blastn_self_files/CcruzaQ_174_blastn.Z


BLASTN 1.4.8MP [1-Jun-95] [Build 09:04:03 Jun  6 1995]

Reference:  Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers,
and David J. Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol.
215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  CcruzaQ_174
        (636 letters)

Database:  consensus
           3685 sequences; 1,458,175 total letters.
Searching..................................................done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
  Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

 CcruzaQ_174  (77 EST) Length=636                             3138  1.5e-258  1
 CcruzaQ_1895  (4 EST) Length=398                             1342  6.0e-109  1
 1206443  (1 EST) Length=409                                   631  1.0e-83   3
 CcruzaQ_5  (4 EST) Length=677                                 552  1.8e-78   3
 CcruzaQ_724  (6 EST) Length=484                               562  1.0e-69   3
 1782659  (1 EST) Length=340                                   651  5.9e-49   1
 CcruzaQ_228  (3 EST) Length=537                               270  1.2e-14   1
 CcruzaQ_314  (4 EST) Length=772                               175  4.1e-13   2
 CcruzaQ_400  (8 EST) Length=536                               206  7.1e-11   2
 CcruzaQ_415  (8 EST) Length=537                               133  1.2e-08   2
 CcruzaQ_268  (21 EST) Length=553                              121  2.5e-07   3
 1206486  (1 EST) Length=419                                   179  5.4e-07   1
 CcruzaQ_240  (7 EST) Length=551                               155  6.0e-05   1
 CcruzaQ_166  (16 EST) Length=717                              111  0.00025   2
 CcruzaQ_247  (3 EST) Length=544                               145  0.00042   1
 CcruzaQ_351  (5 EST) Length=534                               139  0.0013    1
 1658187  (1 EST) Length=532                                   138  0.0016    1
 CcruzaQ_1955  (4 EST) Length=733                              134  0.0036    1
 CcruzaQ_362  (10 EST) Length=732                              130  0.0078    1
 CcruzaQ_836  (11 EST) Length=834                              130  0.0079    1
 CcruzaQ_572  (2 EST) Length=784                               128  0.012     1
 1618938  (1 EST) Length=267                                   125  0.017     1
 1618939  (1 EST) Length=284                                   125  0.017     1
 CcruzaQ_1283  (9 EST) Length=669                              125  0.020     1
 1619031  (1 EST) Length=271                                   123  0.025     1
 CcruzaQ_275  (6 EST) Length=540                               122  0.035     1
 CcruzaQ_418  (2 EST) Length=530                               121  0.042     1
 1694408  (1 EST) Length=269                                   119  0.054     1
 1619018  (1 EST) Length=267                                   115  0.11      1
 1609597  (1 EST) Length=51                                     94  0.16      1
 1688907  (1 EST) Length=298                                   113  0.17      1
 CcruzaQ_3063  (18 EST) Length=614                             113  0.19      1
 1658180  (1 EST) Length=532                                   112  0.22      1
 CcruzaQ_277  (5 EST) Length=541                               112  0.22      1
 CcruzaQ_357  (3 EST) Length=483                               111  0.26      1
 CcruzaQ_279  (2 EST) Length=542                               111  0.26      1
 1831937  (1 EST) Length=532                                   110  0.30      1
 CcruzaQ_340  (2 EST) Length=644                               110  0.31      1
 1694583  (1 EST) Length=277                                   109  0.32      1
 CcruzaQ_2625  (15 EST) Length=602                             109  0.36      1
 CcruzaQ_2303  (3 EST) Length=428                              107  0.47      1
 1694431  (1 EST) Length=282                                   106  0.51      1
 CcruzaQ_805  (3 EST) Length=531                               106  0.55      1
 1658056  (1 EST) Length=276                                   104  0.64      1
 CcruzaQ_2364  (2 EST) Length=335                              104  0.66      1
 1869006  (1 EST) Length=429                                   103  0.75      1
 1782811  (1 EST) Length=439                                   103  0.75      1
 CcruzaQ_1584  (4 EST) Length=369                              102  0.80      1
 CcruzaQ_183  (2 EST) Length=550                               102  0.82      1
 CcruzaQ_778  (7 EST) Length=587                               102  0.82      1
 1841498  (1 EST) Length=503                                   101  0.87      1
 CcruzaQ_1464  (2 EST) Length=440                               99  0.95      1
 CcruzaQ_327  (7 EST) Length=539                                99  0.95      1
 CcruzaQ_93  (5 EST) Length=850                                 99  0.96      1
 CcruzaQ_3149  (2 EST) Length=268                               98  0.96      1
 CcruzaQ_3121  (2 EST) Length=287                               98  0.97      1
 CcruzaQ_381  (3 EST) Length=586                                97  0.99      1
 1688762  (1 EST) Length=289                                    96  0.993     1
 CcruzaQ_952  (3 EST) Length=664                                96  0.996     1
 1077611  (1 EST) Length=234                                    95  0.997     1
 1792711  (1 EST) Length=255                                    95  0.997     1
 1618988  (1 EST) Length=288                                    94  0.9993    1
 1765771  (1 EST) Length=296                                    94  0.9994    1
 1658049  (1 EST) Length=418                                    94  0.9996    1
 CcruzaQ_184  (2 EST) Length=550                                94  0.9997    1
 CcruzaQ_453  (2 EST) Length=526                                93  0.99994   1
 CcruzaQ_2293  (10 EST) Length=683                              93  0.99995   1



>CcruzaQ_174  (77 EST) Length=636
  Length = 636

  Plus Strand HSPs:

 Score = 3138 (867.1 bits), Expect = 1.5e-258, P = 1.5e-258
 Identities = 630/636 (99%), Positives = 630/636 (99%), Strand = Plus / Plus

Query:     1 GGGGGGGGGGGGNTATTGGCCTCTTAGGCCNATTANTCGCAAANANGCTACTAANTCGGC 60
             |||||||||||| ||||||||||||||||| |||| ||||||| | |||||||| |||||
Sbjct:     1 GGGGGGGGGGGGNTATTGGCCTCTTAGGCCNATTANTCGCAAANANGCTACTAANTCGGC 60

Query:    61 ACGAGGTGTTTTTTTTGTTTTTGTAGAAAACGAAAAGAAAACAACAACAAACCAATCCTA 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 ACGAGGTGTTTTTTTTGTTTTTGTAGAAAACGAAAAGAAAACAACAACAAACCAATCCTA 120

Query:   121 TTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGACGACGGCCACCCAGGTGCATCT 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 TTCTATAGGGCTACGTGTGGGTCACCGTGGCTCAGCGACGACGGCCACCCAGGTGCATCT 180

Query:   181 AACATGTTGCGCCCCCTCCCTGCGCCTGGCCTGAAGGCCGCTCTAAGCGCTGGGCGTCGC 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 AACATGTTGCGCCCCCTCCCTGCGCCTGGCCTGAAGGCCGCTCTAAGCGCTGGGCGTCGC 240

Query:   241 CCTCGCCTTCTTGCTGCTCTTGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTCGGCATCAC 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 CCTCGCCTTCTTGCTGCTCTTGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTCGGCATCAC 300

Query:   301 ACCACCACGCGACAGCGTCACATCCTTCAGGAGCATGCCGAGGTCGTCGTCGTGGCGCAC 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 ACCACCACGCGACAGCGTCACATCCTTCAGGAGCATGCCGAGGTCGTCGTCGTGGCGCAC 360

Query:   361 GGCAAGCGTCACCGTGCGGGGTGTCAGGCGCTTCGGCTTCTTTGCCTGCTGGCTCGCCGC 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   361 GGCAAGCGTCACCGTGCGGGGTGTCAGGCGCTTCGGCTTCTTTGCCTGCTGGCTCGCCGC 420

Query:   421 CTTCACGGACAGCTCCAGCAGCTCGGCTGTCAGGTACTCCAGCACCGCCGCCATGTACAC 480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   421 CTTCACGGACAGCTCCAGCAGCTCGGCTGTCAGGTACTCCAGCACCGCCGCCATGTACAC 480

Query:   481 AGCGCCCGACGCGCCGATGCGGCGGGCATACTGGCCGCGGCGCAGCAGCGAGCCCACACG 540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   481 AGCGCCCGACGCGCCGATGCGGCGGGCATACTGGCCGCGGCGCAGCAGCGAGCCCACACG 540

Query:   541 GCCCACGGGGAAGATCAGACCGGCCTTCGCGGAACGGCCGCAAACTTATCCCTTTAATGA 600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   541 GCCCACGGGGAAGATCAGACCGGCCTTCGCGGAACGGCCGCAAACTTATCCCTTTAATGA 600

Query:   601 AGGTTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 636
             ||||||||||||||||||||||||||||||||||||
Sbjct:   601 AGGTTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 636


>CcruzaQ_1895  (4 EST) Length=398
  Length = 398

  Plus Strand HSPs:

 Score = 1342 (370.8 bits), Expect = 6.0e-109, P = 6.0e-109
 Identities = 270/272 (99%), Positives = 270/272 (99%), Strand = Plus / Plus

Query:   201 TGCGCCTGGCCTGAAGGCCGCTCTAAGCGCTGGGCGTCGCCCTCGCCTTCTTGCTGCTCT 260
             ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   127 TGCGCATGGCCTGAAGGCCGCTCTAAGCGCTGGGCGTCGCCCTCGCCTTCTTGCTGCTCT 186

Query:   261 TGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTCGGCATCACACCACCACGCGACAGCGTCA 320
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   187 TGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTCGGCATCACACCACCACGCGACAGCGTCA 246

Query:   321 CATCCTTCAGGAGCATGCCGAGGTCGTCGTCGTGGCGCACGGCAAGCGTCACCGTGCGGG 380
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   247 CATCCTTCAGGAGCATGCCGAGGTCGTCGTCGTGGCGCACGGCAAGCGTCACCGTGCGGG 306

Query:   381 GTGTCAGGCGCTTCGGCTTCTTTGCCTGCTGGCTCGCCGCCTTCACGGACAGCTCCAGCA 440
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct:   307 GTGTCAGGCGCTTCGGCTTCTTTGCCTGCTGGGTCGCCGCCTTCACGGACAGCTCCAGCA 366

Query:   441 GCTCGGCTGTCAGGTACTCCAGCACCGCCGCC 472
             ||||||||||||||||||||||||||||||||
Sbjct:   367 GCTCGGCTGTCAGGTACTCCAGCACCGCCGCC 398


>1206443  (1 EST) Length=409
  Length = 409

  Minus Strand HSPs:

 Score = 631 (174.4 bits), Expect = 1.0e-83, Sum P(3) = 1.0e-83
 Identities = 127/128 (99%), Positives = 127/128 (99%), Strand = Minus / Plus

Query:   210 GCCAGGCGCAGGGAGGGGGCGCAACATGTTAGATGCACCTGGGTGGCCGTCGTCGCTGAG 151
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    99 GGCAGGCGCAGGGAGGGGGCGCAACATGTTAGATGCACCTGGGTGGCCGTCGTCGCTGAG 158

Query:   150 CCACGGTGACCCACACGTAGCCCTATAGAATAGGATTGGTTTGTTGTTGTTTTCTTTTCG 91
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   159 CCACGGTGACCCACACGTAGCCCTATAGAATAGGATTGGTTTGTTGTTGTTTTCTTTTCG 218

Query:    90 TTTTCTAC 83
             ||||||||
Sbjct:   219 TTTTCTAC 226

 Score = 371 (102.5 bits), Expect = 1.0e-83, Sum P(3) = 1.0e-83
 Identities = 75/76 (98%), Positives = 75/76 (98%), Strand = Minus / Plus

Query:   308 GTGGTGGTGTGATGCCGAGCCTGAACAAGGCGCTGGCGAAGAAGCACAAGAGCAGCAAGA 249
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     3 GGGGTGGTGTGATGCCGAGCCTGAACAAGGCGCTGGCGAAGAAGCACAAGAGCAGCAAGA 62

Query:   248 AGGCGAGGGCGACGCC 233
             ||||||||||||||||
Sbjct:    63 AGGCGAGGGCGACGCC 78

 Score = 125 (34.5 bits), Expect = 1.0e-83, Sum P(3) = 1.0e-83
 Identities = 25/25 (100%), Positives = 25/25 (100%), Strand = Minus / Plus

Query:   233 CCAGCGCTTAGAGCGGCCTTCAGGC 209
             |||||||||||||||||||||||||
Sbjct:    77 CCAGCGCTTAGAGCGGCCTTCAGGC 101


>CcruzaQ_5  (4 EST) Length=677
  Length = 677

  Plus Strand HSPs:

 Score = 552 (152.5 bits), Expect = 1.8e-78, Sum P(3) = 1.8e-78
 Identities = 114/119 (95%), Positives = 114/119 (95%), Strand = Plus / Plus

Query:    92 GAAAAGAAAACAACAACAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGC 151
             |||||  ||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   445 GAAAACGAAAAAACAACAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCACCGTGGC 504

Query:   152 TCAGCGACGACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCGCCTGGC 210
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct:   505 TCAGCGACGACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCCTCCCTGCGCCTGNC 563

 Score = 470 (129.9 bits), Expect = 1.8e-78, Sum P(3) = 1.8e-78
 Identities = 94/94 (100%), Positives = 94/94 (100%), Strand = Plus / Plus

Query:   233 GGCGTCGCCCTCGCCTTCTTGCTGCTCTTGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTC 292
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   584 GGCGTCGCCCTCGCCTTCTTGCTGCTCTTGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTC 643

Query:   293 GGCATCACACCACCACGCGACAGCGTCACATCCT 326
             ||||||||||||||||||||||||||||||||||
Sbjct:   644 GGCATCACACCACCACGCGACAGCGTCACATCCT 677

 Score = 118 (32.6 bits), Expect = 1.8e-78, Sum P(3) = 1.8e-78
 Identities = 24/25 (96%), Positives = 24/25 (96%), Strand = Plus / Plus

Query:   209 GCCTGAAGGCCGCTCTAAGCGCTGG 233
             | |||||||||||||||||||||||
Sbjct:   561 GNCTGAAGGCCGCTCTAAGCGCTGG 585

 Score = 92 (25.4 bits), Expect = 2.1e-38, Sum P(3) = 2.1e-38
 Identities = 20/22 (90%), Positives = 20/22 (90%), Strand = Plus / Plus

Query:    83 GTAGAAAACGAAAAGAAAACAA 104
             |||||||||||||| | |||||
Sbjct:   442 GTAGAAAACGAAAAAACAACAA 463


>CcruzaQ_724  (6 EST) Length=484
  Length = 484

  Plus Strand HSPs:

 Score = 562 (155.3 bits), Expect = 1.0e-69, Sum P(3) = 1.0e-69
 Identities = 122/134 (91%), Positives = 122/134 (91%), Strand = Plus / Plus

Query:    85 AGAAAACGAAAAGAAAACAACAACAAACCAATCCTATTCTATAGGGCTACGTGTGGGTCA 144
             | || | ||||  |||  |  |||||| ||||||||||||||||||||||||||||||||
Sbjct:   264 AAAACAAGAAAGAAAACAACGAACAAAACAATCCTATTCTATAGGGCTACGTGTGGGTCA 323

Query:   145 CCGTGGCTCAGCGACGACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCCTCCCTGCG 204
             ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||
Sbjct:   324 CCGTGGCTCAGCGACGACGGCCACCCAGGTGCATCTAACATGTTGCGCCCCGTCTCTGCG 383

Query:   205 CCTGGCCTGAAGGC 218
             ||||||||||||||
Sbjct:   384 CCTGGCCTGAAGGC 397

 Score = 335 (92.6 bits), Expect = 1.0e-69, Sum P(3) = 1.0e-69
 Identities = 67/67 (100%), Positives = 67/67 (100%), Strand = Plus / Plus

Query:   241 CCTCGCCTTCTTGCTGCTCTTGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTCGGCATCAC 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   418 CCTCGCCTTCTTGCTGCTCTTGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTCGGCATCAC 477

Query:   301 ACCACCA 307
             |||||||
Sbjct:   478 ACCACCA 484

 Score = 117 (32.3 bits), Expect = 1.0e-69, Sum P(3) = 1.0e-69
 Identities = 25/27 (92%), Positives = 25/27 (92%), Strand = Plus / Plus

Query:   215 AGGCCGCTCTAAGCGCTGGGCGTCGCC 241
             | | |||||||||||||||||||||||
Sbjct:   393 AAGGCGCTCTAAGCGCTGGGCGTCGCC 419


>1782659  (1 EST) Length=340
  Length = 340

  Minus Strand HSPs:

 Score = 651 (179.9 bits), Expect = 5.9e-49, P = 5.9e-49
 Identities = 143/159 (89%), Positives = 143/159 (89%), Strand = Minus / Plus

Query:   572 CCGCGAAGGCCGGTCTGATCTTCCCCGTGGGCCGTGTGGGCTCGCTGCTGCGCCGCGGCC 513
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 CCGCGAAGGCCGGTCTGATCTTCCCCGTGGGCCGTGTGGGCTCGCTGCTGCGCCGCGGCC 60

Query:   512 AGTATGCCCGCCGCATCGGCGCGTCGGGCGCTGTGTACATGGCGGCGGTGCTGGAGTACC 453
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AGTATGCCCGCCGCATCGGCGCGTCGGGCGCTGTGTACATGGCGGCGGTGCTGGAGTACC 120

Query:   452 TGACAGCCGAGCTGCTGGAGCTGTCCGTGAAGGCGGCGA 414
             |||| ||    | || || | |||  |||  |  ||| |
Sbjct:   121 TGACGGCGTTTCGGCGGGTGATGTGAGTGGGGCGGGCAA 159


>CcruzaQ_228  (3 EST) Length=537
  Length = 537

  Plus Strand HSPs:

 Score = 270 (74.6 bits), Expect = 1.2e-14, P = 1.2e-14
 Identities = 62/76 (81%), Positives = 62/76 (81%), Strand = Plus / Plus

Query:    83 GTAGAAAACGAAAAGAAAACAACAACAAACCAATCCTATTCTATAGGGCTACGTGTGGGT 142
             ||  ||||| | |||||||| || | ||| |||||||||||||| ||||||| | |  ||
Sbjct:   462 GTNNAAAACAANAAGAAAACNACGAAAAAACAATCCTATTCTATGGGGCTACNTNTNNGT 521

Query:   143 CACCGTGGCTCAGCGA 158
             ||||||||||| ||||
Sbjct:   522 CACCGTGGCTCGGCGA 537


>CcruzaQ_314  (4 EST) Length=772
  Length = 772

  Plus Strand HSPs:

 Score = 175 (48.4 bits), Expect = 4.1e-13, Sum P(2) = 4.1e-13
 Identities = 45/58 (77%), Positives = 45/58 (77%), Strand = Plus / Plus

Query:    67 TGTTTTTTTTGTTTTTGTAGAAAACGAAAAGAAAACAACAACAAACCAATCCTATTCT 124
             | |||||||| ||||| |  |||||  ||| ||||||||||||||| |  | | ||||
Sbjct:    25 TTTTTTTTTTTTTTTTTTTAAAAACTGAAAAAAAACAACAACAAACAANACATCTTCT 82

 Score = 146 (40.3 bits), Expect = 4.1e-13, Sum P(2) = 4.1e-13
 Identities = 54/85 (63%), Positives = 54/85 (63%), Strand = Plus / Plus

Query:   246 CCTTCTTGCTGCTCTTGTGCTTCTTCGCCAGCGCCTTGTTCAGGCTCGGCATCACACCAC 305
             |||||||    |  |||| |||||||||||| ||||          |  |||||||||||
Sbjct:   266 CCTTCTTCTCCCAGTTGTACTTCTTCGCCAGGGCCTCAAGTGTCGGCTCCATCACACCAC 325

Query:   306 CACGCGACAGCGTCACATCCTTCAG 330
             | |||    ||  ||||   | |||
Sbjct:   326 CGCGCAGGCGCAGCACAAGGTGCAG 350


>CcruzaQ_400  (8 EST) Length=536
  Length = 536

  Plus Strand HSPs:

 Score = 206 (56.9 bits), Expect = 7.1e-11, Sum P(2) = 7.1e-11
 Identities = 42/43 (97%), Positives = 42/43 (97%), Strand = Plus / Plus

Query:   577 GCCGCAAACTTATCCCTTTAATGAAGGTTAATTTAACTTGGCA 619
             | |||||||||||||||||||||||||||||||||||||||||
Sbjct:   494 GGCGCAAACTTATCCCTTTAATGAAGGTTAATTTAACTTGGCA 536

 Score = 85 (23.5 bits), Expect = 7.1e-11, Sum P(2) = 7.1e-11
 Identities = 23/31 (74%), Positives = 23/31 (74%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGT 84
             | ||||||||||| |    |||| ||||| |
Sbjct:     1 ATTCGGCACGAGGCGCAACTTTTTTTTTTTT 31


>CcruzaQ_415  (8 EST) Length=537
  Length = 537

  Minus Strand HSPs:

 Score = 133 (36.8 bits), Expect = 1.2e-08, Sum P(2) = 1.2e-08
 Identities = 29/33 (87%), Positives = 29/33 (87%), Strand = Minus / Plus

Query:   609 AATTAACCTTCATTAAAGGGATAAGTTTGCGGC 577
             |||||||||||||||| || ||||| ||||| |
Sbjct:     1 AATTAACCTTCATTAAGGGNATAAGNTTGCGCC 33

 Score = 131 (36.2 bits), Expect = 1.2e-08, Sum P(2) = 1.2e-08
 Identities = 29/33 (87%), Positives = 29/33 (87%), Strand = Minus / Plus

Query:    84 ACAAAAACAAAAAAAACACCTCGTGCCGANTTA 52
             | ||||| |||||||| |||||||||||| |||
Sbjct:   505 AAAAAAAAAAAAAAAAAACCTCGTGCCGATTTA 537


>CcruzaQ_268  (21 EST) Length=553
  Length = 553

  Minus Strand HSPs:

 Score = 121 (33.4 bits), Expect = 2.5e-07, Sum P(3) = 2.5e-07
 Identities = 29/35 (82%), Positives = 29/35 (82%), Strand = Minus / Plus

Query:   636 TTTAAAACGACGGCCAGTGCCAAGTTAAATTAACC 602
             | |||||||||| ||||||||||| |||| | | |
Sbjct:    66 TGTAAAACGACGCCCAGTGCCAAGCTAAAATTAAC 100

 Score = 98 (27.1 bits), Expect = 2.5e-07, Sum P(3) = 2.5e-07
 Identities = 24/31 (77%), Positives = 24/31 (77%), Strand = Minus / Plus

Query:    84 ACAAAAACAAAAAAAACACCTCGTGCCGANT 54
             | ||||| |||  |||  ||||||||||| |
Sbjct:   522 AAAAAAAAAAANNAAAAGCCTCGTGCCGANT 552

 Score = 84 (23.2 bits), Expect = 2.5e-07, Sum P(3) = 2.5e-07
 Identities = 20/24 (83%), Positives = 20/24 (83%), Strand = Minus / Plus

Query:   111 TTTGTTGTTGTTTTCTTTTCGTTT 88
             |||||||||||| | ||||  |||
Sbjct:   403 TTTGTTGTTGTTGTTTTTTTATTT 426


>1206486  (1 EST) Length=419
  Length = 419

  Plus Strand HSPs:

 Score = 179 (49.5 bits), Expect = 5.4e-07, P = 5.4e-07
 Identities = 41/48 (85%), Positives = 41/48 (85%), Strand = Plus / Plus

Query:   589 TCCCTTTAATGAAGGTTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 636
             |||||||| ||| ||| | |||| ||||||||||||||||||||  ||
Sbjct:   326 TCCCTTTAGTGANGGTAATTTTAGCTTGGCACTGGCCGTCGTTTACAA 373


>CcruzaQ_240  (7 EST) Length=551
  Length = 551

  Plus Strand HSPs:

 Score = 155 (42.8 bits), Expect = 6.0e-05, P = 6.0e-05
 Identities = 35/41 (85%), Positives = 35/41 (85%), Strand = Plus / Plus

Query:   577 GCCGCAAACTTATCCCTTTAATGAAGGTTAATTTAACTTGG 617
             | ||||| |||||||| |||||||||||| | ||| |||||
Sbjct:   498 GGCGCAAGCTTATCCCCTTAATGAAGGTTTANTTANCTTGG 538


>CcruzaQ_166  (16 EST) Length=717
  Length = 717

  Plus Strand HSPs:

 Score = 111 (30.7 bits), Expect = 0.00025, Sum P(2) = 0.00025
 Identities = 25/29 (86%), Positives = 25/29 (86%), Strand = Plus / Plus

Query:    52 TAANTCGGCACGAGGTGTTTTTTTTGTTT 80
             |||  ||||||||||| |||||||| |||
Sbjct:    17 TAAAACGGCACGAGGTTTTTTTTTTTTTT 45

 Score = 102 (28.2 bits), Expect = 0.00025, Sum P(2) = 0.00025
 Identities = 22/24 (91%), Positives = 22/24 (91%), Strand = Plus / Plus

Query:   589 TCCCTTTAATGAAGGTTAATTTAA 612
             |||||||| ||||||||||||| |
Sbjct:   687 TCCCTTTAGTGAAGGTTAATTTTA 710


>CcruzaQ_247  (3 EST) Length=544
  Length = 544

  Plus Strand HSPs:

 Score = 145 (40.1 bits), Expect = 0.00042, P = 0.00042
 Identities = 37/47 (78%), Positives = 37/47 (78%), Strand = Plus / Plus

Query:   590 CCCTTTAATGAAGGTTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 636
             || || |   | | | | ||||||||||||||||||||||||||| |
Sbjct:   447 CCTTTAATGAAGGTTAATTTTAACTTGGCACTGGCCGTCGTTTTACA 493

 Score = 111 (30.7 bits), Expect = 0.30, P = 0.26
 Identities = 23/24 (95%), Positives = 23/24 (95%), Strand = Plus / Plus

Query:   589 TCCCTTTAATGAAGGTTAATTTAA 612
             |||||||||||||||||||||| |
Sbjct:   445 TCCCTTTAATGAAGGTTAATTTTA 468


>CcruzaQ_351  (5 EST) Length=534
  Length = 534

  Plus Strand HSPs:

 Score = 139 (38.4 bits), Expect = 0.0013, P = 0.0013
 Identities = 31/35 (88%), Positives = 31/35 (88%), Strand = Plus / Plus

Query:   602 GGTTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 636
             | | | ||||||||||||||||||||||||||| |
Sbjct:   383 GTTAATTTTAACTTGGCACTGGCCGTCGTTTTACA 417


>1658187  (1 EST) Length=532
  Length = 532

  Plus Strand HSPs:

 Score = 138 (38.1 bits), Expect = 0.0016, P = 0.0016
 Identities = 36/47 (76%), Positives = 36/47 (76%), Strand = Plus / Plus

Query:   590 CCCTTTAATGAAGGTTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 636
             || || |   | | | | ||||||||||||||||||||| ||||| |
Sbjct:   461 CCTTTAATGAAGGTTAATTTTAACTTGGCACTGGCCGTCNTTTTACA 507

 Score = 111 (30.7 bits), Expect = 0.30, P = 0.26
 Identities = 23/24 (95%), Positives = 23/24 (95%), Strand = Plus / Plus

Query:   589 TCCCTTTAATGAAGGTTAATTTAA 612
             |||||||||||||||||||||| |
Sbjct:   459 TCCCTTTAATGAAGGTTAATTTTA 482


>CcruzaQ_1955  (4 EST) Length=733
  Length = 733

  Minus Strand HSPs:

 Score = 134 (37.0 bits), Expect = 0.0036, P = 0.0036
 Identities = 42/62 (67%), Positives = 42/62 (67%), Strand = Minus / Plus

Query:   115 TTGGTTTGTTGTTGTTTTCTTTTCGTTTTCTACAAAAACAAAAAAAACACCTCGTGCCGA 56
             ||| ||| || || | ||  || |       | ||||| ||||||||  |||||||||||
Sbjct:   672 TTGTTTTTTTATTTTATTTATTGCCAAACNAAAAAAAAAAAAAAAAAAGCCTCGTGCCGA 731

Query:    55 NT 54
              |
Sbjct:   732 AT 733


>CcruzaQ_362  (10 EST) Length=732
  Length = 732

  Plus Strand HSPs:

 Score = 130 (35.9 bits), Expect = 0.0079, P = 0.0078
 Identities = 36/49 (73%), Positives = 36/49 (73%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGTAGAAAACGAAAAGAAAAC 102
             | |||||||||||  |||||||| ||||| | |   | |||||   |||
Sbjct:     1 AATCGGCACGAGGCTTTTTTTTTTTTTTTTTTGCCTATGAAAAATGAAC 49


>CcruzaQ_836  (11 EST) Length=834
  Length = 834

  Minus Strand HSPs:

 Score = 130 (35.9 bits), Expect = 0.0080, P = 0.0079
 Identities = 30/35 (85%), Positives = 30/35 (85%), Strand = Minus / Plus

Query:   636 TTTAAAACGACGGCCAGTGCCAAGTTAAATTAACC 602
             | |||||||||||||||||||||| |||| | | |
Sbjct:   117 TGTAAAACGACGGCCAGTGCCAAGCTAAAATTAAC 151


>CcruzaQ_572  (2 EST) Length=784
  Length = 784

  Minus Strand HSPs:

 Score = 128 (35.4 bits), Expect = 0.012, P = 0.012
 Identities = 28/31 (90%), Positives = 28/31 (90%), Strand = Minus / Plus

Query:   636 TTTAAAACGACGGCCAGTGCCAAGTTAAATT 606
             |||||||||||||||||||||||| | || |
Sbjct:    52 TTTAAAACGACGGCCAGTGCCAAGCTTAAAT 82


>1618938  (1 EST) Length=267
  Length = 267

  Plus Strand HSPs:

 Score = 125 (34.5 bits), Expect = 0.017, P = 0.017
 Identities = 27/30 (90%), Positives = 27/30 (90%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTG 83
             | |||||||||||| |||||||| ||||||
Sbjct:     5 ATTCGGCACGAGGTTTTTTTTTTTTTTTTG 34


>1618939  (1 EST) Length=284
  Length = 284

  Plus Strand HSPs:

 Score = 125 (34.5 bits), Expect = 0.017, P = 0.017
 Identities = 27/30 (90%), Positives = 27/30 (90%), Strand = Plus / Plus

Query:    53 AANTCGGCACGAGGTGTTTTTTTTGTTTTT 82
             || |||||||||||| |||||||| |||||
Sbjct:     1 AAATCGGCACGAGGTTTTTTTTTTTTTTTT 30


>CcruzaQ_1283  (9 EST) Length=669
  Length = 669

  Minus Strand HSPs:

 Score = 125 (34.5 bits), Expect = 0.021, P = 0.020
 Identities = 27/30 (90%), Positives = 27/30 (90%), Strand = Minus / Plus

Query:    82 AAAAACAAAAAAAACACCTCGTGCCGANTT 53
             ||||| |||||||| |||||||||||| ||
Sbjct:   640 AAAAAAAAAAAAAAAACCTCGTGCCGATTT 669


>1619031  (1 EST) Length=271
  Length = 271

  Plus Strand HSPs:

 Score = 123 (34.0 bits), Expect = 0.025, P = 0.025
 Identities = 33/44 (75%), Positives = 33/44 (75%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGTAGAAAACGAAAAG 97
             | |||||||||||| |||||||| |||     |  |||| ||||
Sbjct:     1 ATTCGGCACGAGGTTTTTTTTTTTTTTGCTCTGGTAACGGAAAG 44


>CcruzaQ_275  (6 EST) Length=540
  Length = 540

  Plus Strand HSPs:

 Score = 122 (33.7 bits), Expect = 0.036, P = 0.035
 Identities = 30/37 (81%), Positives = 30/37 (81%), Strand = Plus / Plus

Query:   576 GGCCGCAAACTTATCCCTTTAATGAAGGTTAATTTAA 612
             |||   || ||  |||||||||||||||||||||| |
Sbjct:   495 GGCGCAAACCTATTCCCTTTAATGAAGGTTAATTTTA 531


>CcruzaQ_418  (2 EST) Length=530
  Length = 530

  Plus Strand HSPs:

 Score = 121 (33.4 bits), Expect = 0.043, P = 0.042
 Identities = 27/31 (87%), Positives = 27/31 (87%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGT 84
             | |||||||||||| |||||||| ||||| |
Sbjct:     1 ATTCGGCACGAGGTTTTTTTTTTTTTTTTAT 31


>1694408  (1 EST) Length=269
  Length = 269

  Plus Strand HSPs:

 Score = 119 (32.9 bits), Expect = 0.055, P = 0.054
 Identities = 29/36 (80%), Positives = 29/36 (80%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGTAGAAA 89
             | |||||||||||| |||||||| ||||   | |||
Sbjct:     1 AATCGGCACGAGGTTTTTTTTTTTTTTTCCAATAAA 36


>1619018  (1 EST) Length=267
  Length = 267

  Plus Strand HSPs:

 Score = 115 (31.8 bits), Expect = 0.12, P = 0.11
 Identities = 33/46 (71%), Positives = 33/46 (71%), Strand = Plus / Plus

Query:    53 AANTCGGCACGAGGTGTTTTTTTTGTTTTTGTAGAAAACGAAAAGA 98
             || ||||||||||| |  |||||| || ||  |  ||| |||  ||
Sbjct:     1 AATTCGGCACGAGGGGCCTTTTTTCTTCTTTGACGAAAAGAAGTGA 46


>1609597  (1 EST) Length=51
  Length = 51

  Plus Strand HSPs:

 Score = 94 (26.0 bits), Expect = 0.17, P = 0.16
 Identities = 22/28 (78%), Positives = 22/28 (78%), Strand = Plus / Plus

Query:     1 GGGGGGGGGGGGNTATTGGCCTCTTAGG 28
             |||||||||||  ||| |||| ||  ||
Sbjct:     1 GGGGGGGGGGGNATATNGGCCGCTNTGG 28


>1688907  (1 EST) Length=298
  Length = 298

  Plus Strand HSPs:

 Score = 113 (31.2 bits), Expect = 0.18, P = 0.17
 Identities = 27/34 (79%), Positives = 27/34 (79%), Strand = Plus / Plus

Query:    51 CTAANTCGGCACGAGGTGTTTTTTTTGTTTTTGT 84
             | || ||| |||||||| |||||||  ||||| |
Sbjct:     2 CCAANTCGNCACGAGGTTTTTTTTTNTTTTTTTT 35


>CcruzaQ_3063  (18 EST) Length=614
  Length = 614

  Plus Strand HSPs:

 Score = 113 (31.2 bits), Expect = 0.21, P = 0.19
 Identities = 41/67 (61%), Positives = 41/67 (61%), Strand = Plus / Plus

Query:    45 ANGCTACTAANTCGGCACGAGGTGTTTTTTTTGTTTTTGTAGAAAACGAAAAGAAAACAA 104
             | || || ||  ||||||||||| ||  || | |||||  |    |   | | | |  ||
Sbjct:    19 ATGCGACAAATACGGCACGAGGTTTTNNTTNTNTTTTTTAAATTCATTCATAAATAGAAA 78

Query:   105 CAACAAA 111
              |||| |
Sbjct:    79 AAACAGA 85


>1658180  (1 EST) Length=532
  Length = 532

  Plus Strand HSPs:

 Score = 112 (30.9 bits), Expect = 0.25, P = 0.22
 Identities = 26/31 (83%), Positives = 26/31 (83%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGT 84
             | |||||||||||  |||||||| ||||| |
Sbjct:     1 AATCGGCACGAGGCTTTTTTTTTTTTTTTCT 31


>CcruzaQ_277  (5 EST) Length=541
  Length = 541

  Plus Strand HSPs:

 Score = 112 (30.9 bits), Expect = 0.25, P = 0.22
 Identities = 28/35 (80%), Positives = 28/35 (80%), Strand = Plus / Plus

Query:   576 GGCCGCAAACTTATCCCTTTAATGAAGGTTAATTT 610
             |||   ||  |  ||||||||||||||||||||||
Sbjct:   418 GGCGCAAACTTATTCCCTTTAATGAAGGTTAATTT 452


>CcruzaQ_357  (3 EST) Length=483
  Length = 483

  Minus Strand HSPs:

 Score = 111 (30.7 bits), Expect = 0.30, P = 0.26
 Identities = 31/43 (72%), Positives = 31/43 (72%), Strand = Minus / Plus

Query:   109 TGTTGTTGTTTTCTTTTCGTTTTCTACAAAAACAAAAAAAACA 67
             | || ||||||||||||   |  |   ||||| |||||||| |
Sbjct:   260 TTTTTTTGTTTTCTTTTTTCTANCCNAAAAAAAAAAAAAAAAA 302


>CcruzaQ_279  (2 EST) Length=542
  Length = 542

  Plus Strand HSPs:

 Score = 111 (30.7 bits), Expect = 0.30, P = 0.26
 Identities = 27/33 (81%), Positives = 27/33 (81%), Strand = Plus / Plus

Query:   604 TTAATTTAACTTGGCACTGGCCGTCGTTTTAAA 636
             | | |||| |||||||||||||  ||||||| |
Sbjct:   422 TAATTTTAGCTTGGCACTGGCCTCCGTTTTACA 454


>1831937  (1 EST) Length=532
  Length = 532

  Plus Strand HSPs:

 Score = 110 (30.4 bits), Expect = 0.36, P = 0.30
 Identities = 26/31 (83%), Positives = 26/31 (83%), Strand = Plus / Plus

Query:    85 AGAAAACGAAAAGAAAACAACAACAAACCAA 115
             ||||||||||||| ||| || || ||||| |
Sbjct:    91 AGAAAACGAAAAGGAAAGAAAAAAAAACCCA 121


>CcruzaQ_340  (2 EST) Length=644
  Length = 644

  Plus Strand HSPs:

 Score = 110 (30.4 bits), Expect = 0.37, P = 0.31
 Identities = 26/32 (81%), Positives = 26/32 (81%), Strand = Plus / Plus

Query:    53 AANTCGGCACGAGGTGTTTTTTTTGTTTTTGT 84
             || |||||||||||   ||||||| ||||| |
Sbjct:     1 AATTCGGCACGAGGNAATTTTTTTTTTTTTTT 32


>1694583  (1 EST) Length=277
  Length = 277

  Plus Strand HSPs:

 Score = 109 (30.1 bits), Expect = 0.39, P = 0.32
 Identities = 31/44 (70%), Positives = 31/44 (70%), Strand = Plus / Plus

Query:    67 TGTTTTTTTTGTTTTTGTAGAAAACGAAAAGAAAACAACAACAA 110
             | |||||||| ||||| |         |||| ||||||||||||
Sbjct:    24 TTTTTTTTTTTTTTTTTTTNGTTGANNAAAGCAAACAACAACAA 67


>CcruzaQ_2625  (15 EST) Length=602
  Length = 602

  Minus Strand HSPs:

 Score = 109 (30.1 bits), Expect = 0.45, P = 0.36
 Identities = 25/29 (86%), Positives = 25/29 (86%), Strand = Minus / Plus

Query:   112 GTTTGTTGTTGTTTTCTTTTCGTTTTCTA 84
             | ||||||| |||||  ||||||||||||
Sbjct:   563 GGTTGTTGTCGTTTTTGTTTCGTTTTCTA 591


>CcruzaQ_2303  (3 EST) Length=428
  Length = 428

  Plus Strand HSPs:

 Score = 107 (29.6 bits), Expect = 0.63, P = 0.47
 Identities = 23/25 (92%), Positives = 23/25 (92%), Strand = Plus / Plus

Query:    66 GTGTTTTTTTTGTTTTTGTAGAAAA 90
             ||||||||||| |||||||||| ||
Sbjct:   327 GTGTTTTTTTTTTTTTTGTAGATAA 351


>1694431  (1 EST) Length=282
  Length = 282

  Plus Strand HSPs:

 Score = 106 (29.3 bits), Expect = 0.70, P = 0.51
 Identities = 26/33 (78%), Positives = 26/33 (78%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGTAG 86
             | |||||||||||  || ||||| ||||| | |
Sbjct:     2 ATTCGGCACGAGGCTTTNTTTTTTTTTTTTTTG 34


>CcruzaQ_805  (3 EST) Length=531
  Length = 531

  Minus Strand HSPs:

 Score = 106 (29.3 bits), Expect = 0.79, P = 0.55
 Identities = 24/28 (85%), Positives = 24/28 (85%), Strand = Minus / Plus

Query:    81 AAAACAAAAAAAACACCTCGTGCCGANT 54
             |||| | |||||| |||||||||||| |
Sbjct:   474 AAAAAATAAAAAAAACCTCGTGCCGATT 501


>1658056  (1 EST) Length=276
  Length = 276

  Plus Strand HSPs:

 Score = 104 (28.7 bits), Expect = 1.0, P = 0.64
 Identities = 26/35 (74%), Positives = 26/35 (74%), Strand = Plus / Plus

Query:     7 GGGGGGNTATTGGCCTCTTAGGCCNATTANTCGCA 41
             |||||  | ||| ||||||||||| |||    |||
Sbjct:     1 GGGGGNTTCTTGNCCTCTTAGGCCNATTTTCGGCA 35


>CcruzaQ_2364  (2 EST) Length=335
  Length = 335

  Plus Strand HSPs:

 Score = 104 (28.7 bits), Expect = 1.1, P = 0.66
 Identities = 22/24 (91%), Positives = 22/24 (91%), Strand = Plus / Plus

Query:     6 GGGGGGGNTATTGGCCTCTTAGGC 29
             ||||||| ||||||||||| ||||
Sbjct:     3 GGGGGGGATATTGGCCTCTGAGGC 26


>1869006  (1 EST) Length=429
  Length = 429

  Plus Strand HSPs:

 Score = 103 (28.5 bits), Expect = 1.4, P = 0.75
 Identities = 31/44 (70%), Positives = 31/44 (70%), Strand = Plus / Plus

Query:    83 GTAGAAAACGAAAAGAAAACAACAACAAACCAATCCTATTCTAT 126
             | | ||||  |||  |||||||||||| ||| ||   ||  |||
Sbjct:   122 GAAAAAAAACAAACAAAAACAACAACACACCGATAAAATGATAT 165


>1782811  (1 EST) Length=439
  Length = 439

  Minus Strand HSPs:

 Score = 103 (28.5 bits), Expect = 1.4, P = 0.75
 Identities = 23/26 (88%), Positives = 23/26 (88%), Strand = Minus / Plus

Query:   110 TTGTTGTTGTTTTCTTTTCGTTTTCT 85
             ||||||||||||| |||| ||||| |
Sbjct:   126 TTGTTGTTGTTTTGTTTTTGTTTTGT 151


>CcruzaQ_1584  (4 EST) Length=369
  Length = 369

  Minus Strand HSPs:

 Score = 102 (28.2 bits), Expect = 1.6, P = 0.80
 Identities = 22/24 (91%), Positives = 22/24 (91%), Strand = Minus / Plus

Query:   612 TTAAATTAACCTTCATTAAAGGGA 589
             | ||||||||| ||||||||||||
Sbjct:     2 TAAAATTAACCCTCATTAAAGGGA 25


>CcruzaQ_183  (2 EST) Length=550
  Length = 550

  Minus Strand HSPs:

 Score = 102 (28.2 bits), Expect = 1.7, P = 0.82
 Identities = 34/51 (66%), Positives = 34/51 (66%), Strand = Minus / Plus

Query:   273 GCGAAGAAGCACAAGAGCAGCAAGAAGGCGAGGGCGACGCCCAGCGCTTAG 223
             ||||||||||||  |  |  |||||||| |  |   | || | ||||  ||
Sbjct:    68 GCGAAGAAGCACTCGGACGCCAAGAAGGAGCTGTACAAGCTCCGCGCGCAG 118


>CcruzaQ_778  (7 EST) Length=587
  Length = 587

  Plus Strand HSPs:

 Score = 102 (28.2 bits), Expect = 1.7, P = 0.82
 Identities = 26/33 (78%), Positives = 26/33 (78%), Strand = Plus / Plus

Query:    85 AGAAAACGAAAAGAAAACAACAACAAACCAATC 117
             | ||| | |||| |||||||||||| |  ||||
Sbjct:    26 ACAAAGCAAAAAAAAAACAACAACACATGAATC 58


>1841498  (1 EST) Length=503
  Length = 503

  Plus Strand HSPs:

 Score = 101 (27.9 bits), Expect = 2.1, P = 0.87
 Identities = 25/31 (80%), Positives = 25/31 (80%), Strand = Plus / Plus

Query:    85 AGAAAACGAAAAGAAAACAACAACAAACCAA 115
             || ||| ||||||||||||| ||  | ||||
Sbjct:    29 AGGAAAAGAAAAGAAAACAATAAACACCCAA 59


>CcruzaQ_1464  (2 EST) Length=440
  Length = 440

  Minus Strand HSPs:

 Score = 99 (27.4 bits), Expect = 3.0, P = 0.95
 Identities = 21/23 (91%), Positives = 21/23 (91%), Strand = Minus / Plus

Query:    75 AAAAAAACACCTCGTGCCGANTT 53
             ||||||| |||||||||||| ||
Sbjct:   410 AAAAAAAAACCTCGTGCCGAATT 432


>CcruzaQ_327  (7 EST) Length=539
  Length = 539

  Plus Strand HSPs:

 Score = 99 (27.4 bits), Expect = 3.1, P = 0.95
 Identities = 21/23 (91%), Positives = 21/23 (91%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTT 76
             | |||||||||||| ||||||||
Sbjct:     3 ANTCGGCACGAGGTTTTTTTTTT 25


>CcruzaQ_93  (5 EST) Length=850
  Length = 850

  Minus Strand HSPs:

 Score = 99 (27.4 bits), Expect = 3.2, P = 0.96
 Identities = 27/36 (75%), Positives = 27/36 (75%), Strand = Minus / Plus

Query:   308 GTGGTGGTGTGATGCCGAGCCTGAACAAGGCGCTGG 273
             ||||||  | | ||| | ||  || |||||||||||
Sbjct:   252 GTGGTGTGGCGCTGCTGCGCGCGAGCAAGGCGCTGG 287


>CcruzaQ_3149  (2 EST) Length=268
  Length = 268

  Plus Strand HSPs:

 Score = 98 (27.1 bits), Expect = 3.3, P = 0.96
 Identities = 22/25 (88%), Positives = 22/25 (88%), Strand = Plus / Plus

Query:    86 GAAAACGAAAAGAAAACAACAACAA 110
             |||||  |||| |||||||||||||
Sbjct:   149 GAAAATAAAAACAAAACAACAACAA 173


>CcruzaQ_3121  (2 EST) Length=287
  Length = 287

  Minus Strand HSPs:

 Score = 98 (27.1 bits), Expect = 3.4, P = 0.97
 Identities = 24/30 (80%), Positives = 24/30 (80%), Strand = Minus / Plus

Query:   117 GATTGGTTTGTTGTTGTTTTCTTTTCGTTT 88
             | || | ||||||||||||| ||| | |||
Sbjct:   203 GGTTTGCTTGTTGTTGTTTTTTTTNCTTTT 232


>CcruzaQ_381  (3 EST) Length=586
  Length = 586

  Plus Strand HSPs:

 Score = 97 (26.8 bits), Expect = 4.5, P = 0.99
 Identities = 23/28 (82%), Positives = 23/28 (82%), Strand = Plus / Plus

Query:    53 AANTCGGCACGAGGTGTTTTTTTTGTTT 80
             || ||||||||||||   |||||| |||
Sbjct:     1 AANTCGGCACGAGGTTGCTTTTTTCTTT 28


>1688762  (1 EST) Length=289
  Length = 289

  Plus Strand HSPs:

 Score = 96 (26.5 bits), Expect = 5.0, P = 0.99
 Identities = 26/35 (74%), Positives = 26/35 (74%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGTAGAA 88
             | |||||||||||  ||| ||| |||| |  | ||
Sbjct:     1 ATTCGGCACGAGGAATTTGTTTAGTTTGTTGAAAA 35


>CcruzaQ_952  (3 EST) Length=664
  Length = 664

  Plus Strand HSPs:

 Score = 96 (26.5 bits), Expect = 5.6, P = 1.0
 Identities = 32/48 (66%), Positives = 32/48 (66%), Strand = Plus / Plus

Query:    64 AGGTGTTTTTTTTGTTTTTGTAGAAAACGAAAAGAAAACAACAACAAA 111
             ||| |  |||  | | ||  |   ||| ||||  | ||||||||||||
Sbjct:   546 AGGAGAATTTAATCTCTTCTTCTTAAAGGAAACAACAACAACAACAAA 593


>1077611  (1 EST) Length=234
  Length = 234

  Plus Strand HSPs:

 Score = 95 (26.3 bits), Expect = 5.7, P = 1.0
 Identities = 23/28 (82%), Positives = 23/28 (82%), Strand = Plus / Plus

Query:    84 TAGAAAACGAAAAGAAAACAACAACAAA 111
             ||||| |  |||| | ||||||||||||
Sbjct:    44 TAGAAGAAAAAAAAACAACAACAACAAA 71


>1792711  (1 EST) Length=255
  Length = 255

  Plus Strand HSPs:

 Score = 95 (26.3 bits), Expect = 5.9, P = 1.0
 Identities = 27/37 (72%), Positives = 27/37 (72%), Strand = Plus / Plus

Query:   451 CAGGTACTCCAGCACCGCCGCCATGTACACAGCGCCC 487
             ||||||||||||  |  ||||||  || ||| | | |
Sbjct:   213 CAGGTACTCCAGGGCATCCGCCAAATATACATCCCAC 249


>1618988  (1 EST) Length=288
  Length = 288

  Plus Strand HSPs:

 Score = 94 (26.0 bits), Expect = 7.3, P = 1.0
 Identities = 24/31 (77%), Positives = 24/31 (77%), Strand = Plus / Plus

Query:    54 ANTCGGCACGAGGTGTTTTTTTTGTTTTTGT 84
             | |||||||||||    ||||| |||||| |
Sbjct:     7 ATTCGGCACGAGGGCCATTTTTAGTTTTTTT 37


>1765771  (1 EST) Length=296
  Length = 296

  Plus Strand HSPs:

 Score = 94 (26.0 bits), Expect = 7.4, P = 1.0
 Identities = 22/26 (84%), Positives = 22/26 (84%), Strand = Plus / Plus

Query:    85 AGAAAACGAAAAGAAAACAACAACAA 110
             | ||||   |||||||||||||||||
Sbjct:   139 ATAAAAAACAAAGAAAACAACAACAA 164


>1658049  (1 EST) Length=418
  Length = 418

  Minus Strand HSPs:

 Score = 94 (26.0 bits), Expect = 7.8, P = 1.0
 Identities = 22/26 (84%), Positives = 22/26 (84%), Strand = Minus / Plus

Query:   110 TTGTTGTTGTTTTCTTTTCGTTTTCT 85
             ||||||||||| | ||||| |||| |
Sbjct:   184 TTGTTGTTGTTGTTTTTTCTTTTTTT 209


>CcruzaQ_184  (2 EST) Length=550
  Length = 550

  Minus Strand HSPs:

 Score = 94 (26.0 bits), Expect = 8.1, P = 1.0
 Identities = 20/22 (90%), Positives = 20/22 (90%), Strand = Minus / Plus

Query:    84 ACAAAAACAAAAAAAACACCTC 63
             | |||||||||||||||||| |
Sbjct:   278 AAAAAAACAAAAAAAACACCNC 299


>CcruzaQ_453  (2 EST) Length=526
  Length = 526

  Minus Strand HSPs:

 Score = 93 (25.7 bits), Expect = 9.7, P = 1.0
 Identities = 25/33 (75%), Positives = 25/33 (75%), Strand = Minus / Plus

Query:   120 TAGGATTGGTTTGTTGTTGTTTTCTTTTCGTTT 88
             |||||    |||||||||||||| | || || |
Sbjct:   229 TAGGAACATTTTGTTGTTGTTTTTTGTTTGTGT 261


>CcruzaQ_2293  (10 EST) Length=683
  Length = 683

  Plus Strand HSPs:

 Score = 93 (25.7 bits), Expect = 10., P = 1.0
 Identities = 21/24 (87%), Positives = 21/24 (87%), Strand = Plus / Plus

Query:    87 AAAACGAAAAGAAAACAACAACAA 110
             ||||| || | |||||||||||||
Sbjct:    57 AAAACAAAGAAAAAACAACAACAA 80


Parameters:

  V=500
  B=250
  -ctxfactor=2.00
  E=10

  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.173   0.357    same    same    same
   -1      0   +5,-4           0.192   0.173   0.357    same    same    same

  Query
  Strand MatID  Length  Eff.Length   E    S  W   T  X     E2  S2
   +1      0      636       630      10. 90 11 N/A 73   0.022 80
   -1      0      636       630      10. 90 11 N/A 73   0.022 80


Statistics:
  Query          Expected         Observed           HSPs       HSPs
  Strand MatID  High Score       High Score       Reportable  Reported
   +1      0    98 (27.1 bits)  3138 (867.1 bits)      57         57
   -1      0    98 (27.1 bits)   651 (179.9 bits)      25         25

  Query         Neighborhd  Word      Excluded    Failed   Successful  Overlaps
  Strand MatID   Words      Hits        Hits    Extensions Extensions  Excluded
   +1      0       590        1632         489        1008      137         4
   -1      0       590        1073         233         766       76         0

  Database:  consensus
    Release date:  unknown
    Posted date:  9:10 AM EDT Sep 24, 1998
  # of letters in database:  1,458,175
  # of sequences in database:  3685
  # of database sequences satisfying E:  67
  No. of states in DFA:  244 (244 KB)
  Total size of DFA:  258 KB (320 KB)
  Time to generate neighborhood:  0.01u 0.00s 0.01t  Real: 00:00:00
  No. of processors used:  1
  Time to search database:  0.07u 0.01s 0.08t  Real: 00:00:00
  Total cpu time:  0.10u 0.02s 0.12t  Real: 00:00:00

Date: 16:24:50 on Sun 17 Dec 117.