blastn_self_files/300004_blastn.Z


BLASTN 1.4.8MP [1-Jun-95] [Build 09:04:03 Jun  6 1995]

Reference:  Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers,
and David J. Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol.
215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  300004
        (336 letters)

Database:  consensus
           4509 sequences; 1,759,974 total letters.
Searching..................................................done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

 300004  (1 EST) Length=336                                   1512  6.2e-123  1
 898506  (1 EST) Length=383                                    375  4.1e-24   1



>300004  (1 EST) Length=336
  Length = 336

  Plus Strand HSPs:

 Score = 1512 (417.8 bits), Expect = 6.2e-123, P = 6.2e-123
 Identities = 312/336 (92%), Positives = 312/336 (92%), Strand = Plus / Plus

Query:     1 CAGTTTGAGATCATNTACAGCGGAAGGNATAGCGAGGTNGTAGTGATCATTCACAANGAA 60
             |||||||||||||| |||||||||||| |||||||||| ||||||||||||||||| |||
Sbjct:     1 CAGTTTGAGATCATNTACAGCGGAAGGNATAGCGAGGTNGTAGTGATCATTCACAANGAA 60

Query:    61 CGATCATGATCTGCTGAATTATAAGGTTGTGCTAGTCATATGAAGATNCACCCGCCCAAT 120
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct:    61 CGATCATGATCTGCTGAATTATAAGGTTGTGCTAGTCATATGAAGATNCACCCGCCCAAT 120

Query:   121 CGATGTCCTACCACCTACCGGAACTTATTAAANTGNACAGGGCGTGACTGTTTTTTTTAT 180
             |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||
Sbjct:   121 CGATGTCCTACCACCTACCGGAACTTATTAAANTGNACAGGGCGTGACTGTTTTTTTTAT 180

Query:   181 AACGAACCAACACANTTCACTGTGCATTNCATGGNGATAGAGANTTTTATGTCAGANTNC 240
             |||||||||||||| ||||||||||||| ||||| |||||||| |||||||||||| | |
Sbjct:   181 AACGAACCAACACANTTCACTGTGCATTNCATGGNGATAGAGANTTTTATGTCAGANTNC 240

Query:   241 ACGAGCAGAGACANTAACGAGNGTGGCAAANGNANTTGTTCTATGCGATCCTATGATCAT 300
             ||||||||||||| ||||||| |||||||| | | |||||||||||||||||||||||||
Sbjct:   241 ACGAGCAGAGACANTAACGAGNGTGGCAAANGNANTTGTTCTATGCGATCCTATGATCAT 300

Query:   301 NGGCNGGGAGACACCCCCTGCGNNGGNGNTAGCCTA 336
              ||| |||||||||||||||||  || | |||||||
Sbjct:   301 NGGCNGGGAGACACCCCCTGCGNNGGNGNTAGCCTA 336


>898506  (1 EST) Length=383
  Length = 383

  Plus Strand HSPs:

 Score = 375 (103.6 bits), Expect = 4.1e-24, P = 4.1e-24
 Identities = 93/123 (75%), Positives = 93/123 (75%), Strand = Plus / Plus

Query:   214 GNGATAGAGANTTTTATGTCAGANTNCACGAGCAGAGACANTAACGAGNGTGGCAAANGN 273
             | ||||||||    ||||||||| | |||||||||||||| ||||||  |||||||| | 
Sbjct:    11 GAGATAGAGAAAAATATGTCAGAATACACGAGCAGAGACAATAACGAAAGTGGCAAAAGC 70

Query:   274 ANTTGTTCTATGCGATCCTATGATCATNGGCNGGGAGACACCCCCTGCGNNGGNGNTAGC 333
             | |||| |||||||| ||||||||||| | |  || ||||   ||  |   || | ||||
Sbjct:    71 AATTGTACTATGCGAACCTATGATCATAGCCATGGGGACAAAACCGCCTTTGGAGTTAGC 130

Query:   334 CTA 336
             |||
Sbjct:   131 CTA 133


Parameters:

  V=500
  B=250
  -ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same

  Query
  Strand MatID  Length  Eff.Length   E    S  W   T  X     E2  S2
   +1      0      336       312      10. 87 11 N/A 73   0.021 76
   -1      0      336       312      10. 87 11 N/A 73   0.021 76


Statistics:
  Query          Expected         Observed           HSPs       HSPs
  Strand MatID  High Score       High Score       Reportable  Reported
   +1      0    94 (26.0 bits)  1512 (417.8 bits)       2          2
   -1      0    94 (26.0 bits)    89 (24.6 bits)        0          0

  Query         Neighborhd  Word      Excluded    Failed   Successful  Overlaps
  Strand MatID   Words      Hits        Hits    Extensions Extensions  Excluded
   +1      0       184         160          56          99        5         0
   -1      0       184          75           8          64        5         0

  Database:  consensus
    Release date:  unknown
    Posted date:  12:46 PM EST Feb 4, 1998
  # of letters in database:  1,759,974
  # of sequences in database:  4509
  # of database sequences satisfying E:  2
  No. of states in DFA:  185 (185 KB)
  Total size of DFA:  190 KB (192 KB)
  Time to generate neighborhood:  0.00u 0.01s 0.01t  Real: 00:00:00
  No. of processors used:  4
  Time to search database:  0.08u 0.04s 0.12t  Real: 00:00:00
  Total cpu time:  0.08u 0.07s 0.15t  Real: 00:00:00

Date: 16:32:15 on Sun 17 Dec 117.