blastn_self_files/886509_blastn.Z


BLASTN 1.4.8MP [1-Jun-95] [Build 09:04:03 Jun  6 1995]

Reference:  Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers,
and David J. Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol.
215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  886509
        (328 letters)

Database:  consensus
           4509 sequences; 1,759,974 total letters.
Searching..................................................done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

 886509  (1 EST) Length=328                                   1612  3.0e-131  1
 CBrugiaQ_519  (3 EST) Length=569                              395  3.7e-65   3
 444799  (1 EST) Length=68                                     233  1.5e-13   1
 706152  (1 EST) Length=193                                    153  3.2e-05   1
 1048145  (1 EST) Length=424                                   116  0.059     1
 636417  (1 EST) Length=245                                    114  0.076     1
 885570  (1 EST) Length=613                                    101  0.70      1
 CBrugiaQ_865  (5 EST) Length=559                               99  0.82      1
 CBrugiaQ_262  (2 EST) Length=1041                              96  0.96      1
 CBrugiaQ_152  (2 EST) Length=724                               94  0.991     1



>886509  (1 EST) Length=328
  Length = 328

  Plus Strand HSPs:

 Score = 1612 (445.4 bits), Expect = 3.0e-131, P = 3.0e-131
 Identities = 324/328 (98%), Positives = 324/328 (98%), Strand = Plus / Plus

Query:     1 AACAATCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGTGATCAGTTTT 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 AACAATCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGTGATCAGTTTT 60

Query:    61 TATTCAACTAATTTACTTCCTTTCAAGAAAAACTAGCATATAAGACAATTGTTTTTACGG 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 TATTCAACTAATTTACTTCCTTTCAAGAAAAACTAGCATATAAGACAATTGTTTTTACGG 120

Query:   121 TAAATTTTTTCCGGATTTATCAATCGGATTTTGAANGCAGTAACGAAATTATTNTTTATA 180
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct:   121 TAAATTTTTTCCGGATTTATCAATCGGATTTTGAANGCAGTAACGAAATTATTNTTTATA 180

Query:   181 ACGAAATATATCATTTCGGCGTGCGGATTGCCGGATGGCGATGCCGCCGACATCCGCACC 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 ACGAAATATATCATTTCGGCGTGCGGATTGCCGGATGGCGATGCCGCCGACATCCGCACC 240

Query:   241 CGGGAAAATTCGATCATGATTCTTCCAGTGTTGATACTATAAATTTACGAATGATCTTAT 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 CGGGAAAATTCGATCATGATTCTTCCAGTGTTGATACTATAAATTTACGAATGATCTTAT 300

Query:   301 GATGGAAAGACAAAGAATTCCATTANNT 328
             |||||||||||||||||||||||||  |
Sbjct:   301 GATGGAAAGACAAAGAATTCCATTANNT 328


>CBrugiaQ_519  (3 EST) Length=569
  Length = 569

  Plus Strand HSPs:

 Score = 395 (109.1 bits), Expect = 3.7e-65, Sum P(3) = 3.7e-65
 Identities = 81/84 (96%), Positives = 81/84 (96%), Strand = Plus / Plus

Query:     4 AATCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGTGATCAGTTTTTAT 63
             || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct:    13 AACCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGTGATCAGTTTCTAT 72

Query:    64 TCAACTAATTTACTTCCTTTCAAG 87
             |||||||||||||||||||||| |
Sbjct:    73 TCAACTAATTTACTTCCTTTCANG 96

 Score = 277 (76.5 bits), Expect = 3.7e-65, Sum P(3) = 3.7e-65
 Identities = 57/59 (96%), Positives = 57/59 (96%), Strand = Plus / Plus

Query:   241 CGGGAAAATTCGATCATGATTCTTCCAGTGTTGATACTATAAATTTACGAATGATCTTA 299
             | |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct:   139 CCGGAAAATTCGATCATGATTCTTCCAGTGTTGATACTATAAATTTACGATTGATCTTA 197

 Score = 233 (64.4 bits), Expect = 3.7e-65, Sum P(3) = 3.7e-65
 Identities = 49/52 (94%), Positives = 49/52 (94%), Strand = Plus / Plus

Query:   198 GGCGTGCGGATTGCCGGATGGCGATGCCGCCGACATCCGCACCCGGGAAAAT 249
             ||||||||||||||||||||||||||||||||||||||||| |||| ||| |
Sbjct:    97 GGCGTGCGGATTGCCGGATGGCGATGCCGCCGACATCCGCAGCCGGAAAATT 148

 Score = 166 (45.9 bits), Expect = 6.2e-42, Sum P(3) = 6.2e-42
 Identities = 54/80 (67%), Positives = 54/80 (67%), Strand = Plus / Plus

Query:     1 AACAATCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGTGATCAGTTTT 60
             | ||||||||||||||||||||| |||  ||| |||||| |||  | |    |   | ||
Sbjct:    14 ACCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGTGATCAGTTTCTATT 73

Query:    61 TATTCAACTAATTTACTTCC 80
              |   || | | || ||| |
Sbjct:    74 CAACTAATTTACTTCCTTTC 93

 Score = 152 (42.0 bits), Expect = 2.1e-40, Sum P(3) = 2.1e-40
 Identities = 36/43 (83%), Positives = 36/43 (83%), Strand = Plus / Plus

Query:     5 ATCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATC 47
             || || ||||||||||||||||| |||  ||| |||||| |||
Sbjct:    10 ATAAACCAATCAATCAATCAATCAATCGATCATTCAATCAATC 52

 Score = 138 (38.1 bits), Expect = 5.9e-39, Sum P(3) = 5.9e-39
 Identities = 34/42 (80%), Positives = 34/42 (80%), Strand = Plus / Plus

Query:     9 ATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGT 50
             || || ||||||||||||| |||| || |||| || |||| |
Sbjct:    10 ATAAACCAATCAATCAATCAATCAATCGATCATTCAATCAAT 51

 Score = 126 (34.8 bits), Expect = 9.3e-38, Sum P(3) = 9.3e-38
 Identities = 30/36 (83%), Positives = 30/36 (83%), Strand = Plus / Plus

Query:    17 ATCAATCAATCGATCATTCAATCAATCGATCAGTGA 52
             || || ||||| |||| ||||||||||||||| | |
Sbjct:    10 ATAAACCAATCAATCAATCAATCAATCGATCATTCA 45


>444799  (1 EST) Length=68
  Length = 68

  Plus Strand HSPs:

 Score = 233 (64.4 bits), Expect = 1.5e-13, P = 1.5e-13
 Identities = 55/68 (80%), Positives = 55/68 (80%), Strand = Plus / Plus

Query:    56 GTTTTTATTCAACTAATTTACTTCCTTTCAAGAAAAACTAGCATATAAGACAATTGTTTT 115
             ||||  |||||||||||| ||||||    |||||||||||  |||||| |||||||||  
Sbjct:     1 GTTTCAATTCAACTAATTNACTTCCNAANAAGAAAAACTANTATATAANACAATTGTTGG 60

Query:   116 TACGGTAA 123
              |||||||
Sbjct:    61 GACGGTAA 68


>706152  (1 EST) Length=193
  Length = 193

  Minus Strand HSPs:

 Score = 153 (42.3 bits), Expect = 3.2e-05, P = 3.2e-05
 Identities = 33/36 (91%), Positives = 33/36 (91%), Strand = Minus / Plus

Query:    43 GATTGATTGAATGATCGATTGATTGATTGATTGATT 8
             |||||||||| ||||||||||||||||||  |||||
Sbjct:    34 GATTGATTGATTGATCGATTGATTGATTGGATGATT 69

 Score = 140 (38.7 bits), Expect = 0.00042, P = 0.00042
 Identities = 32/37 (86%), Positives = 32/37 (86%), Strand = Minus / Plus

Query:    40 TGATTGAATGATCGATTGATTGATTGATTGATTGATT 4
             ||||||| |||| ||| |||||||||||||  |||||
Sbjct:    33 TGATTGATTGATTGATCGATTGATTGATTGGATGATT 69

 Score = 134 (37.0 bits), Expect = 0.0014, P = 0.0014
 Identities = 30/34 (88%), Positives = 30/34 (88%), Strand = Minus / Plus

Query:    36 TGAATGATCGATTGATTGATTGATTGATTGATTG 3
             ||  |||| ||||||||||| |||||||||||||
Sbjct:    29 TGTCTGATTGATTGATTGATCGATTGATTGATTG 62

 Score = 117 (32.3 bits), Expect = 0.040, P = 0.039
 Identities = 25/27 (92%), Positives = 25/27 (92%), Strand = Minus / Plus

Query:    27 GATTGATTGATTGATTGATTGATTGTT 1
             ||||||||||||||| ||||||||| |
Sbjct:    34 GATTGATTGATTGATCGATTGATTGAT 60

 Score = 102 (28.2 bits), Expect = 0.77, P = 0.54
 Identities = 22/24 (91%), Positives = 22/24 (91%), Strand = Minus / Plus

Query:    24 TGATTGATTGATTGATTGATTGTT 1
             |||||||||||||||| ||||| |
Sbjct:    33 TGATTGATTGATTGATCGATTGAT 56

 Score = 91 (25.1 bits), Expect = 6.8, P = 1.0
 Identities = 23/29 (79%), Positives = 23/29 (79%), Strand = Minus / Plus

Query:    52 TCACTGATCGATTGATTGAATGATCGATT 24
             | | ||||||||||||||| ||   ||||
Sbjct:    41 TGATTGATCGATTGATTGATTGGATGATT 69


>1048145  (1 EST) Length=424
  Length = 424

  Plus Strand HSPs:

 Score = 116 (32.1 bits), Expect = 0.061, P = 0.059
 Identities = 36/52 (69%), Positives = 36/52 (69%), Strand = Plus / Plus

Query:     4 AATCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGTGATCA 55
             |||| || || | ||||||||||| | || |  || || | |||  | || |
Sbjct:   295 AATCTATTAACCGATCAATCAATCAACCAGTTGATGAAACCATCCATAATGA 346

 Score = 103 (28.5 bits), Expect = 0.77, P = 0.54
 Identities = 39/62 (62%), Positives = 39/62 (62%), Strand = Plus / Plus

Query:     1 AACAATCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCAGTGATCAGTTTT 60
             | ||||||||||| || |  || || | |||  | |   ||  ||| | |  |  || ||
Sbjct:   308 ATCAATCAATCAACCAGTTGATGAAACCATCCATAATGAAACGGATGAATTTTTTGTATT 367

Query:    61 TA 62
             ||
Sbjct:   368 TA 369

 Score = 96 (26.5 bits), Expect = 3.0, P = 0.95
 Identities = 32/48 (66%), Positives = 32/48 (66%), Strand = Plus / Plus

Query:     1 AACAATCAATCAATCAATCAATCAATCGATCATTCAATCAATCGATCA 48
             | | || || | ||||||||||||| |  |   | || | ||| || |
Sbjct:   296 ATCTATTAACCGATCAATCAATCAACCAGTTGATGAAACCATCCATAA 343


>636417  (1 EST) Length=245
  Length = 245

  Plus Strand HSPs:

 Score = 114 (31.5 bits), Expect = 0.079, P = 0.076
 Identities = 26/30 (86%), Positives = 26/30 (86%), Strand = Plus / Plus

Query:    28 GATCATTCAATCAATCGATCAGTGATCAGT 57
             ||| || | |||||||||||||| ||||||
Sbjct:    47 GATAATACTATCAATCGATCAGTAATCAGT 76


>885570  (1 EST) Length=613
  Length = 613

  Minus Strand HSPs:

 Score = 101 (27.9 bits), Expect = 1.2, P = 0.70
 Identities = 29/40 (72%), Positives = 29/40 (72%), Strand = Minus / Plus

Query:   321 GGAATTCTTTGTCTTTCCATCATAAGATCATTCGTAAATT 282
             |||| ||||||||||||  ||||      ||||||| | |
Sbjct:   142 GGAAATCTTTGTCTTTCGCTCATTTCGCTATTCGTATAGT 181


>CBrugiaQ_865  (5 EST) Length=559
  Length = 559

  Minus Strand HSPs:

 Score = 99 (27.4 bits), Expect = 1.7, P = 0.82
 Identities = 31/45 (68%), Positives = 31/45 (68%), Strand = Minus / Plus

Query:    74 AAATTAGTTGAATAAAAACTGATCACTGATCGATTGATTGAATGA 30
             || | | |||||||||||| ||||| | |   | |||  | || |
Sbjct:    46 AACTCAATTGAATAAAAACAGATCAATAACGAAATGAGAGGATAA 90


>CBrugiaQ_262  (2 EST) Length=1041
  Length = 1041

  Plus Strand HSPs:

 Score = 96 (26.5 bits), Expect = 3.3, P = 0.96
 Identities = 24/30 (80%), Positives = 24/30 (80%), Strand = Plus / Plus

Query:     1 AACAATCAATCAATCAATCAATCAATCGAT 30
             ||  | |||  || ||||||||||||||||
Sbjct:    11 AAAGAACAAGAAAACAATCAATCAATCGAT 40


>CBrugiaQ_152  (2 EST) Length=724
  Length = 724

  Minus Strand HSPs:

 Score = 94 (26.0 bits), Expect = 4.7, P = 0.99
 Identities = 38/62 (61%), Positives = 38/62 (61%), Strand = Minus / Plus

Query:   117 TAAAAACAATTGTCTTATATGCTAGTTTTTCTTGAAAGGAAGTAAATTAGTTGAATAAAA 58
             |||| | || ||  |||  |      ||    || || ||||||||||| ||  |  |||
Sbjct:   409 TAAACAAAAATGGATTAATTAAAGAATTCATATGTAATGAAGTAAATTATTTCTAACAAA 468

Query:    57 AC 56
             ||
Sbjct:   469 AC 470


Parameters:

  V=500
  B=250
  -ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same

  Query
  Strand MatID  Length  Eff.Length   E    S  W   T  X     E2  S2
   +1      0      328       324      10. 87 11 N/A 73   0.022 76
   -1      0      328       324      10. 87 11 N/A 73   0.022 76


Statistics:
  Query          Expected         Observed           HSPs       HSPs
  Strand MatID  High Score       High Score       Reportable  Reported
   +1      0    95 (26.3 bits)  1612 (445.4 bits)      14         14
   -1      0    95 (26.3 bits)   153 (42.3 bits)        9          9

  Query         Neighborhd  Word      Excluded    Failed   Successful  Overlaps
  Strand MatID   Words      Hits        Hits    Extensions Extensions  Excluded
   +1      0       302         460         161         252       48        15
   -1      0       302         293          37         228       29         1

  Database:  consensus
    Release date:  unknown
    Posted date:  12:46 PM EST Feb 4, 1998
  # of letters in database:  1,759,974
  # of sequences in database:  4509
  # of database sequences satisfying E:  10
  No. of states in DFA:  176 (176 KB)
  Total size of DFA:  184 KB (192 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Real: 00:00:00
  No. of processors used:  4
  Time to search database:  0.08u 0.01s 0.09t  Real: 00:00:00
  Total cpu time:  0.10u 0.04s 0.14t  Real: 00:00:00

Date: 17:24:16 on Mon 18 Dec 117.