blastn_self_files/CBrugiaQ_266_blastn.Z


BLASTN 1.4.8MP [1-Jun-95] [Build 09:04:03 Jun  6 1995]

Reference:  Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers,
and David J. Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol.
215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  CBrugiaQ_266
        (795 letters)

Database:  consensus
           4509 sequences; 1,759,974 total letters.
Searching..................................................done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

 CBrugiaQ_266  (2 EST) Length=795                             3863  7.4e-319  1
 1153943  (1 EST) Length=337                                   314  8.5e-23   2
 800307  (1 EST) Length=403                                    135  0.00039   2
 1261909  (1 EST) Length=457                                   132  0.0076    1
 CBrugiaQ_2102  (3 EST) Length=528                             126  0.025     1
 CBrugiaQ_262  (2 EST) Length=1041                             126  0.026     1
 747330  (1 EST) Length=514                                    124  0.036     1
 CBrugiaQ_687  (2 EST) Length=774                              120  0.080     1
 444592  (1 EST) Length=400                                    115  0.18      1
 445907  (1 EST) Length=514                                    112  0.31      1
 749664  (1 EST) Length=599                                    111  0.37      1
 749715  (1 EST) Length=487                                    100  0.98      1
 CBrugiaQ_2447  (14 EST) Length=665                             98  0.997     1
 1386078  (1 EST) Length=500                                    97  0.999     1
 1381444  (1 EST) Length=371                                    95  0.99993   1
 CBrugiaQ_2042  (4 EST) Length=421                              95  0.99994   1



>CBrugiaQ_266  (2 EST) Length=795
  Length = 795

  Plus Strand HSPs:

 Score = 3863 (1067.4 bits), Expect = 7.4e-319, P = 7.4e-319
 Identities = 779/795 (97%), Positives = 779/795 (97%), Strand = Plus / Plus

Query:     1 GCCAGTTGNGGGCAAAAAGGTAAATGTTTGTAAATACCGCAAATTGTCCTGGTAATTGTG 60
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 GCCAGTTGNGGGCAAAAAGGTAAATGTTTGTAAATACCGCAAATTGTCCTGGTAATTGTG 60

Query:    61 GGTTTGGGCGCCNAAAATTTTGTCCANGTTGTCCCCAAACGTTGCCGTTATTNAGTTCAC 120
             |||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||
Sbjct:    61 GGTTTGGGCGCCNAAAATTTTGTCCANGTTGTCCCCAAACGTTGCCGTTATTNAGTTCAC 120

Query:   121 CCAAAACCTGGTTGCAAGTATTGCNTGCCTGGGAAGGCCTTCGGGTGCATATTGACGATA 180
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct:   121 CCAAAACCTGGTTGCAAGTATTGCNTGCCTGGGAAGGCCTTCGGGTGCATATTGACGATA 180

Query:   181 TTGTTGCTGTGAATAGAATTGCTGGGCAGCAGTAATAACATTTGTCGAATTTTGAACCGA 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 TTGTTGCTGTGAATAGAATTGCTGGGCAGCAGTAATAACATTTGTCGAATTTTGAACCGA 240

Query:   241 CTGTGCTTGTTGCTGTTGTATTAACTTTGAAAAAATCCTGTGCCGAAGTGGTAATGGTGG 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 CTGTGCTTGTTGCTGTTGTATTAACTTTGAAAAAATCCTGTGCCGAAGTGGTAATGGTGG 300

Query:   301 TAGTGCATGATGTTGTTGGTGCAGAAATCTGTTGTTGTTGCTGCTGTTGCTGTTGTTGCT 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 TAGTGCATGATGTTGTTGGTGCAGAAATCTGTTGTTGTTGCTGCTGTTGCTGTTGTTGCT 360

Query:   361 GCGGTCTAACAGCTGCAATTTGTTGATTTGAACCGAAATATTGTGTCCCCAACATCATAT 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   361 GCGGTCTAACAGCTGCAATTTGTTGATTTGAACCGAAATATTGTGTCCCCAACATCATAT 420

Query:   421 AGCATTGGCCATTATGGTGAACAAGCATGAACTGTCCAGGCGACGCAGAACTTAGCATTA 480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   421 AGCATTGGCCATTATGGTGAACAAGCATGAACTGTCCAGGCGACGCAGAACTTAGCATTA 480

Query:   481 ACGGTGCTAGCGGAACCATTTGAGTAGCAGAAGATGAACAGACGACTGCGGTCGAAGTGT 540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   481 ACGGTGCTAGCGGAACCATTTGAGTAGCAGAAGATGAACAGACGACTGCGGTCGAAGTGT 540

Query:   541 TTGTCTTATCAGTGGAGTCCTTTTTACTACGAGATGCTGCTTTACGGCGACTTTATGGCG 600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   541 TTGTCTTATCAGTGGAGTCCTTTTTACTACGAGATGCTGCTTTACGGCGACTTTATGGCG 600

Query:   601 CTGGTTGTGGTGTTGATGATGTTGAAGAAGCCCTCGTGCCGAATCTTCTACNACTTGCTG 660
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct:   601 CTGGTTGTGGTGTTGATGATGTTGAAGAAGCCCTCGTGCCGAATCTTCTACNACTTGCTG 660

Query:   661 ANATTGTNGTTGCTTCTTCAGCTGCTGCNCTACCTTCAGCGCTAACATTAGTTGCATTTA 720
             | ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct:   661 ANATTGTNGTTGCTTCTTCAGCTGCTGCNCTACCTTCAGCGCTAACATTAGTTGCATTTA 720

Query:   721 TTGTATCCGATATTACNCTCTTACTCGATGATGACACAGNNATGNTAGCAGAGGCTGANG 780
             |||||||||||||||| ||||||||||||||||||||||  ||| ||||||||||||| |
Sbjct:   721 TTGTATCCGATATTACNCTCTTACTCGATGATGACACAGNNATGNTAGCAGAGGCTGANG 780

Query:   781 TNACTTGCATTGNAT 795
             | |||||||||| ||
Sbjct:   781 TNACTTGCATTGNAT 795


>1153943  (1 EST) Length=337
  Length = 337

  Minus Strand HSPs:

 Score = 314 (86.8 bits), Expect = 8.5e-23, Sum P(2) = 8.5e-23
 Identities = 78/97 (80%), Positives = 78/97 (80%), Strand = Minus / Plus

Query:   428 CCAATGCTATATGATGTTGGGGACACAATATTTCGGTTCAAATCAACAAATTGCAGCTGT 369
             |||||||||||||||||  |  ||||||||||||||| ||||||||||||||||||||||
Sbjct:     1 CCAATGCTATATGATGTCTGCAACACAATATTTCGGTACAAATCAACAAATTGCAGCTGT 60

Query:   368 TAGACCGCAGCAACAACAGCAACAGCAGCAACAACAA 332
             |||||||  ||    |||||| ||  |    |||| |
Sbjct:    61 TAGACCGATGCCTTCACAGCAGCAATACGTGCAACCA 97

 Score = 117 (32.3 bits), Expect = 8.5e-23, Sum P(2) = 8.5e-23
 Identities = 33/45 (73%), Positives = 33/45 (73%), Strand = Minus / Plus

Query:    67 CCAAACCCACAATTACCAGGACAATTTGCGGTATTTACAAACATT 23
             ||||| |||  ||||||||||| | |||| ||| |  | | || |
Sbjct:   149 CCAAAGCCATCATTACCAGGACCAGTTGCCGTAGTAGCGACCAGT 193

 Score = 107 (29.6 bits), Expect = 2.1e-05, Sum P(2) = 2.1e-05
 Identities = 23/25 (92%), Positives = 23/25 (92%), Strand = Minus / Plus

Query:   144 GCAATACTTGCAACCAGGTTTTGGG 120
             ||||||| ||||||||||||||| |
Sbjct:    82 GCAATACGTGCAACCAGGTTTTGTG 106


>800307  (1 EST) Length=403
  Length = 403

  Minus Strand HSPs:

 Score = 135 (37.3 bits), Expect = 0.0042, P = 0.0042
 Identities = 31/36 (86%), Positives = 31/36 (86%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACA 330
             || ||| |||||||| ||||| || |||||||||||
Sbjct:   195 ACAGCACCAACAACAACAACAACATCAACAACAACA 230

 Score = 126 (34.8 bits), Expect = 0.00039, Sum P(2) = 0.00039
 Identities = 30/36 (83%), Positives = 30/36 (83%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACA 330
             ||  || |||||||| || ||||| |||||||||||
Sbjct:   216 ACATCAACAACAACAACACCAGCACCAACAACAACA 251

 Score = 124 (34.3 bits), Expect = 0.035, P = 0.035
 Identities = 28/32 (87%), Positives = 28/32 (87%), Strand = Minus / Plus

Query:   361 CAGCAACAACAGCAACAGCAGCAACAACAACA 330
             || |||||||| ||||| || |||||||||||
Sbjct:   202 CAACAACAACAACAACATCAACAACAACAACA 233

 Score = 117 (32.3 bits), Expect = 0.14, P = 0.13
 Identities = 29/36 (80%), Positives = 29/36 (80%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACA 330
             ||  || || || || |||||||| |||||||||||
Sbjct:   177 ACACCAACATCATCATCAACAGCACCAACAACAACA 212

 Score = 117 (32.3 bits), Expect = 0.14, P = 0.13
 Identities = 29/36 (80%), Positives = 29/36 (80%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACA 330
             ||  || || |||||||| || || |||||||||||
Sbjct:   183 ACATCATCATCAACAGCACCAACAACAACAACAACA 218

 Score = 115 (31.8 bits), Expect = 0.0030, Sum P(2) = 0.0030
 Identities = 27/32 (84%), Positives = 27/32 (84%), Strand = Minus / Plus

Query:   361 CAGCAACAACAGCAACAGCAGCAACAACAACA 330
             || |||||||| || || || |||||||||||
Sbjct:   223 CAACAACAACACCAGCACCAACAACAACAACA 254

 Score = 84 (23.2 bits), Expect = 0.00039, Sum P(2) = 0.00039
 Identities = 24/33 (72%), Positives = 24/33 (72%), Strand = Minus / Plus

Query:   624 CAACATCATCAACACCACAACCAGCGCCATAAA 592
             ||||||||||| || ||  |||| |  ||  ||
Sbjct:   181 CAACATCATCATCAACAGCACCAACAACAACAA 213

 Score = 84 (23.2 bits), Expect = 0.00039, Sum P(2) = 0.00039
 Identities = 24/33 (72%), Positives = 24/33 (72%), Strand = Minus / Plus

Query:   624 CAACATCATCAACACCACAACCAGCGCCATAAA 592
             || ||||||||||| ||| | || |  ||  ||
Sbjct:   184 CATCATCATCAACAGCACCAACAACAACAACAA 216


>1261909  (1 EST) Length=457
  Length = 457

  Plus Strand HSPs:

 Score = 132 (36.5 bits), Expect = 0.0076, P = 0.0076
 Identities = 28/30 (93%), Positives = 28/30 (93%), Strand = Plus / Plus

Query:   329 CTGTTGTTGTTGCTGCTGTTGCTGTTGTTG 358
             |||||||||||||||||| ||||||||| |
Sbjct:   142 CTGTTGTTGTTGCTGCTGCTGCTGTTGTGG 171

 Score = 131 (36.2 bits), Expect = 0.0093, P = 0.0092
 Identities = 31/37 (83%), Positives = 31/37 (83%), Strand = Plus / Plus

Query:   329 CTGTTGTTGTTGCTGCTGTTGCTGTTGTTGCTGCGGT 365
             | ||||||||||||| ||||| || || |||||| ||
Sbjct:   130 CGGTTGTTGTTGCTGTTGTTGTTGCTGCTGCTGCTGT 166

 Score = 118 (32.6 bits), Expect = 0.12, P = 0.11
 Identities = 30/38 (78%), Positives = 30/38 (78%), Strand = Plus / Plus

Query:   327 ATCTGTTGTTGTTGCTGCTGTTGCTGTTGTTGCTGCGG 364
             | ||||||  |||| || || || |||||||||||| |
Sbjct:   122 AGCTGTTGCGGTTGTTGTTGCTGTTGTTGTTGCTGCTG 159

 Score = 109 (30.1 bits), Expect = 0.66, P = 0.48
 Identities = 37/56 (66%), Positives = 37/56 (66%), Strand = Plus / Plus

Query:   309 GATGTTGTTGGTGCAGAAATCTGTTGTTGTTGCTGCTGTTGCTGTTGTTGCTGCGG 364
             | | | ||  || |  ||    | |||||  | || |||||||||||||| ||| |
Sbjct:   101 GCTTTAGTCCGTTCTAAACGGAGCTGTTGCGGTTGTTGTTGCTGTTGTTGTTGCTG 156


>CBrugiaQ_2102  (3 EST) Length=528
  Length = 528

  Minus Strand HSPs:

 Score = 126 (34.8 bits), Expect = 0.025, P = 0.025
 Identities = 30/36 (83%), Positives = 30/36 (83%), Strand = Minus / Plus

Query:   364 CCGCAGCAACAACAGCAACAGCAGCAACAACAACAG 329
             ||  | |||||||| ||||| || ||||||||||||
Sbjct:   203 CCCAAACAACAACAACAACAACAACAACAACAACAG 238

 Score = 122 (33.7 bits), Expect = 0.054, P = 0.053
 Identities = 30/37 (81%), Positives = 30/37 (81%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACAG 329
             ||  || |||||  |||||||  ||||||||||||||
Sbjct:   226 ACAACAACAACAGGAGCAACAAGAGCAACAACAACAG 262

 Score = 122 (33.7 bits), Expect = 0.054, P = 0.053
 Identities = 42/64 (65%), Positives = 42/64 (65%), Strand = Minus / Plus

Query:   393 GTTCAAATCAACAAATTGCAGCTGTTAGACCGCAGCAACAACAGCAACAGCAGCAACAAC 334
             ||  || ||  | |||     || | | | | |   ||||||| ||||| || |||||||
Sbjct:   171 GTCGAATTCCTCCAATGTATCCTTTCATAACTCCCAAACAACAACAACAACAACAACAAC 230

Query:   333 AACA 330
             ||||
Sbjct:   231 AACA 234


>CBrugiaQ_262  (2 EST) Length=1041
  Length = 1041

  Minus Strand HSPs:

 Score = 126 (34.8 bits), Expect = 0.027, P = 0.026
 Identities = 30/36 (83%), Positives = 30/36 (83%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACA 330
             ||  || ||||||||||||||| |||| ||| ||||
Sbjct:   392 ACAACAACAACAACAGCAACAGTAGCAGCAAAAACA 427

 Score = 124 (34.3 bits), Expect = 0.039, P = 0.039
 Identities = 28/32 (87%), Positives = 28/32 (87%), Strand = Minus / Plus

Query:   361 CAGCAACAACAGCAACAGCAGCAACAACAACA 330
             ||||||||||| ||||| ||||||||  ||||
Sbjct:   798 CAGCAACAACAACAACAACAGCAACAGTAACA 829

 Score = 122 (33.7 bits), Expect = 0.058, P = 0.056
 Identities = 30/37 (81%), Positives = 30/37 (81%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACAG 329
             ||  || ||||||||||||||| | || ||||| |||
Sbjct:   803 ACAACAACAACAACAGCAACAGTAACACCAACAGCAG 839

 Score = 122 (33.7 bits), Expect = 0.058, P = 0.056
 Identities = 30/37 (81%), Positives = 30/37 (81%), Strand = Minus / Plus

Query:   361 CAGCAACAACAGCAACAGCAGCAACAACAACAGATTT 325
             ||||| || |||||  ||||||||||| ||||| | |
Sbjct:   834 CAGCAGCAGCAGCAGGAGCAGCAACAATAACAGCTGT 870

 Score = 113 (31.2 bits), Expect = 0.33, P = 0.28
 Identities = 29/37 (78%), Positives = 29/37 (78%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACAG 329
             ||  | ||| || || ||||| || ||||||||||||
Sbjct:   371 ACAACTGCACCACCACCAACAACAACAACAACAACAG 407

 Score = 108 (29.8 bits), Expect = 0.86, P = 0.58
 Identities = 28/36 (77%), Positives = 28/36 (77%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACA 330
             ||  ||  |||||| ||| || || |||||||||||
Sbjct:   362 ACAACAATAACAACTGCACCACCACCAACAACAACA 397

 Score = 104 (28.7 bits), Expect = 1.9, P = 0.85
 Identities = 28/37 (75%), Positives = 28/37 (75%), Strand = Minus / Plus

Query:   365 ACCGCAGCAACAACAGCAACAGCAGCAACAACAACAG 329
             || ||| ||  |||| ||||||||||| || ||  ||
Sbjct:   815 ACAGCAACAGTAACACCAACAGCAGCAGCAGCAGGAG 851

 Score = 101 (27.9 bits), Expect = 3.3, P = 0.96
 Identities = 25/31 (80%), Positives = 25/31 (80%), Strand = Minus / Plus

Query:   360 AGCAACAACAGCAACAGCAGCAACAACAACA 330
             | || ||||| | | ||||||||||| ||||
Sbjct:   328 ACCAGCAACAACTATAGCAGCAACAATAACA 358

 Score = 97 (26.8 bits), Expect = 7.2, P = 1.0
 Identities = 25/32 (78%), Positives = 25/32 (78%), Strand = Minus / Plus

Query:   361 CAGCAACAACAGCAACAGCAGCAACAACAACA 330
             || | | | ||||||||  | |||||||||||
Sbjct:   336 CAACTATAGCAGCAACAATAACAACAACAACA 367


>747330  (1 EST) Length=514
  Length = 514

  Minus Strand HSPs:

 Score = 124 (34.3 bits), Expect = 0.037, P = 0.036
 Identities = 28/32 (87%), Positives = 28/32 (87%), Strand = Minus / Plus

Query:   361 CAGCAACAACAGCAACAGCAGCAACAACAACA 330
             |||| ||||||  ||||||| |||||||||||
Sbjct:   442 CAGCTACAACAATAACAGCAACAACAACAACA 473

 Score = 101 (27.9 bits), Expect = 3.1, P = 0.96
 Identities = 25/31 (80%), Positives = 25/31 (80%), Strand = Minus / Plus

Query:   360 AGCAACAACAGCAACAGCAGCAACAACAACA 330
             | || | ||| ||| | ||||||||||||||
Sbjct:   440 AACAGCTACAACAATAACAGCAACAACAACA 470


>CBrugiaQ_687  (2 EST) Length=774
  Length = 774

  Plus Strand HSPs:

 Score = 120 (33.2 bits), Expect = 0.083, P = 0.080
 Identities = 44/69 (63%), Positives = 44/69 (63%), Strand = Plus / Plus

Query:   300 GTAGTGCATGATGTTGTTGGTGCAGAAATCTGTTGTTGTTGCTGCTGTTGCTGTTGTTGC 359
             ||||   |||||  || |  | | | | |    || | |||  | |||||||||||||| 
Sbjct:   154 GTAGATAATGATAATGGTACTACTGTATTGCCATGATTTTGACGTTGTTGCTGTTGTTGT 213

Query:   360 TGCGGTCTA 368
             || ||  ||
Sbjct:   214 TGGGGCATA 222


>444592  (1 EST) Length=400
  Length = 400

  Plus Strand HSPs:

 Score = 115 (31.8 bits), Expect = 0.20, P = 0.18
 Identities = 27/32 (84%), Positives = 27/32 (84%), Strand = Plus / Plus

Query:   330 TGTTGTTGTTGCTGCTGTTGCTGTTGTTGCTG 361
             ||||||||||| || ||||| |||| ||| ||
Sbjct:   111 TGTTGTTGTTGATGTTGTTGTTGTTATTGATG 142

 Score = 106 (29.3 bits), Expect = 1.2, P = 0.68
 Identities = 28/37 (75%), Positives = 28/37 (75%), Strand = Plus / Plus

Query:   329 CTGTTGTTGTTGCTGCTGTTGCTGTTGTTGCTGCGGT 365
             |||||||||||  || ||||| ||||  ||  || ||
Sbjct:    59 CTGTTGTTGTTATTGTTGTTGNTGTTTCTGTAGCTGT 95

 Score = 105 (29.0 bits), Expect = 1.4, P = 0.75
 Identities = 25/31 (80%), Positives = 25/31 (80%), Strand = Plus / Plus

Query:   330 TGTTGTTGTTGCTGCTGTTGCTGTTGTTGCT 360
             || ||||  ||  ||||||||||| ||||||
Sbjct:    78 TGNTGTTTCTGTAGCTGTTGCTGTNGTTGCT 108

 Score = 102 (28.2 bits), Expect = 2.5, P = 0.92
 Identities = 24/29 (82%), Positives = 24/29 (82%), Strand = Plus / Plus

Query:   330 TGTTGTTGTTGCTGCTGTTGCTGTTGTTG 358
             |||||||| || | |||| ||||||| ||
Sbjct:    72 TGTTGTTGNTGTTTCTGTAGCTGTTGCTG 100

 Score = 99 (27.4 bits), Expect = 4.5, P = 0.99
 Identities = 27/36 (75%), Positives = 27/36 (75%), Strand = Plus / Plus

Query:   330 TGTTGTTGTTGCTGCTGTTGCTGTTGTTGCTGCGGT 365
             ||||||||||| |  || || | |||||| |  |||
Sbjct:   123 TGTTGTTGTTGTTATTGATGTTATTGTTGTTTTGGT 158


>445907  (1 EST) Length=514
  Length = 514

  Minus Strand HSPs:

 Score = 112 (30.9 bits), Expect = 0.37, P = 0.31
 Identities = 38/58 (65%), Positives = 38/58 (65%), Strand = Minus / Plus

Query:   342 AGCAACAACAACAGATTTCTGCACCAACAACATCATGCACTACCACCATTACCACTTC 285
             |||||||||||||   |  | |  ||||||   |    ||||| || ||| | ||| |
Sbjct:   191 AGCAACAACAACATGATGTTACTACAACAATTACTNCTACTACTACTATTGCTACTAC 248


>749664  (1 EST) Length=599
  Length = 599

  Minus Strand HSPs:

 Score = 111 (30.7 bits), Expect = 0.46, P = 0.37
 Identities = 27/33 (81%), Positives = 27/33 (81%), Strand = Minus / Plus

Query:   361 CAGCAACAACAGCAACAGCAGCAACAACAACAG 329
             || |||||||||||| || |||| || || |||
Sbjct:    94 CAACAACAACAGCAATAGTAGCAGCAGCAGCAG 126

 Score = 100 (27.6 bits), Expect = 3.9, P = 0.98
 Identities = 24/29 (82%), Positives = 24/29 (82%), Strand = Minus / Plus

Query:   364 CCGCAGCAACAACAGCAACAGCAGCAACA 336
             | |||||| || |||||||||||| | ||
Sbjct:   115 CAGCAGCAGCAGCAGCAACAGCAGTAGCA 143

 Score = 97 (26.8 bits), Expect = 6.9, P = 1.0
 Identities = 25/32 (78%), Positives = 25/32 (78%), Strand = Minus / Plus

Query:   360 AGCAACAACAGCAACAGCAGCAACAACAACAG 329
             || | || ||||| ||||||||||| ||  ||
Sbjct:   110 AGTAGCAGCAGCAGCAGCAGCAACAGCAGTAG 141


>749715  (1 EST) Length=487
  Length = 487

  Minus Strand HSPs:

 Score = 100 (27.6 bits), Expect = 3.8, P = 0.98
 Identities = 24/29 (82%), Positives = 24/29 (82%), Strand = Minus / Plus

Query:   362 GCAGCAACAACAGCAACAGCAGCAACAAC 334
             |||||||||||| ||||  |  |||||||
Sbjct:    42 GCAGCAACAACAACAACTTCTTCAACAAC 70


>CBrugiaQ_2447  (14 EST) Length=665
  Length = 665

  Minus Strand HSPs:

 Score = 98 (27.1 bits), Expect = 5.8, P = 1.0
 Identities = 30/43 (69%), Positives = 30/43 (69%), Strand = Minus / Plus

Query:   381 AAATTGCAGCTGTTAGACCGCAGCAACAACAGCAACAGCAGCA 339
             |||||||   |  | ||   ||||||  | | |||||||||||
Sbjct:   323 AAATTGCGCTTTCTGGAAAACAGCAAATAGAACAACAGCAGCA 365


>1386078  (1 EST) Length=500
  Length = 500

  Minus Strand HSPs:

 Score = 97 (26.8 bits), Expect = 6.8, P = 1.0
 Identities = 33/50 (66%), Positives = 33/50 (66%), Strand = Minus / Plus

Query:   356 ACAACAGCAACAGCAGCAACAACAACAGATTTCTGCACCAACAACATCAT 307
             ||||    |||| || |||||||||||    |    || | || ||||||
Sbjct:    19 ACAAAGCAAACAACAACAACAACAACACTAATAATAACAATCATCATCAT 68


>1381444  (1 EST) Length=371
  Length = 371

  Plus Strand HSPs:

 Score = 95 (26.3 bits), Expect = 9.6, P = 1.0
 Identities = 43/73 (58%), Positives = 43/73 (58%), Strand = Plus / Plus

Query:   572 AGATGCTGCTTTACGGCGACTTTATGGCGCTGGTTGTGGTGTTGATGATGTTGAAGAAGC 631
             ||||| |     || || |  ||  |  | |||   || |   |  | | ||  ||| | 
Sbjct:   100 AGATGGTAAGACACCGCAAGATTTAGCAGATGGCGATGCTAAAGCAGTTTTTACAGAGGA 159

Query:   632 CCTCGTGCCGAAT 644
             |||||||||||||
Sbjct:   160 CCTCGTGCCGAAT 172


>CBrugiaQ_2042  (4 EST) Length=421
  Length = 421

  Plus Strand HSPs:

 Score = 95 (26.3 bits), Expect = 9.8, P = 1.0
 Identities = 19/19 (100%), Positives = 19/19 (100%), Strand = Plus / Plus

Query:   256 TTGTATTAACTTTGAAAAA 274
             |||||||||||||||||||
Sbjct:     2 TTGTATTAACTTTGAAAAA 20


Parameters:

  V=500
  B=250
  -ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same

  Query
  Strand MatID  Length  Eff.Length   E    S  W   T  X     E2  S2
   +1      0      795       779      10. 92 11 N/A 73   0.022 81
   -1      0      795       779      10. 92 11 N/A 73   0.022 81


Statistics:
  Query          Expected           Observed           HSPs       HSPs
  Strand MatID  High Score         High Score       Reportable  Reported
   +1      0    100 (27.6 bits)  3863 (1067.4 bits)     13         13
   -1      0    100 (27.6 bits)   314 (86.8 bits)      32         32

  Query         Neighborhd  Word      Excluded    Failed   Successful  Overlaps
  Strand MatID   Words      Hits        Hits    Extensions Extensions  Excluded
   +1      0       683         942         296         617       29         1
   -1      0       683         863         131         677       59         5

  Database:  consensus
    Release date:  unknown
    Posted date:  12:46 PM EST Feb 4, 1998
  # of letters in database:  1,759,974
  # of sequences in database:  4509
  # of database sequences satisfying E:  16
  No. of states in DFA:  249 (249 KB)
  Total size of DFA:  265 KB (320 KB)
  Time to generate neighborhood:  0.01u 0.01s 0.02t  Real: 00:00:00
  No. of processors used:  4
  Time to search database:  0.11u 0.02s 0.13t  Real: 00:00:00
  Total cpu time:  0.13u 0.06s 0.19t  Real: 00:00:00

Date: 14:52:22 on Sun 17 Dec 117.