), Positives = 21/24 (87%), Strand = Plus / Plus

Query:   160 CACCAACAACAATCCCGTGATGGA 183
             || ||||||||||||||||| | |
Sbjct:    72 CAACAACAACAATCCCGTGANGAA 95


>1831876  (1 EST) Length=312
  Length = 312

  Plus Strand HSPs:

 Score = 157 (43.4 bits), Expect = 1.1e-05, P = 1.1e-05
 Identities = 43/58 (74%), Positives = 43/58 (74%), Strand = Plus / Plus

Query:   182 GACGGACGCATCGCTGACTGCGGGCTTCCCCCGANAATACGGAGCAATTGGCCCTGGC 239
             || |||  ||| |||| ||   ||||||||||||   ||||| || |||| | |||||
Sbjct:   212 GAGGGAGACATGGCTGGCTTTCGGCTTCCCCCGACGGTACGGGGCGATTGACACTGGC 269


>1602068  (1 EST) Length=266
  Length = 266

  Plus Strand HSPs:

 Score = 146 (40.3 bits), Expect = 9.3e-05, P = 9.3e-05
 Identities = 38/50 (76%), Positives = 38/50 (76%), Strand = Plus / Plus

Query:   220 ACGGAGCAATTGGCCCTGGCACCACGGCNAGGTGGCCGGCATCGCNAAGG 269
             | || |||||| | |||||| |||||   ||||||||||| | || | ||
Sbjct:   179 AGGGTGCAATTTGTCCTGGCGCCACGATGAGGTGGCCGGCGTTGCCAGGG 228


>1606324  (1 EST) Length=505
  Length = 505

  Plus Strand HSPs:

 Score = 120 (33.2 bits), Expect = 0.018, P = 0.018
 Identities = 24/24 (100%), Positives = 24/24 (100%), Strand = Plus / Plus

Query:   145 ATGCCGTCAGCCCTGCACCAACAA 168
             ||||||||||||||||||||||||
Sbjct:   237 ATGCCGTCAGCCCTGCACCAACAA 260


>1785373  (1 EST) Length=148
  Length = 148

  Minus Strand HSPs:

 Score = 117 (32.3 bits), Expect = 0.021, P = 0.021
 Identities = 27/32 (84%), Positives = 27/32 (84%), Strand = Minus / Plus

Query:   239 GCCAGGGCCAATTGCTCCGTATTNTCGGGGGA 208
             ||||||||||||||| || | || ||||| ||
Sbjct:    27 GCCAGGGCCAATTGCCCCATCTTGTCGGGAGA 58


>1744275  (1 EST) Length=278
  Length = 278

  Minus Strand HSPs:

 Score = 95 (26.3 bits), Expect = 2.2, P = 0.89
 Identities = 25/33 (75%), Positives = 25/33 (75%), Strand = Minus / Plus

Query:   255 GCCACCTNGCCGTGGTGCCAGGGCCAATTGCTC 223
             |||||||   ||||||||||||  | |  ||||
Sbjct:   172 GCCACCTTAACGTGGTGCCAGGTTCCAGGGCTC 204


>CcruzaQ_335  (5 EST) Length=558
  Length = 558

  Minus Strand HSPs:

 Score = 92 (25.4 bits), Expect = 4.3, P = 0.99
 Identities = 28/40 (70%), Positives = 28/40 (70%), Strand = Minus / Plus

Query:   174 GGATTGTTGTTGGTGCAGGGCTGACGGCATCAACCAGCGC 135
             || ||   |  | ||||    ||||||||||||||| |||
Sbjct:   435 GGTTTTCCGGCGTTGCATCCATGACGGCATCAACCACCGC 474


Parameters:

  V=500
  B=250
  -ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same

  Query
  Strand MatID  Length  Eff.Length   E    S  W   T  X     E2  S2
   +1      0      269       261      10. 85 11 N/A 73   0.021 75
   -1      0      269       261      10. 85 11 N/A 73   0.021 75


Statistics:
  Query          Expected         Observed           HSPs       HSPs
  Strand MatID  High Score       High Score       Reportable  Reported
   +1      0    92 (25.4 bits)  1289 (356.2 bits)       8          8
   -1      0    92 (25.4 bits)   266 (73.5 bits)        7          7

  Query         Neighborhd  Word      Excluded    Failed   Successful  Overlaps
  Strand MatID   Words      Hits        Hits    Extensions Extensions  Excluded
   +1      0       204         158          64          83       11         0
   -1      0       204          94          15          69       10         0

  Database:  consensus
    Release date:  unknown
    Posted date:  9:10 AM EDT Sep 24, 1998
  # of letters in database:  1,458,175
  # of sequences in database:  3685
  # of database sequences satisfying E:  12
  No. of states in DFA:  180 (180 KB)
  Total size of DFA:  186 KB (192 KB)
  Time to generate neighborhood:  0.00u 0.00s 0.00t  Real: 00:00:00
  No. of processors used:  1
  Time to search database:  0.05u 0.00s 0.05t  Real: 00:00:00
  Total cpu time:  0.07u 0.02s 0.09t  Real: 00:00:00

Date: 14:50:21 on Sun 17 Dec 117.